Produção Proteínas Recombinantes

48.453 visualizações

Publicada em

Publicada em: Saúde e medicina
0 comentários
4 gostaram
Estatísticas
Notas
  • Seja o primeiro a comentar

Sem downloads
Visualizações
Visualizações totais
48.453
No SlideShare
0
A partir de incorporações
0
Número de incorporações
219
Ações
Compartilhamentos
0
Downloads
1.004
Comentários
0
Gostaram
4
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Produção Proteínas Recombinantes

  1. 1. Produção de Proteínas Recombinantes
  2. 2. <ul><li>O que são proteínas recombinantes? </li></ul><ul><li>São proteínas produzidas artificialmente a partir de genes clonados. Isto é, advêm da técnica de DNA recombinante. </li></ul><ul><li>Para que servem? </li></ul><ul><li> A produção de proteínas recombinantes permite obter benefícios em várias áreas: </li></ul><ul><li> - saúde; </li></ul><ul><li> - biologia; </li></ul><ul><li> - bioquímica; </li></ul><ul><li> - microbiologia; </li></ul><ul><li> - genética; </li></ul><ul><li> - biotecnologia; </li></ul><ul><li> - agricultura; </li></ul><ul><li> - etc. </li></ul>
  3. 3. <ul><li>Terapia gênica </li></ul><ul><li>Possibilidade de introdução de um gene num organismo e </li></ul><ul><li>consequente correção de doenças genéticas. </li></ul><ul><li>Melhoramento animal e vegetal </li></ul><ul><li>Plantas resistentes a pragas e a </li></ul><ul><li>diferentes meios nutritivos. </li></ul><ul><li>Animais de maiores dimensões, </li></ul><ul><li>mais férteis e carne com maior qualidade. </li></ul><ul><li>Criação de modelos animais </li></ul><ul><li>Ideais para o estudo da estrutura, função e regulação de um gene, além de facilitar a compreensão da fisiopatologia da doença. </li></ul>Algumas aplicações www.dqb.fc.ul.pt
  4. 4. Técnica de produção de proteínas recombinantes <ul><li>Isolar e preparar o DNA; </li></ul><ul><li>Escolher o vetor apropriado; </li></ul><ul><li>O fragmento de DNA a clonar é introduzido em vectores de clonagem, formando-se o DNA recombinante. </li></ul><ul><li>O DNA recombinante é inserido na célula hospedeira – transformação, que possui mecanismos enzimáticos para a replicação do DNA e para a síntese protéica; </li></ul><ul><li>Selecção e identificação de células que incorporam o DNA recombinante; </li></ul><ul><li>Verificar se a proteína foi expressa; </li></ul><ul><li>Remoção e purificação das proteínas. </li></ul>The Cell- A Molecular Approach; Cooper, Geoffrey M..
  5. 5. Algumas enzimas envolvidas no processo <ul><li>Enzimas de restrição- Endonucleases </li></ul><ul><ul><li>Os fragmentos de DNA usados para criar moléculas recombinantes são normalmente gerados por digestão através de endonucleases de restrição ou PCR </li></ul></ul><ul><ul><li>. Conhecem pequenas sequências específicas com 4 a 6 pares de bases. </li></ul></ul><ul><ul><li>. São designadas por três letras: EcoRI, HindIII. </li></ul></ul>Produz uma molécula de DNA através de uma molécula de RNA. Transcriptase reversa Adiciona os nucleotídeos na extremidade 3´ da cadeia de DNA. Taq DNA polimerase Juntam duas moléculas de DNA ou fragmentos. DNA ligase Cortam os DNAs em sequências de bases específicas. Tipo II (endonuclease de restrição) Função Enzimas
  6. 6. Vetores de clonagem <ul><li>Capaz de transportar uma seqüência de DNA estranha dando origem a um DNA híbrido ou recombinante. </li></ul><ul><li>Capacidade de se auto-replicar. </li></ul><ul><li>Conter pelo menos um gene que confira resistência a antibióticos. </li></ul><ul><li>Possuir locais de restrição únicos, polylinker . </li></ul><ul><li>Fácil de purificar. </li></ul><ul><li>Tipos de vectores de clonagem </li></ul><ul><li>Plasmídeos (pBR322) </li></ul><ul><li>Fasmídeos ou fagemídeos </li></ul><ul><li>Cosmídeos </li></ul><ul><li>Bacteriófagos λ </li></ul><ul><li>YACs, BACs e PACs </li></ul>www. biologianaweb .com/ Livro2/C11/pbr322.html
  7. 7. Vetores de expressão <ul><li>Promotor </li></ul><ul><li>Códon de iniciação seguido de polylinker </li></ul><ul><li>Local de ligação ao ribossoma </li></ul>www. icampus . ucl .ac. be /. ../ expression . html Promotor Local de ligação ao ribossoma Sítio de clonagem e sequência codificante de 6 histidinas www. icampus . ucl .ac. be /. ../ expression . html
  8. 8. Vetores para clonagem gênica
  9. 9. O que precisa um vetor para servir de molécula carreadora? <ul><li>A escolha de um vetor depende do design do experimento e de como o gene/proteína clonados serão pesquisados posteriormente </li></ul><ul><li>Alguns vetores contêm uma origem procariótica de replicação o qual permite sua manutenção em bactérias. </li></ul>
  10. 10. <ul><li>Alguns vetores contêm uma origem eucariótica de replicação permitindo replicação autônoma e epissomal em células eucarióticas. </li></ul><ul><li>Sítios de clonagem múltiplos são geralmente incluídos para versatilidade e construção de bibliotecas genômicas. </li></ul>
  11. 11. <ul><li>Genes de resistência a antibióticos e/ou marcadores selecionados permitem a identificação de células que adquiriram o vetor. </li></ul><ul><li>Alguns vetores possuem promotores induíveis ou tecido-específicos que permitem a expressão controlada dos genes introduzidos em células transfectadas ou animais transgênicos. </li></ul>
  12. 12. <ul><li>Vetores mais modernos possuem elementos multi-funcionais que permitem uma combinação de clonagem, seqüenciamento de DNA transcrição e replicação epissomal. </li></ul>
  13. 13. Muitos tipos de vetores <ul><li>Plasmídeos, bacteriófagos, cosmídeos, cromossomo artificial bacteriano (BAC), cromossomo artificial de fungos (YAC), retrovírus, vetor de baculovírus... </li></ul>
  14. 14. Escolha do vetor <ul><li>Depende da natureza e do protocolo de experimento </li></ul><ul><li>Tipo de célula que vai receber o vetor </li></ul><ul><ul><li>Procariótica </li></ul></ul><ul><ul><li>Eucariótica </li></ul></ul>
  15. 15. Vetor de Plasmídeo <ul><li>Fechado, circular, DNA dupla fita, ocorre naturalmente em bactérias e replica extracromossomalmente </li></ul><ul><li>Muitos conferem resistência a drogas para cepas bacterianas </li></ul><ul><li>Origem de replicação presente (ORI) </li></ul>
  16. 16. <ul><li>Examplos </li></ul><ul><ul><li>pBR322 </li></ul></ul><ul><ul><ul><li>Um dos primeiros plasmídeos utilizados </li></ul></ul></ul><ul><ul><ul><li>Dois marcadores (resistência a Amp and Tet) </li></ul></ul></ul><ul><ul><ul><li>Vários sítios de restrição espalhados através do plasmídeo </li></ul></ul></ul><ul><ul><ul><li>ColE1 ORI </li></ul></ul></ul>
  17. 17. <ul><ul><li>pUC18 </li></ul></ul><ul><ul><ul><li>Derivado do pBR322 </li></ul></ul></ul><ul><ul><ul><li>Vantagens sobre pBR322: </li></ul></ul></ul><ul><ul><ul><ul><li>Pode acomodar fragmentos de DNA maiores durante a clonagem (5-10kbp) </li></ul></ul></ul></ul><ul><ul><ul><ul><li>MAior número de cópias por célula (500 per cell = 5-10x mais que pBR322) </li></ul></ul></ul></ul><ul><ul><ul><ul><li>Múltiplos sítios de clonagem = “polylinker” </li></ul></ul></ul></ul>
  18. 18. Esquema geral de clonagem <ul><li>O vetor e o gene a ser clonado são purificados separadamente e depois ligados entre si </li></ul><ul><li>Produtos ligados são introduzidos em células competentes por técnicas de transformação. As colônias são analizadas individualmente. </li></ul>
  19. 19. <ul><li>Os vetores que vêm de bactérias que sobreviveram à seleção por antibióticos são amplificados em outras bactérias </li></ul><ul><li>O plasmídeo contendo DNA é purificado em larga escala </li></ul>
  20. 20. F. Vetores cosmídeos <ul><li>Moléculas híbridas contendo DNA de plasmídeos e de bacteriófagos lambaLambda components: COS sequences (required for in vitro packaging into phage coats) </li></ul><ul><ul><li>Componentes do plasmídeo: ORI + Gene de resistência aos antibióticos </li></ul></ul><ul><ul><li>Os sítios de clonagem vêm do lambda </li></ul></ul>
  21. 21. F. Vetores cosmídeos
  22. 22. <ul><li>Após a transformação da bactéria, o rDNA replica como plasmídeo. </li></ul><ul><li>Insertos bem grandes podem ser acomodados por cosmídeos (mais de 35-45 kbp) </li></ul>
  23. 23. Bacterial artificial chromosomes (BACs) <ul><li>Pode acomodar mais de 1 Mb de DNA (= 1000kbp) </li></ul><ul><li>Vários componentes de replicação e de controle de número de cópias estão presentes </li></ul><ul><li>Marcadores e sítios de clonagem em diferentes lugares </li></ul><ul><li>Outras características: </li></ul><ul><ul><li>Prmotores SP6 and T7 </li></ul></ul><ul><ul><ul><li>Síntese de RNA mais eficiente </li></ul></ul></ul><ul><ul><ul><li>Sondas de RNA para hibridização </li></ul></ul></ul>
  24. 24. Bacterial artificial chromosomes (BACs)
  25. 25. I. Yeast artificial chromosomes (YACs) <ul><li>Molécula híbrida contendo componentes de fungos, protozoários e bactérias (plasmídeos) </li></ul><ul><ul><ul><li>ORI = ARS (autonomously replicating sequence) </li></ul></ul></ul><ul><ul><ul><li>MArcadores (TRP1 and URA3) </li></ul></ul></ul><ul><ul><ul><li>Centrômero de fungos </li></ul></ul></ul><ul><ul><li>Protozoa= Tetrahymena </li></ul></ul><ul><ul><ul><li>Sequências de telômeros </li></ul></ul></ul><ul><ul><ul><li>Plasmídeos bacterianos </li></ul></ul></ul><ul><ul><ul><li>Polylinker </li></ul></ul></ul><ul><li>Pode acomodar >1Mb (1000kbp = 10 6 bp) </li></ul>
  26. 26. I. Yeast artificial chromosomes (YACs)
  27. 27. I. Yeast artificial chromosomes (YACs)
  28. 28. Human artificial chromosomes <ul><li>Devenvolvidos em 1997 – sintéticos, auto-replicantes </li></ul><ul><li>1/10 do tamanho de um cromossomo normal </li></ul><ul><li>Microcromossomo que passa para as células durante a mitose </li></ul><ul><li>Contém: </li></ul><ul><ul><li>ORI </li></ul></ul><ul><ul><li>Centrômero </li></ul></ul><ul><ul><li>Telômero </li></ul></ul><ul><ul><li>Cap protetor de DNA repetitivo no fim do cromossomo </li></ul></ul><ul><ul><li>Histonas dadas pela célula hospedeira </li></ul></ul>
  29. 29. J. Human artificial chromosomes
  30. 30. Transformação <ul><li>Ocorre quando uma célula incorpora e exprime um fragmento de material genético. </li></ul><ul><li>Para a introdução do DNA recombinante podem ser utilizados vários métodos: </li></ul><ul><ul><li>Células competentes; </li></ul></ul><ul><ul><li>Eletroporação; </li></ul></ul><ul><ul><li>Bombardeamento de DNA revestido de Tungsténio; </li></ul></ul><ul><ul><li>Microinjeção; </li></ul></ul><ul><ul><li>Transfecção. </li></ul></ul>Modern Genetic Analysis .
  31. 31. Extracção e purificação de proteínas <ul><li>Extração lise celular </li></ul><ul><li>Purificação </li></ul><ul><li>Cromatografia de afinidade </li></ul>Lehningher Principles of Biochemistry
  32. 32. Tags moleculares de fusão Coated microplates Usual antibody/antigen elution buffers (e.g., low pH or chaotropic salts) Neutral (physiologic) pH and non-denaturing Anti-GFP antibody Green Fluorescent Protein (GFP) Gel slurry, coated microplates Maltose at neutral pH (competitor) Neutral (physiologic) pH and non-denaturing; NaCl added to reduce nonspecific binding Dextrin Maltose Binding Protein (MBP) Prepacked column kits, spin cup column kits, SwellGel Discs, Swell- Gel Discs in 96-well filter plates, coated microplates >200 mM Imidazole, low pH, or strong chelators Neutral (physiologic) pH without reducing or oxidizing agents; small tag must be accessible in fusion protein structure; high ionic strength and denaturants (chaotropes such as 8 M urea) compatible. Chelated Nickel or Cobalt Histidine-tagged Prepacked column kits, spin cup column kits, SwellGel Discs, coated microplates Free reduced glutathione at neutral pH (competitor) Neutral (physiologic) pH, and non-denaturing; glutathione must be reduced and GST must be active Reduced glutathione Glutathione (S-transferase(GST) Available Formats Elution Conditions Binding Conditions Immobilized Ligand Fusion Tag
  33. 33. Exemplos de Proteínas Recombinantes <ul><li>Hormônio de crescimento humano – a administração deste hormônio durante a infância permite a correção dos casos de nanismo. </li></ul><ul><li>Anticoagulantes – ativadores de plasminogênio tecidual que por sua vez ativam a plasmina, enzima que dissolve os trombos (evita ataques cardíacos). </li></ul><ul><li>Dismatase do superóxido – previne danificação de tecidos </li></ul><ul><li>quando este é exposto à falta de oxigênio. </li></ul><ul><li>Anticorpos monoclonais – são usados em testes </li></ul><ul><li>diagnósticos; transporte direccionado </li></ul><ul><li>(drogas, toxinas, componentes radioactivos </li></ul><ul><li>utilizados na terapia cancerígena), assim </li></ul><ul><li>como outras aplicações. </li></ul>ioh.medstudents.com.br/ humoral.htm
  34. 34. Referência cronológica <ul><li>1922 - Frederick Grant Banting descobre a insulina. </li></ul><ul><li>1978 - É produzida insulina humana recombinante. </li></ul><ul><li>1982 - Esta insulina é disponibilizada no mercado. </li></ul>Insulina
  35. 35. Insulina <ul><li>Duas cadeias peptídicas- cadeia A e cadeia B. </li></ul><ul><li>- Duas pontes dissulfeto entre as cadeias A e B e outra na própria cadeia A. </li></ul>
  36. 36. Insulina recombinante http:io.chm.nu.edu esourceswebproject asHol utorialisulina4.htm http:io.chm.nu.edu esourceswebproject asHol utorialisulina4.htm Monômeros - Insulina é ativa na forma de monômeros. Dímeros – pontes de hidrogênio entre as extremidades C da cadeia B. Zn 2+
  37. 37. Produção de insulina <ul><ul><li>Insulina proveniente de suínos e bovinos </li></ul></ul><ul><ul><li>Insulina humana biossintética </li></ul></ul>Introduction to Genetic Analysis.
  38. 38. Β -gal Β -gal peptide Purify β -gal- insulin fusion proteins
  39. 39. Cebron-Delauw, 1994 Forward: GAGGATCCATGCAGCTGTGGCGGCGCAG Reverse: GGGAATTCTTAGGCAGCCACATGCACAA SAG3 Parmley et al, 1992 Forward: GCGGATCCATGAGTTTCTCAAAGACCACG Reverse: GGGAATTCTTACACAAACGTGATCAACAA SAG2 Burg et al, 1988 Forward: CGGAATTCATGTCGGTTTCGCTGCACCAC Reverse: CCCAAGCTTCACTCACGCGACACAAGCTG SAG1 Referência Seqüência SAG
  40. 41. A- SAG1 – CEPA RH 5`ATGTCGGTTTCGCTGCACCACTTCATTATTTCTTCTGGTTTTTTGACGAGTATGTTTCCGAAGGCAGTGAGACGCGCCGTCACGGCAGGGGTGTTTGCCGCGCCCACACTGATGTCGTTCTTGCGATGTGGCGTTATGGCATCGGATCCCCCTCTTGTTGCCAATCAAGTTGTCACCTGCCCAGATAAAAAATCGACAGCCGCGGTCATTCTCACACCGACGGAGAACCACTTCACTCTCAAGTGCCCTAAAACAGCGCTCACAGAGCCTCCCACTCTTGCGTACTCACCCAACAGGCAAATCTGCCCAGCGGGTACTACAAGTAGCTGTACATCAACGGCTGTAACATTGAGCTCCTTGATTCCTGAAGCAGAAGATAGCTGGTGGACGGGGGATTCTGCTAGTCTCGACACGGCAGGCATCAAACTCACAGTTCCAATCGAGAAGTTCCCCGTGACAACGCAGACGTTTGTGGTCGGTTGCATCAAGGGAGACGACGCACAGAGTTGTATGGTCACGGTGACAGTACAAGCCAGAGCCTCATCGGTCGTCAATAATGTCGCAAGGTGCTCCTACGGTGCAGACAGCACTCTTGGTCCTGTCAAGTTGTCTGCGGAAGGACCCACTACAATGACCCTCGTGTGCGGGAAAGATGGAGTCAAAGTTCCTCAAGACAACAATCAGTACTGTTCCGGGACGACGCTGACTGGTTGCAACGAGAAATCGTTCAAAGATATTTTGCCAAAATTAACTGAGAACCCGTGGCAGGGTAACGCTTCGAGTGATAAGGGTGCCACGCTAATGATCAAGAAGGAAGCATTTCCAGCCGAGTCAAAAAGCGTCATTATTGGATGCACAGGGGGATCGCCTGAGAAGCATCACTGTACCGTGAAACTGGAGTTTGCCGGGGCTGCAGGGTCAGCAAAATCGGCTGCGGGAACAGCCAGTCACGTTTCCATTTTTGCCATGGTGATCGGACTTATTGGCTCTATCGCAGCTTGTGTCGCGTGA 3` B- SAG2 – CEPA RH 5´ATGAGTTTCTCAAAGACCACGAGCCTAGCGTCGCTAGCGCTCACGGGCTTGTTTGTTGTGTTCAAGTTCGCTCTTGCGTCCACCACCGAGACGCCAGCACCCATTGAGTGCACTGCCGGCGCAACGAAGACTGTTGATGCACCCTCCAGTGGTTCCGTTGTCTTCCGATGTGGGGATAAACTAACCATCAGTCCCAGTGGCGAAGGTGATGTCTTTTATGGCAAGGAATGCACAGACTCGAGGAAGTTGACGACTGTCCTTCCAGGTGCGGTCTTGGCAGCTAAGGTCGAGCAGCCCCCGAAAGGTCCTGCTACCTACACACTGTCTTACGACGGTACTCCCGAGAAACCTCAGGTTCTCTGTTACAAGTGCGTTGCCGAAGCAGGTGCTCCCGCTGGTCGAAATAATGATGGTGGTTCTAGCGCTCCGACGCCTAAAGACTGCAAACTCATTGTTCGCGTTCCGGGTGCCGATGGCCGTGTCACATCTGGGTTTGACCCTGTGTCTCTCACGGGCAAGGTTCTTGCTCCCGGTCTCGCAGGTTTGTTGATCACGTTTGTGTAA 3` C- SAG3 – cepa rh 5´ATGCAGCTGTGGCGGCGCAGAGCAGCAGGTCCCGCGAGCCTGGGGAGGCAGTCTTTGCCGCTCGGGTGTTTTTTCGCGGCTTTTGGTTTGTGCGTGTTGTCTGCGATCTTGGGAACCGGAGAGCACGGACTGTTCGTCGCCGCAGGGAAATCGAGAAGTAAGATAACCTATTTTGGCACGCTCCTCAAGAAGGCTCCGAACTGGTACCGCTGCTCTTCAACGAGGGCGAATGAAGAGGTCGTAGGACATGTGACGCTGAACAAAGAGCACCCTGATATGACAATTGAATGCGTCGACGACGGCTTGGGCGGAGAGTTTTTGCCGCTCGAAGGCGGCACGTCGTCGTACCCGCGAGTATGTCACATTGATGCCAAGGACAAGGGCGACTGCGAGCGCAACAAGGGCTTTCTGACCGACTACATACCGGGCGCGAACAGGTACTGGTACAAGATAGAAAAGGTGGAGAACAACGGCGAGCAATCCGTTCTGTACAAATTCACAGTTCCTTGGATATTCCTTCCGCCCGCCAAGCAGCGATACAAGGTTGGATGCCGATACCCGAACCACGAGTATTGCTTTGTTGAGGTCACCGTCGAACCCACGCCGCCAATGGTCGAAGGCAAGAGAGTGACCTGCGGGTATCCCGAGTCCGGCCCCGTGAATCTCGAGGTGGACTTGTCAAAGGACGCGAACTTTATCGAGATTCGGTGCGGCGAACAGCACCACCCGCAGCCGTCGACCTACACGCTGCAGTACTGCTCAGGTGACTCGGTGGACCCGCAGAAGTGTTCGCCGCAGTCCCTGACGAACATTTTTTATGACTACAGCTCTTCGTGGTGGAAGGGGAAACTGAACGGGCCTGACGGGGCAACTCTCACCATTCCACCCGGCGGGTTCCCCGAAGAAGACAAATCTTTTCTTGTCGGGTGTTCACTCACTGTGGACGGGCCGCCCTTCTGCAACGTCAAAGTGAGAGTTGCCGGGAACCCCAGAAAGTGGGGGAGAGGCGGAGGCGGCCATCCAGGAAGCGGAGGATTGCAGCCGGGAACTGAAGGGGAAAGTCAAGCTGGAACAGAAAGTTCAGCCGGCGCGAGTTCGCGAATGGCTTCCGTTGCCCTGGCGTTCCTTCTCGGTCTCCTTGTGCATGTGGCTGCCTAA 3´
  41. 44. A - SAG1 M S V S L H H F I I S S G F L T S M F P K A V R R A V T A G V F A A P T L M S F L R C G V M A S D P P L V A N Q V V T C P D K K S T A A V I L T P T E N H F T L K C P K T A L T E P P T L A Y S P N R Q I C P A G T T S S C T S K A V T L S S L I P E A E D S W W T G D S A S L D T A G I K L T V P I E K F P V T T Q T F V V G C I K G D D A Q S C M V T V T V Q A R A S S V V N N V A R C S Y G A D S T L G P V K L S A E G P T T M T L V C G K D G V K V P Q D N N Q Y C S G T T L T G C N E K S F K D I L P K L T E N P W Q G N A S S D K G A T L T I K K E A F P A E S K S V I I G C T G G S P E K H H C T V K L E F A G A A G S A K S A A G T A S H V S I F A M V I G L I G S I A A C V A B - SAG2 M S F S K T T S L A S L A L T G L F V V F K F A L A S T T E T P A P I E C T A G A T K T V D A P S S G S V V F R C G D K L T I S P S G E G D V F Y G K E C T D S R K L T T V L P G A V L A A K V E Q P P K G P A T Y T L S Y D G T P E K P Q V L C Y K C V A E A G A P A G R N N D G G S S A P T P K D C K L I V R V P G A D G R V T S G F D P V S L T G K V L A P G L A G L L I T F V C - SAG3 M Q L W R R R A A G P A S L G R Q S L P L G C F F A A F G L C V L S A I L G T G E H G L F V A A G K S R S K I T Y F G T L L K K A P N W Y R C S S T R A N E E V V G H V T L N K E H P D M T I E C V D D G L G G E F L P L E G G T S S Y P R V C H I D A K D K G D C E R N K G F L T D Y I P G A N R Y W Y K I E K V E N N G E Q S V L Y K F T V P W I F L P P A K Q R Y K V G C R Y P N H E Y C F V E V T V E P T P P M V E G K R V T C G Y P E S G P V N L E V D L S K D A N F I E I R C G E Q H H P Q P S T Y T L Q Y C S G D S V D P Q K C S P Q S L T N I F Y D Y S S S W W K G K L N G P D G A T L T I P P G G F P E E D K S F L V G C S L T V D G P P F C N V K V R V A G N P R K W G R G G G G H P G S G G L Q P G T E G E S Q A G T E S S A G A S S R M A S V A L A F L L G L L V H V A A

×