Molecular epidemiological investigations of LSDV outbreaks
and implications for the use of live attenuated LSDV vaccines
Charles Euloge LAMIEN
Joint FAO-IAEA Centre
International Atomic Energy Agency, Vienna, Austria

Click to edit meeting title, place and date
▪ In non-vaccinated herds:
• conventional diagnostics tools can be used, followed by molecular characterization
• In some cases differential diagnostic tools can held to determine if other poxvirus are involved
LSD (capripox) can occur in both non-vaccinated and vaccinated herds
Diagnosis and Differential Diagnosis
Lumpy skin disease symposium - How science can support evidence-based disease management and control | Hybrid meeting | 14 - 16 March 2023, Rome
▪ Lesions in cattle following vaccination using a live attenuated capripox vaccine can
result from:
• Adverse reaction (localized)
• Vaccination failure (infection by a field virus despite vaccination)
• Animal vaccinated while incubating the disease (infection by a field virus)
• Vaccine not sufficiently attenuated (infection of naïve breads by the vaccine itself)
• Reversion to virulence
▪ We need tools to:
• Friendly tools to distinguish vaccine virus from field virus
• Accurate tools for quality control before vaccination

Click to edit meeting title, place and date
Image challenge quiz 1, 2 and 3
What is the diagnosis?
Diagnosis and Differential Diagnosis
Lesions in cattle
Lesions in goats
Lumpy skin disease symposium - How science can support evidence-based disease management and control | Hybrid meeting | 14 - 16 March 2023, Rome

Click to edit meeting title, place and date
Respiratory diseases of small ruminants
Diagnosis and Differential Diagnosis
Pox diseases of ruminants and camel
Lumpy skin disease symposium - How science can support evidence-based disease management and control | Hybrid meeting | 14 - 16 March 2023, Rome

Click to edit meeting title, place and date
Pseudo cowpox in Zambia
Diagnosis and Differential Diagnosis
Both LSD and pseudo cowpox in Botswana

Click to edit meeting title, place and date
RPO30, GPCR, EEV
glycoprotein, B22R
Multi-targets approach revealed NI2490/KS1 like
virus in Bangladesh, Nepal and Myanmar
Approaches for Molecular Epidemiology
Lumpy skin disease symposium - How science can support evidence-based disease management and control | Hybrid meeting | 14 - 16 March 2023, Rome

Click to edit meeting title, place and date
Lumpy skin disease symposium - How science can support evidence-based disease management and control | Hybrid meeting | 14 - 16 March 2023, Rome
Approaches for Molecular Epidemiology
A multi-targets approach combined with NGS analysis of hotspots to
detect a vaccine-like field isolate of LSDV in Kenya

Click to edit meeting title, place and date
▪ Bangladesh (LSDV, GTPV, Targeted and whole
genome sequencing)
▪ Bhutan (LSDV, GTPV, Targeted and whole
genome sequencing)
▪ Botswana (LSDV, Targeted sequencing)
▪ Kenya (LSDV, GTPV Targeted and whole genome
sequencing)
▪ Myanmar (LSDV, SPPV, Targeted and whole
genome sequencing)
▪ Namibia (LSDV, Targeted sequencing)
▪ Nepal (LSDV, Targeted and whole genome
sequencing)
▪ Nigeria (LSDV, SPPV, Targeted sequencing)
▪ Uganda (LSDV, Targeted sequencing)
▪ Vietnam (LSDV , Targeted and whole genome
sequencing)
▪ Thailand (LSDV, whole genome sequencing)
▪ Indonesia (LSDV, Targeted and whole genome
sequencing)
▪ Lesotho (LSDV, Targeted sequencing)
▪ Sri Lanka (LSDV, Targeted and whole genome
sequencing)
▪ Ethiopia (LSDV, GTPV, Targeted and whole
genome sequencing)
▪ Mongolia (LSDV, Targeted and whole genome
sequencing)
Support to the molecular characterization of capripoxviruses 2020-2022
Whole Genome Sequencing and Analysis
Lumpy skin disease symposium - How science can support evidence-based disease management and control | Hybrid meeting | 14 - 16 March 2023, Rome

Click to edit meeting title, place and date
Various sequencing technologies available at APHL
Whole Genome Sequencing and Analysis
PacBio (Sequel II instrument)
Ion S5
Minion Nanopore
Lumpy skin disease symposium - How science can support evidence-based disease management and control | Hybrid meeting | 14 - 16 March 2023, Rome

Click to edit meeting title, place and date
▪ the emergence of
recombinant LSD viruses
brings some challenges for
whole genome phylogeny:
trees may not be accurate
▪ whole genome must be
fragmented to produce
several trees at various part
of the break points
▪ Several alternative methods
are possible
Whole Genome Sequencing and Analysis
Comparative analysis using the SNPs in LSDV genomes
Lumpy skin disease symposium - How science can support evidence-based disease management and control | Hybrid meeting | 14 - 16 March 2023, Rome

Click to edit meeting title, place and date
Comparative analysis using the SNPs in LSDV genomes
Whole Genome Sequencing and Analysis
▪ Isolates from South Asia cluster in
the NI-like group and those from
South East Asia belong to the
recom_3-like with China, Taiwan,
Hong Kong (China)…
▪ Recom_1: Saratov_2017
▪ Recom_2: Udmurtiya
▪ Recom_3: China
▪ Recom_4: Tyumen
Lumpy skin disease symposium - How science can support evidence-based disease management and control | Hybrid meeting | 14 - 16 March 2023, Rome

Click to edit meeting title, place and date
Whole Genome Sequencing and Analysis
Comparative analysis using the Indels in LSDV genomes

Click to edit meeting title, place and date
Image challenge quiz
What is the diagnosis?
Investigate and Prevent Issues with Live Attenuated Capripox Vaccines
Lesions in cattle
Lumpy skin disease symposium - How science can support evidence-based disease management and control | Hybrid meeting | 14 - 16 March 2023, Rome

Click to edit meeting title, place and date
Differentiate sheep poxvirus vaccines from field isolates
Investigate and Prevent Issues with Live Attenuated Capripox Vaccines
Ruling out vaccine involvement in LSD vaccine in an outbreak
Lumpy skin disease symposium - How science can support evidence-based disease management and control | Hybrid meeting | 14 - 16 March 2023, Rome

Click to edit meeting title, place and date
Characterization of Vaccine seeds
Quality Control of Capripox Vaccines
Genotype the viral strain in the vaccine
Several capripox vaccines
are mis-labelled
Kenyavac (KSGP O-240 ) = LSDV.
The Jovivac RM65 strain = SPPV
Romanian strain in the Saudi Arabian
Sheep Pox Vaccine = SPPV
Lumpy skin disease symposium - How science can support evidence-based disease management and control | Hybrid meeting | 14 - 16 March 2023, Rome

Click to edit meeting title, place and date
Quality Control of Capripox Vaccines
Sanger sequencing to confirm the presence of specific mutations in the vaccine before use
B22R_CaPVFw TCATTTTCTTCTAGTTCCGACGA
B22R_CaPVRv TTCGTTGATGATAAATAACTGGAAA

Click to edit meeting title, place and date
▪ KS1 is widely used in LSD endemic regions for
cattle, but also for small ruminant against also
sheeppox and goatpox
▪ Some countries in Africa and the Middle East are
replacing KS1 by Neethling for cattle immunization,
but still using KS1 for sheep and goats
▪ When both Neethling (for cattle) and KS1 (for small
ruminants) are produced by the same company, there
is a high risk for cross contamination
Detect a cross contamination (KS1/Neethling vaccine)
Quality Control of Capripox Vaccines
Detecting low number of viral subpopulation in LSDV vaccines can be
performed by qPCR or targeted sequencing
Lumpy skin disease symposium - How science can support evidence-based disease management and control | Hybrid meeting | 14 - 16 March 2023, Rome

Click to edit meeting title, place and date
Quality Control of Capripox Vaccines
▪ Presence of several variant
positions with mixed
populations across the
genome
▪ Each variant position
matches the genomic
differences between LSDV
KSGP 0240 and LSDV
Neethling vaccine LW 1959
perfectly
▪ This suggests that the
initial mixture contained
the two viruses
HIFI sequencing for the accurate analysis of viral population diversity in vaccines
Lumpy skin disease symposium - How science can support evidence-based disease management and control | Hybrid meeting | 14 - 16 March 2023, Rome

Click to edit meeting title, place and date
Quality Control of Capripox Vaccines
Genotype
All 50 HIFI reads of LSDV_Myanmar are clustering with LSDV NI2490
All 370 HIFI reads of LSDV_Macedonia are clustering with LSDV Evros/GR/15
▪ Low diversity
in virus
subpopulation
for clinical
samples and
low passages
HIFI sequencing for the accurate analysis of viral population diversity in vaccines
Lumpy skin disease symposium - How science can support evidence-based disease management and control | Hybrid meeting | 14 - 16 March 2023, Rome

Click to edit meeting title, place and date
Quality Control of Capripox Vaccines
▪ All 250 HIFI reads of the good vaccine are clustering with LSDV Neethling vaccine LW 1959
HIFI sequencing for the accurate analysis of viral population diversity in vaccines
Lumpy skin disease symposium - How science can support evidence-based disease management and control | Hybrid meeting | 14 - 16 March 2023, Rome

Click to edit meeting title, place and date
Quality Control of Capripox Vaccines
HIFI sequencing for the accurate analysis of viral population diversity in vaccines
▪ Individual sequences are
scattered all over the place
▪ These reads represent all
known LSDVs: LSDV
Neethling vaccine, KSGP
0240, and all known
recombinant.
▪ This suggests that we could
expect more recombinants
to emerge
Lumpy skin disease symposium - How science can support evidence-based disease management and control | Hybrid meeting | 14 - 16 March 2023, Rome

Click to edit meeting title, place and date
Important Lessons from LSDV Studies
▪ Conventional field isolates (Africa, Middle East,
Europe, and part of Russia)
▪ Recombinant-like viruses (first described in Russia,
China, Hong Kong, and Vietnam…, but also seen in
retrospective analysis of a sample collected in 2011
in Kenya)
▪ NI2490 like viruses (first described in Bangladesh,
India, Myanmar, and Nepal)
Three types of field isolates are circulating
▪ Conventional molecular DIVAs for LSD are compromised
▪ The new molecular DIVA approaches must be more
dynamic and must be based on multiple targets
▪ Baseline knowledge and continuous molecular monitoring
of your isolates and vaccines batches is essential
▪ Nether inoculate vaccine before molecular tests
▪ Always comprehensively investigate outbreaks in
vaccinated herds and surrounding areas and analyze the
isolates molecularly.
Consequences
Lumpy skin disease symposium - How science can support evidence-based disease management and control | Hybrid meeting | 14 - 16 March 2023, Rome

Click to edit meeting title, place and date
Our NGS Team
Hatem Ouled
Ahmed
Irene Meki Sneha Datta
William
Dundon
Sequencing Data Analysis
Molecular
Epidemiology
Nanopore
Charles Lamien
Bharani Settypalli
Sequencing
Molecular
Epidemiology
Lumpy skin disease symposium - How science can support evidence-based disease management and control | Hybrid meeting | 14 - 16 March 2023, Rome

Click to edit meeting title, place and date
Acknowledgments
▪ Gerrit Viljoen (APH Section Head):
▪ Giovanni Cattoli (APH Laboratory Head):
▪ The Symposium organisers
▪ All VETLAB partner Laboratories that supported these studies
▪ The Austrian Agency for Health and Food Safety (AGES), Austria
Lumpy skin disease symposium - How science can support evidence-based disease management and control | Hybrid meeting | 14 - 16 March 2023, Rome

Protecting people, animals, and the environment every day
Drawings: FAO/Chiara Caproni
Thank You