SlideShare a Scribd company logo

The DNA sequences shown below are from the promoter reglons of six ba.pdf

•
•
G
guptahimanshu382

The document provides the DNA promoter sequences of six bacterial genes. It asks to identify the Pribnow box sequence located approximately 10 nucleotides before the +1 transcription start site in each sequence, and determine the consensus Pribnow box sequence based on the six examples.

Education
1 of 1
Download to read offline
The DNA sequences shown below are from the promoter reglons of six bacterlal genes. In each case, the last Examine these sequences and identify the Pribnow box sequence at approximately - 10 for each promoter. nucleotide in the sequence is the +1 nucleotide that Enter your answers separated by commas. initiates transcription. Gene 1 ... TTCCGGCTCGTATGTTGTGTGGB ... Gene 2 ... CGTCATTTGATATGATGCGCCCCG ... Gene 3 ... CCACTGGCGGTGATACTGAGCACA ... Gene 4 ... TTTATTGCAGCTTATAATGGTTACA ... Gene 5... TGCTTCTGACTATAATAGACAGGG ... GEE 6... AAGTAAACACGGTACGATGTACCACA ... Part B Determine the consensus sequence for the Pribnow box from the sequences above.

Recommended

The main difference between lactic acid fermentation and alcoholic fe.pdf
The main difference between lactic acid fermentation and alcoholic fe.pdf The main difference between lactic acid fermentation and alcoholic fe.pdf
The main difference between lactic acid fermentation and alcoholic fe.pdf
guptahimanshu382
 
The IRC Section 199A deduction is designed to give some taxpayers who.pdf
The IRC Section 199A deduction is designed to give some taxpayers who.pdf The IRC Section 199A deduction is designed to give some taxpayers who.pdf
The IRC Section 199A deduction is designed to give some taxpayers who.pdf
guptahimanshu382
 
The IRS recently completed an audit of Sheas tax return and assessed.pdf
The IRS recently completed an audit of Sheas tax return and assessed.pdf The IRS recently completed an audit of Sheas tax return and assessed.pdf
The IRS recently completed an audit of Sheas tax return and assessed.pdf
guptahimanshu382
 
The Income Statement Balance Sheet Statement Based on the Financial S.pdf
The Income Statement Balance Sheet Statement Based on the Financial S.pdf The Income Statement Balance Sheet Statement Based on the Financial S.pdf
The Income Statement Balance Sheet Statement Based on the Financial S.pdf
guptahimanshu382
 
The graph below illustrates how changes in temperature influences t.pdf
The graph below illustrates how changes in temperature influences t.pdf The graph below illustrates how changes in temperature influences t.pdf
The graph below illustrates how changes in temperature influences t.pdf
guptahimanshu382
 
The following table lists the probability distribution of the number .pdf
The following table lists the probability distribution of the number .pdf The following table lists the probability distribution of the number .pdf
The following table lists the probability distribution of the number .pdf
guptahimanshu382
 
The following information is available for Cullumber Company at Decem.pdf
The following information is available for Cullumber Company at Decem.pdf The following information is available for Cullumber Company at Decem.pdf
The following information is available for Cullumber Company at Decem.pdf
guptahimanshu382
 
The duties of the board of directors include the Duty of Care, which .pdf
The duties of the board of directors include the Duty of Care, which .pdf The duties of the board of directors include the Duty of Care, which .pdf
The duties of the board of directors include the Duty of Care, which .pdf
guptahimanshu382
 

Recommended

The main difference between lactic acid fermentation and alcoholic fe.pdf
The main difference between lactic acid fermentation and alcoholic fe.pdf The main difference between lactic acid fermentation and alcoholic fe.pdf
The main difference between lactic acid fermentation and alcoholic fe.pdf
guptahimanshu382
 
The IRC Section 199A deduction is designed to give some taxpayers who.pdf
The IRC Section 199A deduction is designed to give some taxpayers who.pdf The IRC Section 199A deduction is designed to give some taxpayers who.pdf
The IRC Section 199A deduction is designed to give some taxpayers who.pdf
guptahimanshu382
 
The IRS recently completed an audit of Sheas tax return and assessed.pdf
The IRS recently completed an audit of Sheas tax return and assessed.pdf The IRS recently completed an audit of Sheas tax return and assessed.pdf
The IRS recently completed an audit of Sheas tax return and assessed.pdf
guptahimanshu382
 
The Income Statement Balance Sheet Statement Based on the Financial S.pdf
The Income Statement Balance Sheet Statement Based on the Financial S.pdf The Income Statement Balance Sheet Statement Based on the Financial S.pdf
The Income Statement Balance Sheet Statement Based on the Financial S.pdf
guptahimanshu382
 
The graph below illustrates how changes in temperature influences t.pdf
The graph below illustrates how changes in temperature influences t.pdf The graph below illustrates how changes in temperature influences t.pdf
The graph below illustrates how changes in temperature influences t.pdf
guptahimanshu382
 
The following table lists the probability distribution of the number .pdf
The following table lists the probability distribution of the number .pdf The following table lists the probability distribution of the number .pdf
The following table lists the probability distribution of the number .pdf
guptahimanshu382
 
The following information is available for Cullumber Company at Decem.pdf
The following information is available for Cullumber Company at Decem.pdf The following information is available for Cullumber Company at Decem.pdf
The following information is available for Cullumber Company at Decem.pdf
guptahimanshu382
 
The duties of the board of directors include the Duty of Care, which .pdf
The duties of the board of directors include the Duty of Care, which .pdf The duties of the board of directors include the Duty of Care, which .pdf
The duties of the board of directors include the Duty of Care, which .pdf
guptahimanshu382
 
The following are the sufficient and necessary conditions for a monop.pdf
The following are the sufficient and necessary conditions for a monop.pdf The following are the sufficient and necessary conditions for a monop.pdf
The following are the sufficient and necessary conditions for a monop.pdf
guptahimanshu382
 
The follenwiag diegran rorecentt the lerygti, in cm, of so plests gro.pdf
The follenwiag diegran rorecentt the lerygti, in cm, of so plests gro.pdf The follenwiag diegran rorecentt the lerygti, in cm, of so plests gro.pdf
The follenwiag diegran rorecentt the lerygti, in cm, of so plests gro.pdf
guptahimanshu382
 
The Fibonacci numbers are a sequence generated by a recurrence relati.pdf
The Fibonacci numbers are a sequence generated by a recurrence relati.pdf The Fibonacci numbers are a sequence generated by a recurrence relati.pdf
The Fibonacci numbers are a sequence generated by a recurrence relati.pdf
guptahimanshu382
 
The financial statements of Beths Natural Foods include the followin.pdf
The financial statements of Beths Natural Foods include the followin.pdf The financial statements of Beths Natural Foods include the followin.pdf
The financial statements of Beths Natural Foods include the followin.pdf
guptahimanshu382
 
The expected return on the market is 11.5 with a standard deviation .pdf
The expected return on the market is 11.5 with a standard deviation .pdf The expected return on the market is 11.5 with a standard deviation .pdf
The expected return on the market is 11.5 with a standard deviation .pdf
guptahimanshu382
 
The common stock of Panther Group sells for $42 per share, has a rate.pdf
The common stock of Panther Group sells for $42 per share, has a rate.pdf The common stock of Panther Group sells for $42 per share, has a rate.pdf
The common stock of Panther Group sells for $42 per share, has a rate.pdf
guptahimanshu382
 
The common stock of Panther Group sells for $32.6 per share, has a ra.pdf
The common stock of Panther Group sells for $32.6 per share, has a ra.pdf The common stock of Panther Group sells for $32.6 per share, has a ra.pdf
The common stock of Panther Group sells for $32.6 per share, has a ra.pdf
guptahimanshu382
 
The Canadian government spending in recent years has resulted in pers.pdf
The Canadian government spending in recent years has resulted in pers.pdf The Canadian government spending in recent years has resulted in pers.pdf
The Canadian government spending in recent years has resulted in pers.pdf
guptahimanshu382
 
The effective annual rate of interest as a percent is . (Round the f.pdf
The effective annual rate of interest as a percent is . (Round the f.pdf The effective annual rate of interest as a percent is . (Round the f.pdf
The effective annual rate of interest as a percent is . (Round the f.pdf
guptahimanshu382
 
The company measures its activity in terms of flights. Customers can .pdf
The company measures its activity in terms of flights. Customers can .pdf The company measures its activity in terms of flights. Customers can .pdf
The company measures its activity in terms of flights. Customers can .pdf
guptahimanshu382
 
The beginning inventory of merchandise at Rhodos. Co. and data on pur.pdf
The beginning inventory of merchandise at Rhodos. Co. and data on pur.pdf The beginning inventory of merchandise at Rhodos. Co. and data on pur.pdf
The beginning inventory of merchandise at Rhodos. Co. and data on pur.pdf
guptahimanshu382
 
The diaper industry is characterized by 8 firms producing identical d.pdf
The diaper industry is characterized by 8 firms producing identical d.pdf The diaper industry is characterized by 8 firms producing identical d.pdf
The diaper industry is characterized by 8 firms producing identical d.pdf
guptahimanshu382
 
The Daisy Company uses the LIFO method and has current assets totalin.pdf
The Daisy Company uses the LIFO method and has current assets totalin.pdf The Daisy Company uses the LIFO method and has current assets totalin.pdf
The Daisy Company uses the LIFO method and has current assets totalin.pdf
guptahimanshu382
 
How to Manage Global Discount in Odoo 17 POS
How to Manage Global Discount in Odoo 17 POSHow to Manage Global Discount in Odoo 17 POS
How to Manage Global Discount in Odoo 17 POS
Celine George
 
On_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptx
On_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptxOn_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptx
On_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptx
Pooja Bhuva
 
Basic Civil Engineering first year Notes- Chapter 4 Building.pptx
Basic Civil Engineering first year Notes- Chapter 4 Building.pptxBasic Civil Engineering first year Notes- Chapter 4 Building.pptx
Basic Civil Engineering first year Notes- Chapter 4 Building.pptx
Denish Jangid
 
Interdisciplinary_Insights_Data_Collection_Methods.pptx
Interdisciplinary_Insights_Data_Collection_Methods.pptxInterdisciplinary_Insights_Data_Collection_Methods.pptx
Interdisciplinary_Insights_Data_Collection_Methods.pptx
Pooja Bhuva
 
Python Notes for mca i year students osmania university.docx
Python Notes for mca i year students osmania university.docxPython Notes for mca i year students osmania university.docx
Python Notes for mca i year students osmania university.docx
Ramakrishna Reddy Bijjam
 
Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)
Jisc
 
Understanding Accommodations and Modifications
Understanding Accommodations and ModificationsUnderstanding Accommodations and Modifications
Understanding Accommodations and Modifications
MJDuyan
 
Sociology 101 Demonstration of Learning Exhibit
Sociology 101 Demonstration of Learning ExhibitSociology 101 Demonstration of Learning Exhibit
Sociology 101 Demonstration of Learning Exhibit
jbellavia9
 
ICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptxICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptx
AreebaZafar22
 

More Related Content

More from guptahimanshu382

The beginning inventory of merchandise at Rhodos. Co. and data on pur.pdf
The beginning inventory of merchandise at Rhodos. Co. and data on pur.pdf The beginning inventory of merchandise at Rhodos. Co. and data on pur.pdf
The beginning inventory of merchandise at Rhodos. Co. and data on pur.pdf
guptahimanshu382
 

More from guptahimanshu382 (13)

The following are the sufficient and necessary conditions for a monop.pdf
The following are the sufficient and necessary conditions for a monop.pdf The following are the sufficient and necessary conditions for a monop.pdf
The following are the sufficient and necessary conditions for a monop.pdf
 
The follenwiag diegran rorecentt the lerygti, in cm, of so plests gro.pdf
The follenwiag diegran rorecentt the lerygti, in cm, of so plests gro.pdf The follenwiag diegran rorecentt the lerygti, in cm, of so plests gro.pdf
The follenwiag diegran rorecentt the lerygti, in cm, of so plests gro.pdf
 
The Fibonacci numbers are a sequence generated by a recurrence relati.pdf
The Fibonacci numbers are a sequence generated by a recurrence relati.pdf The Fibonacci numbers are a sequence generated by a recurrence relati.pdf
The Fibonacci numbers are a sequence generated by a recurrence relati.pdf
 
The financial statements of Beths Natural Foods include the followin.pdf
The financial statements of Beths Natural Foods include the followin.pdf The financial statements of Beths Natural Foods include the followin.pdf
The financial statements of Beths Natural Foods include the followin.pdf
 
The expected return on the market is 11.5 with a standard deviation .pdf
The expected return on the market is 11.5 with a standard deviation .pdf The expected return on the market is 11.5 with a standard deviation .pdf
The expected return on the market is 11.5 with a standard deviation .pdf
 
The common stock of Panther Group sells for $42 per share, has a rate.pdf
The common stock of Panther Group sells for $42 per share, has a rate.pdf The common stock of Panther Group sells for $42 per share, has a rate.pdf
The common stock of Panther Group sells for $42 per share, has a rate.pdf
 
The common stock of Panther Group sells for $32.6 per share, has a ra.pdf
The common stock of Panther Group sells for $32.6 per share, has a ra.pdf The common stock of Panther Group sells for $32.6 per share, has a ra.pdf
The common stock of Panther Group sells for $32.6 per share, has a ra.pdf
 
The Canadian government spending in recent years has resulted in pers.pdf
The Canadian government spending in recent years has resulted in pers.pdf The Canadian government spending in recent years has resulted in pers.pdf
The Canadian government spending in recent years has resulted in pers.pdf
 
The effective annual rate of interest as a percent is . (Round the f.pdf
The effective annual rate of interest as a percent is . (Round the f.pdf The effective annual rate of interest as a percent is . (Round the f.pdf
The effective annual rate of interest as a percent is . (Round the f.pdf
 
The company measures its activity in terms of flights. Customers can .pdf
The company measures its activity in terms of flights. Customers can .pdf The company measures its activity in terms of flights. Customers can .pdf
The company measures its activity in terms of flights. Customers can .pdf
 
The beginning inventory of merchandise at Rhodos. Co. and data on pur.pdf
The beginning inventory of merchandise at Rhodos. Co. and data on pur.pdf The beginning inventory of merchandise at Rhodos. Co. and data on pur.pdf
The beginning inventory of merchandise at Rhodos. Co. and data on pur.pdf
 
The diaper industry is characterized by 8 firms producing identical d.pdf
The diaper industry is characterized by 8 firms producing identical d.pdf The diaper industry is characterized by 8 firms producing identical d.pdf
The diaper industry is characterized by 8 firms producing identical d.pdf
 
The Daisy Company uses the LIFO method and has current assets totalin.pdf
The Daisy Company uses the LIFO method and has current assets totalin.pdf The Daisy Company uses the LIFO method and has current assets totalin.pdf
The Daisy Company uses the LIFO method and has current assets totalin.pdf
 

Recently uploaded

Salient Features of India constitution especially power and functions
Salient Features of India constitution especially power and functionsSalient Features of India constitution especially power and functions
Salient Features of India constitution especially power and functions
KarakKing
 

Recently uploaded (20)

How to Manage Global Discount in Odoo 17 POS
How to Manage Global Discount in Odoo 17 POSHow to Manage Global Discount in Odoo 17 POS
How to Manage Global Discount in Odoo 17 POS
 
On_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptx
On_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptxOn_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptx
On_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptx
 
Basic Civil Engineering first year Notes- Chapter 4 Building.pptx
Basic Civil Engineering first year Notes- Chapter 4 Building.pptxBasic Civil Engineering first year Notes- Chapter 4 Building.pptx
Basic Civil Engineering first year Notes- Chapter 4 Building.pptx
 
Interdisciplinary_Insights_Data_Collection_Methods.pptx
Interdisciplinary_Insights_Data_Collection_Methods.pptxInterdisciplinary_Insights_Data_Collection_Methods.pptx
Interdisciplinary_Insights_Data_Collection_Methods.pptx
 
Python Notes for mca i year students osmania university.docx
Python Notes for mca i year students osmania university.docxPython Notes for mca i year students osmania university.docx
Python Notes for mca i year students osmania university.docx
 
Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)
 
Understanding Accommodations and Modifications
Understanding Accommodations and ModificationsUnderstanding Accommodations and Modifications
Understanding Accommodations and Modifications
 
Sociology 101 Demonstration of Learning Exhibit
Sociology 101 Demonstration of Learning ExhibitSociology 101 Demonstration of Learning Exhibit
Sociology 101 Demonstration of Learning Exhibit
 
ICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptxICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptx
 
Single or Multiple melodic lines structure
Single or Multiple melodic lines structureSingle or Multiple melodic lines structure
Single or Multiple melodic lines structure
 
Jamworks pilot and AI at Jisc (20/03/2024)
Jamworks pilot and AI at Jisc (20/03/2024)Jamworks pilot and AI at Jisc (20/03/2024)
Jamworks pilot and AI at Jisc (20/03/2024)
 
Salient Features of India constitution especially power and functions
Salient Features of India constitution especially power and functionsSalient Features of India constitution especially power and functions
Salient Features of India constitution especially power and functions
 
Unit 3 Emotional Intelligence and Spiritual Intelligence.pdf
Unit 3 Emotional Intelligence and Spiritual Intelligence.pdfUnit 3 Emotional Intelligence and Spiritual Intelligence.pdf
Unit 3 Emotional Intelligence and Spiritual Intelligence.pdf
 
ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.
 
Application orientated numerical on hev.ppt
Application orientated numerical on hev.pptApplication orientated numerical on hev.ppt
Application orientated numerical on hev.ppt
 
COMMUNICATING NEGATIVE NEWS - APPROACHES .pptx
COMMUNICATING NEGATIVE NEWS - APPROACHES .pptxCOMMUNICATING NEGATIVE NEWS - APPROACHES .pptx
COMMUNICATING NEGATIVE NEWS - APPROACHES .pptx
 
How to Add New Custom Addons Path in Odoo 17
How to Add New Custom Addons Path in Odoo 17How to Add New Custom Addons Path in Odoo 17
How to Add New Custom Addons Path in Odoo 17
 
HMCS Vancouver Pre-Deployment Brief - May 2024 (Web Version).pptx
HMCS Vancouver Pre-Deployment Brief - May 2024 (Web Version).pptxHMCS Vancouver Pre-Deployment Brief - May 2024 (Web Version).pptx
HMCS Vancouver Pre-Deployment Brief - May 2024 (Web Version).pptx
 
Fostering Friendships - Enhancing Social Bonds in the Classroom
Fostering Friendships - Enhancing Social Bonds in the ClassroomFostering Friendships - Enhancing Social Bonds in the Classroom
Fostering Friendships - Enhancing Social Bonds in the Classroom
 
Wellbeing inclusion and digital dystopias.pptx
Wellbeing inclusion and digital dystopias.pptxWellbeing inclusion and digital dystopias.pptx
Wellbeing inclusion and digital dystopias.pptx
 

The DNA sequences shown below are from the promoter reglons of six ba.pdf

  • 1. The DNA sequences shown below are from the promoter reglons of six bacterlal genes. In each case, the last Examine these sequences and identify the Pribnow box sequence at approximately - 10 for each promoter. nucleotide in the sequence is the +1 nucleotide that Enter your answers separated by commas. initiates transcription. Gene 1 ... TTCCGGCTCGTATGTTGTGTGGB ... Gene 2 ... CGTCATTTGATATGATGCGCCCCG ... Gene 3 ... CCACTGGCGGTGATACTGAGCACA ... Gene 4 ... TTTATTGCAGCTTATAATGGTTACA ... Gene 5... TGCTTCTGACTATAATAGACAGGG ... GEE 6... AAGTAAACACGGTACGATGTACCACA ... Part B Determine the consensus sequence for the Pribnow box from the sequences above.