Ir. Elaine de Oliveira André
“No principio, Deus
criou o céu e a terra...
criou o homem e a
mulher...”
(cf. Gn 1,1;27).
Darwin
Seleção Natural
s?
omo
m s
ue
Q

Para onde vamos?
Ele [o Projeto Genoma Humano] tem sido chamado o
Santo Graal da biologia contemporânea. Custando mais
de 2 bilhões de libr...
Nosso genoma, o conjunto dos nossos
genes, é composto por DNA, que por
sua vez é constituído de uma série de
As, Cs, Gs e ...
CCAACTTAGCGGTTAAAATTCCTCCCTTGGAGGATTACCA
TGACCGATGATCCGGTAGCCGTAGGCTAGGATCGGATT
GGTTTCGGTAGGCTTAAAGGCCGTAGGGCCAATTATCDG
GA...
O genoma é o conjunto de instruções
necessárias para formar um ser humano.
Essas informações estão no DNA, uma longa
moléc...
1997 – A ovelha Dolly é clonada.
1998 – A empresa Celera anuncia que
completaria o sequenciamento
completo do genoma human...
Em 30 anos: Doenças hereditárias serão eliminadas
com a correção de genes defeituosos. Os cientistas
conhecerão os mecanis...
caminho percorrido pela
humanidade em relação à
eugenia; seria ela liberal ou
conservadora? O que devemos
esperar moralmen...
Habermas não é contra o
diagnóstico antecipado que
permite o não
desenvolvimento de doenças,
mas não lhe agrada o fato
des...
Dignidade Humana
A dignidade da pessoa humana
consiste na liberdade que cada
pessoa possui de escolher quem de
fato ela é....
Remete à escravidão, ou
seja, usar o material
genético de um ser para
se criar outro é apoderar-se
do que é do outro e não...
A decodificação do
genoma humano promete
intervenções que lançam,
de modo surpreendente, uma
luz sobre uma condição
natura...
O ensinamento moral da Igreja
foi, por vezes, acusado de
conter muitas proibições. Na
realidade, ele se funda no
reconheci...
A IGREJA CATÓLICA X ENGENHARIA
GENÉTICA
Em 1998 a Pontifícia
Academia para a Vida se
reuniu nos dias 23, 24 e 25
de fevere...
No maravilhoso percurso que a
mente humana realiza para
conhecer o universo, a etapa que
se registra nestes anos no âmbito...
Preocupação quanto à
instauração de um tipo
cultural, que proporciona
e beneficia a diagnose
pré-natal; excluindo
aqueles ...
A Igreja Católica nunca se furtou ao debate bioético; ao
contrário, tem-se empenhado para, junto a tantas
correntes de pen...
A Sacralidade da vida e a era
tecnológica
o homem é o único ser criado a
imagem e semelhança de Deus,
por essa razão se to...
O homem surge como a apoteose
da criação. Para reafirmar sua
importância e sacralidade; ele
recebe de Deus o domínio sobre...
Partindo uma vez mais do pressuposto
de que o homem é formado com alma e
corpo, espírito e matéria, por isso é
um ser únic...
Se o seu patrimônio
genético é pré-ordenado
e estipulado a partir de
outro, entende-se,
então, que ele é apenas
uma cópia:...
No dia 20 de maio do ano
de 2010, o mundo todo
recebeu a assustadora
notícia de que o cientista
Craig Venter, o mesmo que
...
O Deus da Bíblia é também
o Deus do genoma. Pode
ser adorado na catedral ou
no laboratório. Sua criação
é majestosa, esplê...
Bioética pgh
Bioética pgh
Bioética pgh
Bioética pgh
Bioética pgh
Bioética pgh
Bioética pgh
Bioética pgh
Bioética pgh
Bioética pgh
Bioética pgh
Próximos SlideShares
Carregando em…5
×

Bioética pgh

626 visualizações

Publicada em

Material produzido por Ir. Elaine de Oliveira André, ascj.

Publicada em: Espiritual
0 comentários
0 gostaram
Estatísticas
Notas
  • Seja o primeiro a comentar

  • Seja a primeira pessoa a gostar disto

Sem downloads
Visualizações
Visualizações totais
626
No SlideShare
0
A partir de incorporações
0
Número de incorporações
3
Ações
Compartilhamentos
0
Downloads
7
Comentários
0
Gostaram
0
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Bioética pgh

  1. 1. Ir. Elaine de Oliveira André
  2. 2. “No principio, Deus criou o céu e a terra... criou o homem e a mulher...” (cf. Gn 1,1;27).
  3. 3. Darwin Seleção Natural
  4. 4. s? omo m s ue Q Para onde vamos?
  5. 5. Ele [o Projeto Genoma Humano] tem sido chamado o Santo Graal da biologia contemporânea. Custando mais de 2 bilhões de libras, é o projeto científico mais ambicioso desde o programa Apollo para o pouso do homem na Lua. Sua realização demandará mais tempo que as missões lunares, pois só se completará nos primeiros anos do próximo século. Antes mesmo de concluído, segundo seus defensores, o projeto proporcionará uma nova compreensão de muitas das enfermidades que afligem a humanidade e novos tratamentos para elas.[1] [1] WILKIE, T. Projeto Genoma Humano: Um conhecimento perigoso. Rio de Janeiro: J.Zahar, 1994, p. 11.
  6. 6. Nosso genoma, o conjunto dos nossos genes, é composto por DNA, que por sua vez é constituído de uma série de As, Cs, Gs e Ts – 3 bilhões desses elementos ordenados sequenciamente são a receita de um ser humano. Para você ter uma idéia da dimensão do nosso genoma, com esse número imenso de letras poderíamos escrever o equivalente a 800 Bíblias.[2] [1] PEREIRA, L, V. Sequenciaram o Genoma Humano... E agora?.São Paulo: Moderna, 2001, p.18.
  7. 7. CCAACTTAGCGGTTAAAATTCCTCCCTTGGAGGATTACCA TGACCGATGATCCGGTAGCCGTAGGCTAGGATCGGATT GGTTTCGGTAGGCTTAAAGGCCGTAGGGCCAATTATCDG GATTACCCATTAATTATTCGGTTAGAGACCCTTAGGATCC CGTTAGGCTTCGGATTAATCGGTAGGGATTCCGCGTAGG CTTGGTCCGTAGGATCGATCGGTCGGATGCGCTGAGATG GCCTGATCGATCGGTTAAGGTCGGGATGCCGTTAGGGCT GAGAAGTCGATTTCCCYYAAATAACCAGTTGGTTAGGAT CCCTAGAGATTCCCGTGGATAGTCGATGCCCGTAGGCTT AGGGATCCCGTAGGCTTAGATCGCTTTAATCGCCTTAAA TTCCTTATTGCTTCGGATAGGCTAGCTAGTCCTCTGATTC GTAGCCCTGATATGGCTCTGAATCCCCAAATTTATGTGGT AAAGTCCCGTAAGCTGGTTTAGGATGCTAAGCTGATCCG TTAAGCTGAAATCGTAGATCGAAATCGTAGATCGAAATC
  8. 8. O genoma é o conjunto de instruções necessárias para formar um ser humano. Essas informações estão no DNA, uma longa molécula em formato de dupla hélice que carrega os genes compostos por quatro elementos básicos: adenina(A), Tinina (T), Citosina(C) e Guanina(G). ...Os componentes do DNA seriam as letras.(...) ...Os genes seriam as palavras.(...) ...Os cromossomos seriam os capítulos.(...) ...O DNA seria o texto.(...) ...O homem seria uma coleção de 100 trilhões de livros.[1] [1] PESSINE, L; e BARCHIFONTAINE, C. P. (Orgs). Bioética:Alguns desafios.São Paulo: Loyola, 2001, p.248-249.
  9. 9. 1997 – A ovelha Dolly é clonada. 1998 – A empresa Celera anuncia que completaria o sequenciamento completo do genoma humano em três anos. 2000 – O rascunho do genoma humano é concluído. 2001 – Os dados do genoma humano são publicados. Todavia, só seria completamente concluído em 2003.
  10. 10. Em 30 anos: Doenças hereditárias serão eliminadas com a correção de genes defeituosos. Os cientistas conhecerão os mecanismos genéticos envolvidos no processo de envelhecimento. A análise completa do genoma de uma pessoa será um exame comum de uma pessoa e custará menos de 1.000 dólares. Os testes laboratoriais, como os de sangue, serão substituídos por análises computadorizadas de células, mesmo nas doenças mais comuns.[1] [1] PESSINE, L; BARCHIFONTAINE, C. P. (orgs). Bioética:...ob. cit., p.250.
  11. 11. caminho percorrido pela humanidade em relação à eugenia; seria ela liberal ou conservadora? O que devemos esperar moralmente com a biotecnia? Quais as implicações das pesquisas genéticas para a integridade
  12. 12. Habermas não é contra o diagnóstico antecipado que permite o não desenvolvimento de doenças, mas não lhe agrada o fato desses diagnósticos culminarem para um aperfeiçoamento genético.
  13. 13. Dignidade Humana A dignidade da pessoa humana consiste na liberdade que cada pessoa possui de escolher quem de fato ela é. Enfatiza que o embrião a partir da fecundação, pode ser considerado uma pessoa em potencial; por isso já porta seus direitos fundamentais.
  14. 14. Remete à escravidão, ou seja, usar o material genético de um ser para se criar outro é apoderar-se do que é do outro e não se compara com as semelhanças que acontece com os gêmeos univitelinos,
  15. 15. A decodificação do genoma humano promete intervenções que lançam, de modo surpreendente, uma luz sobre uma condição natural de nossa autocompreensão normativa, condição esta até agora não tematizada, mas que, nesse momento, revela-se essencial.[1] [1] HABERMAS,J. O futuro da ... ob. cit., p.18.
  16. 16. O ensinamento moral da Igreja foi, por vezes, acusado de conter muitas proibições. Na realidade, ele se funda no reconhecimento e na promoção de todos os dons que o criador concedeu ao homem, com a vida, o conhecimento, a liberdade e o amor.[1] CONGREGAÇÃO PARA A DOUTRINA DA FÉ. Instrução Dignitas Personae: Sobre algumas questões de bioética. São Paulo: Paulus e Loyola, 2008, p.37. [1]
  17. 17. A IGREJA CATÓLICA X ENGENHARIA GENÉTICA Em 1998 a Pontifícia Academia para a Vida se reuniu nos dias 23, 24 e 25 de fevereiro deste mesmo ano, em uma assembleia na Cidade do Vaticano, abordando o tema: Genoma Humano: personalidade humana e sociedade do futuro.
  18. 18. No maravilhoso percurso que a mente humana realiza para conhecer o universo, a etapa que se registra nestes anos no âmbito genético é particularmente sugestiva, porque leva o homem a descoberta dos segredos mais íntimos da sua própria corporeidade.(...) O genoma humano é como o ultimo continente que agora se explora. WOJTYLA, K. A conquista do novo continente do saber, o genoma humano de possibilidades
  19. 19. Preocupação quanto à instauração de um tipo cultural, que proporciona e beneficia a diagnose pré-natal; excluindo aqueles que, por meio desta, apresentam algum tipo de anomalia.
  20. 20. A Igreja Católica nunca se furtou ao debate bioético; ao contrário, tem-se empenhado para, junto a tantas correntes de pensamentos, fornecer elementos que possibilitem uma compreensão mais abrangente. O papa João Paulo II, particularmente, se esforça por refletir sobre várias questões éticas e religiosas que surgem neste campo. SOUZA, V. J, ob.cit., p.115.
  21. 21. A Sacralidade da vida e a era tecnológica o homem é o único ser criado a imagem e semelhança de Deus, por essa razão se torna a glorificação de toda a criação. Por isso mesmo, a vida humana possui um valor sagrado, porque é por assim dizer um dom incomensurável de Deus.
  22. 22. O homem surge como a apoteose da criação. Para reafirmar sua importância e sacralidade; ele recebe de Deus o domínio sobre as demais espécies, sendo assim introduzido no centro da gênesis.
  23. 23. Partindo uma vez mais do pressuposto de que o homem é formado com alma e corpo, espírito e matéria, por isso é um ser único e irrepetível, como se denominaria um ser clonado? Visto que, esse fora criado por mãos humanas; seria ele um corpo sem alma?
  24. 24. Se o seu patrimônio genético é pré-ordenado e estipulado a partir de outro, entende-se, então, que ele é apenas uma cópia: neste caso, estaria ele, então, preso, infinitamente, a um certo tipo de escravidão biológica?
  25. 25. No dia 20 de maio do ano de 2010, o mundo todo recebeu a assustadora notícia de que o cientista Craig Venter, o mesmo que liderou o sequenciamento do genoma humano; com financiamento particular, havia obtido, em laboratório, a primeira célula com DNA artificial.
  26. 26. O Deus da Bíblia é também o Deus do genoma. Pode ser adorado na catedral ou no laboratório. Sua criação é majestosa, esplêndida, complexa e bela — e não pode guerrear consigo mesma. Só nós, humanos imperfeitos, podemos iniciar batalhas assim. E só nós podemos acabar com elas. Francis Collins

×