Treinamento ácidos nucléicos

5.660 visualizações

Publicada em

0 comentários
3 gostaram
Estatísticas
Notas
  • Seja o primeiro a comentar

Sem downloads
Visualizações
Visualizações totais
5.660
No SlideShare
0
A partir de incorporações
0
Número de incorporações
1
Ações
Compartilhamentos
0
Downloads
216
Comentários
0
Gostaram
3
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Treinamento ácidos nucléicos

  1. 1. Treinamento Ácidos nucléicos – Prof. Emanuel 1. A célula muscular cardíaca e a esquelética têm a mesma origem, porém são diferentes, tanto do ponto de vista estrutural como funcional. Ao longo do processo de diferenciação das células do mesmo organismo ocorre a) duplicação de alguns genes. b) perda dos genes não expressos. c) expressão diferencial dos genes. d) indução de mutações específicas. e) recombinação entre genes ativados. 2. A teoria "Um Gene uma Enzima" propunha que cada gene era responsável pela síntese de uma enzima, que expressava uma determinada característica biológica. Hoje, sabe-se que a partir de um gene é produzida uma cadeia polipeptídica. Assinale a alternativa cuja sequência de eventos resulta na produção de cadeias polipeptídicas. a) Descondensação dos cromossomos, tradução do RNAm e transcrição da cadeia polipeptídica no citoplasma. b) Leitura da sequência de DNA no citoplasma, transcrição no núcleo, tradução no núcleo e síntese polipeptídica no citoplasma. c) Leitura da sequência de DNA específica, transcrição no citoplasma, tradução do RNAm imaturo no núcleo e síntese polipeptídica no citoplasma. d) Leitura da sequência de DNA específica, transcrição do DNA no citoplasma, processamento do RNAm no núcleo, síntese polipeptídica no núcleo e maturação da proteína no citoplasma. e) Leitura da sequência de DNA específica, produção de RNAm heterogêneo no núcleo, saída do RNAm do núcleo e síntese da cadeia polipeptídica no citoplasma. 3.
  2. 2. Treinamento Ácidos nucléicos – Prof. Emanuel Técnica para extrair o DNA de dentro das células da cebola: I) preparar uma mistura com: - uma cebola pequena bem ralada; - meio copo de água bem quente; - três colheres de sal; - duas colheres de detergente de cozinha; II) mexer bem; III) deixar a mistura descansar até esfriar; IV) filtrar a mistura em um filtro de papel; V) acrescentar um copo de álcool ao produto filtrado; VI) 'pescar' o DNA que aparece no produto filtrado e no álcool com um garfo. Pela análise dos passos da técnica, conclui-se que estão corretas as afirmativas a seguir, EXCETO: a) Ao ralar a cebola, a estrutura do tecido vegetal é destruída. b) A água quente ajuda a desnaturar as proteínas presentes nas células. c) A solução salina induz a passagem de água para dentro da célula por osmose. d) O detergente serve para desfazer a membrana plasmática, que é composta por lipídeos. e) As moléculas de DNA são menores que os poros do filtro de papel. 4. O metabolismo celular depende de uma série de reações químicas controladas por enzimas, isto é, proteínas que atuam como catalisadores e que podem sofrer mutações genéticas sendo modificadas ou eliminadas. Assinale a alternativa correta, levando em conta os ácidos nucléicos, a ocorrência de mutações e as consequentes mudanças do ciclo de vida da célula. a) O DNA é constituído por códons, que determinam a sequência de bases do RNA mensageiro, necessária à formação dos anticódons, responsáveis pela produção das proteínas. b) No caso de uma mutação acarretar a transformação de um códon em outro relacionado ao mesmo aminoácido, não haverá alteração na molécula protéica formada, nem no metabolismo celular. c) A mutação altera a sequência de aminoácidos do DNA, acarretando alterações na sequência de bases do RNA mensageiro e, consequentemente, na produção das proteínas. d) As mutações atuam diretamente sobre as proteínas, provocando a desnaturação dessas moléculas e, consequentemente, a inativação delas. e) Quando algumas proteínas são alteradas por mutações, suas funções no metabolismo celular passam a ser realizadas pelos aminoácidos. 5. O gráfico mostra o espectro de absorção de raios ultravioleta (U.V.) por uma proteína e por um ácido nucléico. Considerando a ação desses raios na célula, o comprimento de onda em que será obtida maior
  3. 3. Treinamento Ácidos nucléicos – Prof. Emanuel taxa de mutação é a) 2.400 Angstrons. b) 2.500 Angstrons. c) 2.600 Angstrons. d) 2.700 Angstrons. e) 2.800 Angstrons. 6. O gato doméstico ('Felis domestica') apresenta 38 cromossomos em suas células somáticas. No núcleo do óvulo normal de uma gata são esperados: a) 19 cromossomos simples e 19 moléculas de DNA. b) 19 cromossomos duplicados e 38 moléculas de DNA. c) 38 cromossomos simples e 38 moléculas de DNA. d) 38 cromossomos simples e 19 moléculas de DNA. e) 19 cromossomos duplicados e 19 moléculas de DNA. 7. Observe este trecho de molécula de RNA, que ilustra as ligações entre seus nucleotídeos: A função química decorrente da ligação entre a ribose e o fosfato denomina-se: a) éter b) éster c) álcool d) cetona 8. Considere a sequência de bases da fita não molde do DNA de um organismo procarioto: - AAT CCG ACG GGA. Quais seriam as sequências de bases da fita complementar do DNA, que serve de molde para transcrição, e da fita simples de RNAm transcrito? a) Fita molde - 3' - TTA GGC TGC CCT- 5' e RNA 5'- UUTCCGUCGGGU - 3'. b) Fita molde - 3' - UUA GGC UGC CCU - 5' e RNA 5' - TTAGGCTGC CCT- 3'. c) Fita molde - 3' - AAT CCG ACG GGA - 5' e RNA 5'- UUAGGCUGCCCU - 3'. d) Fita molde - 3' - TTA GGC TGC CCT- 5' e RNA 5' - AAUCCGACGGGA - 3'. e) Fita molde - 3' - AAU CCG ACG GGA - 5' e RNA 5' -TTAGGCTGCCCT - 3'. 9. Todas as formas de vida do nosso planeta têm suas informações genéticas codificadas nas sequências de bases nitrogenadas dos ácidos nucleicos. Assinale a(s) proposição(ões) CORRETA(S), considerando as informações a seguir:
  4. 4. Treinamento Ácidos nucléicos – Prof. Emanuel Sequência 1:AAAGATCCCGAATCGGTCGGCGATTTATCG Sequência 2:TTTCTAGGGCTTAGCCAGCCGCTAAATAGC 01) As sequências 1 e 2 são complementares no DNA e, juntas, representam um segmento de molécula de DNA. 02) Se considerarmos 1 a sequência molde, o RNAm formado por esta sequência conterá as mesmas bases nitrogenadas da sequência 2, trocando-se a timina pela uracila. 04) Na sequência 1 estão representados 30 códons e 10 nucleotídeos. 08) A sequência 1 pode ser a representação de um DNA ou de um RNA, dependendo de como for lida. 16) O código genético é exclusivo de cada espécie. Prova disso é que determinados aminoácidos, como por exemplo a fenilalanina, são encontrados apenas na espécie humana. 32) Adenina, timina, citosina e guanina são aminoácidos essenciais, presentes em todos os seres vivos. 64) Com o sequenciamento do genoma humano foi possível determinar a sequência de aminoácidos de todas as proteínas humanas. 10. A respeito do DNA, substância presente no núcleo das células vivas que constitui a molécula informacional dos seres vivos, assinale o que for correto. 01) Pedaços de DNA, chamados genes, contêm toda a programação sobre as características hereditárias da espécie e do organismo. Em cada célula do organismo humano existem entre 30.000 e 40.000 genes. 02) Os genes são responsáveis pela produção das proteínas celulares e pelo funcionamento das células e do organismo. 04) Genes defeituosos ou que funcionam na hora errada podem acarretar doenças hereditárias. Os hemofílicos, por exemplo, apresentam deficiência na coagulação do sangue porque uma das substâncias da coagulação, chamada de fator VIII, não é produzida, em decorrência de um defeito num determinado gene. 08) A importância de se conhecer bem os genes e suas funções foi um dos motivos para a instituição do Projeto Genoma Humano, já concluído, no qual trabalharam centenas de cientistas do mundo todo. 11. As atividades celulares são orientadas pelas informações contidas no DNA, que são decodificadas em proteínas através dos mecanismos de transcrição e tradução. O que faz uma baleia parecer uma baleia são suas proteínas. Assim, as proteínas determinam as funções vitais da baleia, como de todos os seres vivos. Para ditar o desenvolvimento de um organismo, a informação do DNA deve, de algum modo, ser convertida em proteínas. Esta conversão ocorre porque o DNA contém um código genético para os aminoácidos que compõem as proteínas. Neste código, cada aminoácido é representado por uma sequência de pares de bases, e esta sequência é refletida na sequência de aminoácidos reunidos em uma cadeia protéica. Assim, traduzir o código genético significa passar o código de sequência de bases para uma sequência de aminoácidos. Deste modo, o DNA é decodificado na forma de uma proteína estrutural ou enzimática que, por sua vez, é responsável por uma característica do organismo. Podemos afirmar que: I. Esta decodificação se faz através da leitura de sequências de três nucleotídeos, chamados códons, que especificam aminoácidos. II. Os códons diferem entre diferentes táxons de seres vivos; há códons que não codificam aminoácidos. III. A decodificação ocorre no citoplasma celular, em estruturas chamadas ribossomos, a partir de uma fita simples de DNA que deixa momentaneamente o núcleo somente para tal função. IV. Cada códon traduz apenas um aminoácido. V. Alguns aminoácidos são codificados por mais de um códon. A isto chamamos degeneração do código, o que possivelmente traz maior estabilidade contra mutações no DNA.
  5. 5. Treinamento Ácidos nucléicos – Prof. Emanuel Indique a alternativa em que todas as afirmativas são falsas. a) I e III b) II, III e IV c) II e III d) II, III e V 12. Em 1953, Watson e Crick decifraram que a estrutura da molécula de DNA (ácido desoxirribonucleico) é uma dupla hélice, responsável pelas características dos organismos. Com os conhecimentos atuais, julgue as afirmativas sobre a molécula de DNA: I. Na autoduplicação da molécula de DNA, cada filamento original serve de molde para a síntese de um novo filamento (duplicação semiconservativa). II. A base nitrogenada adenina emparelha-se com a citosina, enquanto a timina emparelha-se com a guanina. III. As bases nitrogenadas dos dois filamentos estão unidas por ligações denominadas pontes de hidrogênio. Está ou estão corretas as afirmativas: a) I somente b) II somente c) I e II. d) I e III. e) II e III. 13. A descoberta de um fóssil de bebê mamute, extremamente bem preservado nas estepes congeladas da Rússia, oferece aos pesquisadores melhor oportunidade de obter o genoma de uma espécie extinta ("O Globo", Ciências, 12 de Julho de 2007). A técnica de PCR vem sendo utilizada para a amplificação do DNA nestes estudos. Para a realização desta técnica, deve-se empregar além do DNA extraído do mamute usado, como molde, as seguintes moléculas: a) nucleotídeos de Uracila, Citosina, Guanina, Adenina, DNA polimerase e primers de DNA b) nucleotídeos de Timina, Citosina, Guanina, Adenina, DNA polimerase e primers de DNA c) nucleotídeos de Uracila, Citosina, Guanina, Adenina, RNA polimerase e primers de DNA d) nucleotídeos de Timina, Citosina, Guanina, Adenina, RNA polimerase e primers de DNA e) nucleotídeos de Timina, Citosina, Guanina, Adenina, RNA polimerase e DNA polimerase 14. Em 1993, Kary Mullis, um geneticista ao serviço da Cetus, uma empresa de Biotecnologia da Califórnia, recebeu o prêmio Nobel da Química pelo desenvolvimento de um método que permite sintetizar, em poucas horas e in vitro, uma grande quantidade de um determinado fragmento de DNA. Esta técnica faz parte integrante da moderna biotecnologia molecular, tendo trazido um enorme progresso para várias áreas, como o diagnóstico de doenças e medicina forense.
  6. 6. Treinamento Ácidos nucléicos – Prof. Emanuel Com base em seus conhecimentos sobre a molécula de DNA e sua duplicação, assinale a alternativa correta. a) O processo de duplicação do DNA é conhecido como semiconservativo, pois a "molécula- mãe" do DNA, que serve de modelo, origina uma molécula de DNA, com duas novas cadeias de nucleotídeos. b) As cadeias do DNA são separadas pelo rompimento das pontes de hidrogênio que fazem a ligação entre as bases, num processo catalisado por enzimas. c) As pontes de hidrogênio que unem ambas as fitas do DNA se formam entre as bases nitrogenadas, representadas pelas letras A, C, G e U. d) Quando as pontes de hidrogênio em uma molécula de DNA são quebradas obtêm-se riboses livres. e) A polimerase do DNA é uma enzima que atua na produção de nucleotídeos. 15. A figura seguinte representa um modelo de transmissão da informação genética nos sistemas biológicos. No fim do processo, que inclui a replicação, a transcrição e a tradução, há três formas proteicas diferentes denominadas a, b e c. Depreende-se do modelo que a) a única molécula que participa da produção de proteínas é o DNA. b) o fluxo de informação genética, nos sistemas biológicos, é unidirecional. c) as fontes de informação ativas durante o processo de transcrição são as proteínas. d) é possível obter diferentes variantes proteicas a partir de um mesmo produto de transcrição. e) a molécula de DNA possui forma circular e as demais moléculas possuem forma de fita simples linearizadas. 16. Há uma impressionante continuidade entre os seres vivos (...). Talvez o exemplo mais marcante seja o da conservação do código genético (...) em praticamente todos os seres vivos. Um código genético de tal maneira “universal” é evidência de que todos os seres vivos são aparentados e herdaram os mecanismos de leitura do RNA de um ancestral comum. Morgante & Meyer, Darwin e a Biologia, O Biólogo 10:12–20, 2009. O termo ―código genético‖ refere-se a) ao conjunto de trincas de bases nitrogenadas, cada trinca correspondendo a um determinado aminoácido. b) ao conjunto de todos os genes dos cromossomos de uma célula, capazes de sintetizar diferentes proteínas.
  7. 7. Treinamento Ácidos nucléicos – Prof. Emanuel c) ao conjunto de proteínas sintetizadas a partir de uma sequência específica de RNA. d) a todo o genoma de um organismo, formado pelo DNA de suas células somáticas e reprodutivas. e) à síntese de RNA a partir de uma das cadeias do DNA, que serve de modelo. 17. Entre as diferentes biotecnologias modernas encontramos a produção do transgênicos. Sobre o tema, assinale o que for correto. 01) Pela técnica do DNA recombinante novos organismos, chamados transgênicos, ou organismos geneticamente modificados, são produzidos pela inserção de genes que lhes são estranhos. 02) O objetivo da produção dos transgênicos é desenvolver novos tipos de seres vivos, mais próximos da perfeição e isentos de doenças genéticas previsíveis. 04) Um transgênico da Escherichia coli tem grande importância terapêutica, sendo usado atualmente na produção do hormônio de crescimento humano, da eritropoietina e de insulina em escala industrial. 08) Dolly foi uma ovelha que, além de ser um clone, era um animal geneticamente modificado, obtido pela inserção de um gene humano em seu DNA. Esse gene codifica a produção do fator IX, uma proteína da coagulação sanguínea, importante no tratamento de hemofílicos. A partir do sangue da ovelha Dolly, esse fator podia ser obtido em grande quantidade. 16) Uma das técnicas para a obtenção de organismos transgênicos é o uso de vetores, que são vírus e bactérias nos quais se insere o DNA, para ser incorporado a um outro organismo. 18. Leia o quadrinho a seguir. Considere o enunciado a seguir, referente ao significado da resposta de Mafalda, e as três propostas para completá-lo. A expressão direção 5’  3’ refere-se 1 – à ligação entre fosfato e açúcar no processo de replicação do DNA. 2 – à atividade da enzima RNA polimerase no processo de transição do RNA. 3 – à união entre os aminoácidos no processo de tradução das proteínas. Quais propostas estão corretas? a) Apenas 1. b) Apenas 2. c) Apenas 3. d) Apenas 1 e 2. e) 1,2 e 3.
  8. 8. Treinamento Ácidos nucléicos – Prof. Emanuel 19. Ao analisar tumores de vários tipos de tecidos diferentes, Isaac S. Kohane, da Divisão de Ciências da Saúde e Tecnologia de Harvard (MIT), catalogou padrões surpreendentes, embora familiares, de atividade dos genes em células cancerosas — são as mesmas instruções genéticas programadas que estão ativas durante vários estágios do desenvolvimento embrionário e fetal. Scientific American Brasil, junho de 2009 A partir da leitura do texto, podemos deduzir que alguns genes: a) mutados presentes nas células embrionárias e fetais não deveriam expressar seus efeitos deletérios em momentos posteriores da vida, mas os expressam nas células cancerosas. b) que estão presentes nas células embrionárias e fetais não deveriam ser encontrados em outras fases do desenvolvimento do organismo, mas são encontrados nas células cancerosas. c) que são replicados nas células embrionárias e fetais não deveriam sê-lo nas outras fases do desenvolvimento do organismo, mas se replicam nas células cancerosas. d) mutados presentes nas células embrionárias e fetais deveriam ser transcritos em diferentes tecidos em momentos posteriores da vida, mas só são transcritos nas células cancerosas. e) normais que são transcritos nas células embrionárias e fetais não deveriam sê-lo em outras fases do desenvolvimento do organismo, mas são transcritos nas células cancerosas. 20. Como consequência de uma mutação hipotética em uma molécula de RNA mensageiro, podemos esperar que ocorram diversas mudanças, à exceção de alterações: a) na transcrição reversa desse RNA para DNA. b) na autoduplicação do DNA que o originou. c) na tradução dessa molécula de RNA. d) moleculares em proteínas estruturais originadas desse RNA. e) funcionais em proteínas enzimáticas originadas desse RNA. 21. A Empresa Brasileira de Pesquisa Agropecuária (Embrapa) tem se especializado na produção de espécies de plantas transgênicas, portadoras de genes que conferem resistência a certas pragas agrícolas. Considerando os genótipos de plantas produzidos em laboratório, analise o que se afirma a seguir. ( ) Devido à resistência a pragas, os clones de plantas transgênicas têm vantagem evolutiva frente às espécies selvagens. ( ) Em plantas utilizadas na alimentação, a transgenia altera a composição de aminoácidos da cadeia polipeptídica codificada pelo gene alterado, produzindo proteínas com menor valor nutritivo. ( ) As técnicas de engenharia genética demandam a utilização de bactérias para a multiplicação de plasmídios vetores nos quais foram introduzidos os genes de interesse. ( ) O consumo de plantas transgênicas na alimentação gera alergias e intoxicações não produzidas pelos genótipos selvagens. ( ) Caso uma praga acometa um genótipo de uma dada espécie de planta transgênica, todos os seus clones serão igualmente susceptíveis. 22. Leia abaixo a descrição do experimento por meio do qual se comprovou que a replicação do DNA é do tipo semiconservativo. Uma cultura de células teve, inicialmente, o seu ciclo de divisão sincronizado, ou seja, todas iniciavam e completavam a síntese de DNA ao mesmo tempo. A cultura foi mantida em um meio nutritivo normal e, após um ciclo de replicação, as células foram transferidas para um outro meio, onde todas as bases nitrogenadas continham o isótopo do nitrogênio 15N em substituição ao 14N. Nestas condições, essas células foram acompanhadas por três gerações seguidas. O DNA de cada geração foi preparado e separado por centrifugação conforme sua densidade. Observe o gráfico correspondente ao resultado obtido na primeira etapa do experimento, na qual as células se reproduziram em meio normal com N:
  9. 9. Treinamento Ácidos nucléicos – Prof. Emanuel Observe, agora, os gráficos correspondentes aos resultados obtidos, para cada geração, após a substituição do nitrogênio das bases por 15 N: Os gráficos que correspondem, respectivamente à primeira, à segunda e à terceira gerações são: a) X, Y, Z b) Z, Y, X c) Z, X, Y d) Y, Z, X 23. Alguns vírus, como o da poliomielite, contêm RNA de fita simples (+), que podem funcionar diretamente como mensageiros na célula infectada. Esses RNA possuem uma sequência nucleotídica necessária para que o códon de iniciação da síntese proteica seja identificado, como mostra o esquema a seguir: Considere, para um RNAm desse tipo, que sintetiza um peptídeo viral, as seguintes informações: • se a base nitrogenada adenina do códon de iniciação é a de número 1, a base uracila do códon de terminação será a de número 133, seguindo-se o sentido da tradução; • o códon UGG aparece duas vezes na porção desse RNA que codifica o peptídeo. Observe, na tabela abaixo, a identificação de alguns códons: Códon Aminoácido codificado ou função AUG metionina - iniciação UAA, UAG, UGA terminação UGG triptofano
  10. 10. Treinamento Ácidos nucléicos – Prof. Emanuel O aminoácido metionina, introduzido no peptídeo pelo códon iniciador, é imediatamente removido após o término da tradução. A percentagem de triptofano na composição da molécula desse peptídio é de: a) 1,48% b) 1,55% c) 4,44% d) 4,65% 24. Algumas células da pele de uma mesma rã foram retiradas em sua fase girino e, depois, em sua fase adulta. Observe a tabela abaixo, na qual são mostradas as combinações possíveis das macromoléculas DNA e RNA mensageiro. Comparação entre as macromoléculas DNA RNAm 1) mesma molécula 3) mesmos tipos 2) moléculas diferentes 4) tipos diferentes Os resultados referentes à comparação das macromoléculas das células da rã nas fases girino e adulta estão indicados pelos seguintes números: a) 1 e 3 b) 1 e 4 c) 2 e 3 d) 2 e 4 25. Considere o seguinte trecho: (...) apesar de suas enormes diferenças, peixes e mamíferos têm aproximadamente os mesmos genes, tal como os crocodilos e os pardais. (François Jacob. O ratinho, a mosca e o homem.) O que explica a produção dessa diferença é a) a existência de um código genético universal e degenerado entre os seres vivos. b) a ocorrência do mesmo tipo de transcrição e de tradução que acontecem nesses genes. c) que diferentes tipos de RNA mensageiro são transcritos em cada espécie. d) a preservação do dogma central da biologia, isto é, um gene para cada proteína. e) a existência de um ancestral comum entre os mais distintos seres vivos. 26. Em 1953, James Watson e Francis Crick elucidaram a estrutura tridimensional da dupla hélice de DNA e postularam que o pareamento específico de bases nitrogenadas sugere um possível mecanismo de cópia para o material genético. Baseado neste postulado, o processo de duplicação do DNA é considerado como sendo semiconservativo porque: a) A dupla-hélice original permanece intacta e uma nova dupla-hélice é formada. b) Os dois filamentos da dupla-hélice original se separam e cada um serve como molde para uma nova fita. c) Ambos os filamentos da dupla-hélice original se fragmentam e servem como moldes para síntese de novos fragmentos. d) Um dos filamentos da dupla-hélice original serve de cópia para as duas fitas de DNA. e) Os filamentos da dupla-hélice original permutam as suas fitas para servirem de cópias de DNA. 27. Bioma é uma região com o mesmo tipo de clima, possui plantas e animais característicos [Planeta Terra: Ecossistemas, 2008]. Mas, como a interferência do homem na natureza é constante, os cientistas criaram uma nova espécie de mosquito da malária modificado geneticamente para não transmitir essa doença e o introduziram na Amazônia. Então, é correto afirmar que a) modificar geneticamente um mosquito não significa alterar o seu DNA. b) modificar um organismo geneticamente significa cruzar espécies diferentes.
  11. 11. Treinamento Ácidos nucléicos – Prof. Emanuel c) a modificação genética dos mosquitos pode ser feita pelo cruzamento dos mosquitos da malária com outros tipos de insetos, gerando novas combinações. d) os ambientalistas defendem o uso da engenharia genética, pois os seus efeitos são totalmente previstos e controlados, não trazendo perigo para a humanidade. e) transgenia significa a inserção de um gene de uma espécie diferente em outra espécie. 28. Sobre os Ácidos Nucleicos, são feitas as seguintes afirmações: I. São macromoléculas, de elevada massa molecular, que possuem ácido fosfórico, açúcares e bases purínicas e pirimidínicas, em sua composição. II. Ocorrem em todas as células vivas e são responsáveis pelo armazenamento e transmissão da informação genética e por sua tradução, que é expressa pela síntese protéica. III. Encontram-se presentes no núcleo dos procariotos e dispersos no hialoplasma dos eucariotos. IV. Encontram-se, normalmente, organizados sob a forma de fita simples ou dupla. Das quatro afirmações anteriores, são verdadeiras a) apenas a I, a II e a IV. b) a I, a II, a III e a IV. c) apenas a III e a IV. d) apenas a I e a II. 29. Observe as figuras:
  12. 12. Treinamento Ácidos nucléicos – Prof. Emanuel Ecossistemas em desequilíbrio podem estar sendo afetados por fatores mutagênicos. Os defeitos nos nossos genes são causados por mutações no DNA. Na figura, identifique o nome dos aminoácidos correspondentes aos códons numerados de 2 a 8 e considere a hipótese de ocorrer uma mutação no DNA que originou o códon 7, o qual, ao invés de ser CGU, passou a ser CCU. A sequência correta dos aminoácidos de 2 a 8, com a mutação no 7, é a seguinte: a) fenilalanina - glicina - fenilalanina - treonina - ácido aspártico - arginina - serina. b) lisina - prolina - lisina - cisteína - leucina - glicina - serina. c) metionina - fenilalanina - glicina - treonina - prolina - serina - metionina. d) fenilalanina - glicina - fenilalanina - treonina - ácido aspártico - prolina - serina. e) fenilalanina - glicina - lisina - cisteína - treonina - ácido aspártico - serina. 30. A tecnologia do DNA recombinante abriu novas perspectivas no melhoramento genético dos organismos. Essa técnica consiste na inserção de um segmento de DNA de uma espécie em outra e, para o seu desenvolvimento, diversas enzimas são utilizadas. Com base na literatura sobre a tecnologia do DNA recombinante, é correto afirmar: a) As enzimas de restrição identificam o segmento de DNA que será inserido na célula alvo. b) Os plasmídeos são enzimas importantes para unir as moléculas de DNA. c) A enzima DNA ligase é importante para inserir o DNA na célula alvo. d) As enzimas de restrição são utilizadas para cortar a molécula de DNA. e) O uso de plasmídeos diminui a eficiência das técnicas de manipulação do DNA. 31. O termo ―mundo de RNA‖ foi criado por Gilbert, em 1986, para delinear um cenário no qual a principal molécula ativa na origem da vida era o RNA. Em relação à hipótese do mundo de RNA, conclui-se que a) a reprodução e o metabolismo das primeiras formas de vida dependiam das atividades catalíticas e replicativas do RNA. b) ao se multiplicarem, moléculas de RNA produziam versões ligeiramente diferentes entre si; algumas delas tinham maior capacidade de se perpetuarem e de se reproduzirem, transmitindo essas características à descendência. c) o RNA é a única molécula capaz de armazenar informação genética nos primódios e nos tempos atuais, propriedade que, até alguns anos atrás, se acreditava limitada às proteínas.
  13. 13. Treinamento Ácidos nucléicos – Prof. Emanuel d) o RNA precedeu o DNA, visto exercer vários papéis na célula, tais como: mensageiro (RNAm), transportador (RNAt), ribossômico (RNAr). Além disso, os ribonucleotídeos são derivados dos desoxirribonucleotídeos, e o DNA não é tão estável quanto o RNA. e) a catálise das ribozimas no mundo de RNA, há bilhões de anos, era muito mais eficiente por causa das baixas temperaturas, quando comparada à catálise atual das enzimas proteicas, o que reforça a hipótese do RNA como molécula inicial. 32. Uma das técnicas atualmente utilizadas para analisar casos de paternidade civil é o emprego de marcadores de microssatélites. Os microssatélites são repetições de trechos de DNA que ocorrem em número variável na população. O número de repetições é transmitido geneticamente. A análise de microssatélites foi utilizada em um teste de paternidade. A tabela abaixo apresenta os resultados relativos ao número de repetições encontradas para a mãe, para o suposto pai e para o filho, em diferentes locos. Com base nos dados apresentados na tabela, é correto afirmar que a) apenas um indivíduo, pela análise, é homozigoto para o loco 6. b) os locos 2, 4 e 7 excluem a possibilidade de paternidade do suposto pai. c) o filho é heterozigoto para a maioria dos locos analisados. d) a mãe referida não é mãe biológica deste filho. e) os locos 1 e 3 excluem a possibilidade de paternidade do suposto pai. TEXTO PARA A PRÓXIMA QUESTÃO: Milhares de atratores luminosos ou bastões de luz (lightsticks) são descartados na costa brasileira por navios que utilizam a técnica de pesca conhecida como espinhel — linha resistente com grande quantidade de anzóis enfileirados. Os atratores são bastões de plástico transparente que contêm um líquido oleoso colorido cujos componentes são perigosos para muitos organismos, inclusive o do ser humano. A exposição de células em cultura a esse óleo causou alterações em proteínas e no material genético (DNA), prejudicou funções celulares e levou parte delas à morte. A curiosidade e a luta pela sobrevivência levaram pescadores e catadores de lixo a ―inventar‖ novos usos para esse material, como formicida, óleo para bronzeamento ou massagem e remédio para dores nas juntas, inflamações e vitiligo. Essas práticas trazem sérios riscos à saúde dos usuários, já que o líquido dos bastões, além de tóxico para as células e o DNA, pode provocar alergias e mutações. O uso do conteúdo dos atratores luminosos como bronzeador pode levar a processos inflamatórios e a envelhecimento precoce e a Amostras de acordo com o número de repetições Mãe Suposto pai Filho Locos 1 12 ; 13 9 ; 14 13 ; 14 2 32 ; 35 29 ; 32 35 ; 35 3 8 ; 10 10 ; 12 10 ; 10 4 7 ; 9 6 ; 9 7 ; 7 5 12 ; 14 11 ; 12 12 ; 14 6 15 ; 17 15 ; 15 15 ; 15 7 18 ; 22 17 ; 19 21 ; 22
  14. 14. Treinamento Ácidos nucléicos – Prof. Emanuel desenvolvimento de câncer de pele, incluindo o temido melanoma. A exposição de células do fígado (mantidas em cultura) a um volume mínimo (0,25 microlitro) do líquido extraído de atratores luminosos usados, dissolvido em 20 mililitros do meio de cultura, levou 20% dessas células à morte após 16 horas. (BECHARA et al., 2009, p. 43-48). 33. A análise do comportamento dos constituintes dos atratores luminosos, inclusive das suas repercussões na vida nos níveis celular e molecular, permite afirmar: 01) As funções celulares são prejudicadas porque resíduos tóxicos impedem a ocorrência simultânea dos processos de transcrição e tradução inerente à célula eucariótica. 02) Hepatócitos e células epiteliais evidenciam em suas características específicas a expressão de todo o genoma, uma vez que se originam de uma mesma célula-ovo por processos de multiplicação e diferenciação. 04) A experiência que resultou em 20% de células de fígado mortas, após 16 horas de exposição ao líquido extraído de atratores luminosos descartados, utilizou um volume mínimo do líquido dos atratores da ordem de 10−7 litros. 08) Mutações presentes em gametas de indivíduos submetidos à contaminação decorrente dos atratores podem ser transmitidas à descendência, independentemente da natureza dominante ou recessiva do alelo. 16) O contato direto dos limpadores de chaminés com a fuligem, composta de hidrocarbonetos semelhantes àqueles presentes nos atratores luminosos, pode ser evitado utilizando-se filtros eletrostáticos que capturam partículas de fuligem desviadas sob a ação de um campo elétrico. TEXTO PARA A PRÓXIMA QUESTÃO: Doping pode ser compreendido como a utilização de substâncias ou método que possa melhorar o desempenho esportivo e atente contra a ética esportiva em determinado tempo e lugar, com ou sem prejuízo à saúde do esportista. Em uma época em que as ciências do esporte aportam cada vez mais decisivamente elementos para a melhoria do desempenho esportivo dos praticantes de esporte de alto rendimento, em particular, e de atividades físicas, em geral, ganham em importância discussões acerca da utilização de metodologias biomoleculares e substâncias em suas mais amplas aplicações. Quer do ponto de vista sanitário ou ético, o doping genético tem suscitado debates tão intensos quanto questionáveis do ponto de vista científico. A questão que se coloca consiste em indagar se o recurso obtido com tecnologias biomoleculares se choca com a ideia de espírito esportivo, essência do Olimpismo, pautado pela busca do equilíbrio entre corpo, mente e espírito. (Adaptado de: RAMIREZ, A; RIBEIRO, Á. Doping genético e esporte.) 34. Com base no texto, na teoria de Habermas e considerando as implicações éticas envolvidas nas disputas entre atletas, assinale a alternativa correta. a) A utilização de terapias genéticas em atletas, por se assemelhar a uma dotação genética, não intencional, similar à da natureza, pode dispensar pressupostos éticos. b) Por desconsiderar a utilização de drogas químicas, o uso do doping genético é eticamente aceitável no esporte, já que implica o aprimoramento genético da espécie. c) O fato de um atleta ter sido submetido à terapia genética rompe com as condições de simetria entre os competidores, pressuposto ético básico das atividades esportivas. d) A ideia de igualdade entre os atletas nas competições representa uma ficção, já que a vitória é a demonstração da real desigualdade entre eles, fator que legitimaria, do ponto de vista ético, o doping genético. e) A igualdade dada pela indisponibilidade da natureza é fator ético que proíbe novas possibilidades genéticas, inviabilizando o grau de aperfeiçoamento moral que o ser humano poderia alcançar.
  15. 15. Treinamento Ácidos nucléicos – Prof. Emanuel 35. Previsões de que a produção global de petróleo em breve começará a diminuir e de que a maior parte do óleo acabará em algumas décadas podem ser demasiadamente pessimistas. Graças a tecnologias avançadas, os poços poderão extrair metade do petróleo subterrâneo conhecido, elevando a média atual que é de 35%. (MANGERI, 2009, p. 46). (TÉCNICAS DE RECUPERAÇÃO TERCIÁRIA) ARMAS POUCO CONVENCIONAIS Depois que as etapas de recuperação primária e secundária tiverem sido aplicadas, métodos mais agressivos, alguns ainda experimentais, podem tornar o petróleo restante mais fluído para melhor escoar em direção aos poços. Como os métodos avançados são caros, só se recorre a esse arsenal se os preços de revenda forem suficientemente altos. COMBUSTÃO Queimar parte de um reservatório — injetando ar no subsolo — aumenta a taxa de recuperação de três formas. Primeiro, o calor do fogo diminui a viscosidade do petróleo. Segundo, a combustão produz dióxido de carbono, que empurra o óleo para cima. Terceiro, o fogo quebra as moléculas maiores e mais pesadas, facilitando seu escoamento. QUÍMICA Substâncias chamadas surfactantes, injetadas no reservatório, ajudam o petróleo a se desprender da rocha e a fluir mais livremente. Camadas de surfactantes envolvem as gotículas de óleo, como o detergente envolve as moléculas de gordura ao limpar superfícies oleosas. Uma variante consiste em injetar produtos químicos que produzem moléculas surfactantes a partir dos componentes presentes no próprio petróleo. BIOLÓGICA Em testes experimentais injetam-se bactérias (junto com nutrientes e, em alguns casos, oxigênio) que crescem na interface entre o petróleo e a rocha, ajudando a liberar o óleo. As bactérias se desenvolvem durante vários dias antes de se retomar a extração. No futuro, micro- organismos geneticamente modificados poderão digerir parcialmente o petróleo mais viscoso para torná-lo mais fluido. Sobre as tecnologias avançadas utilizadas na recuperação do petróleo, analisadas sob a óptica dos conhecimentos das Ciências Naturais, é correto afirmar: 01) As forças de atração entre as moléculas das substâncias que constituem o petróleo são do tipo dipolo instantâneo e induzido. 02) O uso de surfactantes na recuperação terciária do petróleo tem como objetivo aumentar a tensão superficial da água. 04) A utilização de bactérias na fluidificação e liberação do petróleo nos poços fundamenta-se em características desses micro-organismos, como a multiplicação exponencial e as diversificadas estratégias metabólicas.
  16. 16. Treinamento Ácidos nucléicos – Prof. Emanuel 08) O processo de engenharia genética aplicado à tecnologia biológica de recuperação avançada de petróleo implica substituição do genoma bacteriano por genomas de organismos fossilizados. 16) A densidade do petróleo, por ser menor do que a da água, facilita a extração das gotas de óleo presas nos poros da rocha, por meio de injeção de gás natural e água nos reservatórios. 32) As ondas primárias P, sendo ondas longitudinais utilizadas para o mapeamento tridimensional do subsolo, propagam-se nas camadas de rochas com diferentes composições, mantendo a frequência constante.
  17. 17. Treinamento Ácidos nucléicos – Prof. Emanuel Gabarito: Resposta da questão 1: [C] Resposta da questão 2: [E] Resposta da questão 3: [C] Resposta da questão 4: [B] Resposta da questão 5: [C] Resposta da questão 6: [A] Resposta da questão 7: [B] Resposta da questão 8: [D] Resposta da questão 9: 1 + 2 = 3 Resposta da questão 10: 1 + 2 + 4 + 8 = 15 Resposta da questão 11: [C] Resposta da questão 12: [D] Resposta da questão 13: [B] Resposta da questão 14: [B] Resposta da questão 15: [D] A figura mostra que a partir da transcrição de um único RNA, houve a tradução de três proteínas diferentes (proteínas ―a‖, ―b‖ e ―c‖). Resposta da questão 16: [A] O código genético é o conjunto de códons, trincas de bases nitrogenadas que codificam os aminoácidos Resposta da questão 17:
  18. 18. Treinamento Ácidos nucléicos – Prof. Emanuel 01 + 02 + 04 + 16 = 23 A afirmativa 08 é a única incorreta. Organismos transgênicos são organismos geneticamente modificados pela inserção de genes de outros organismos. Dolly foi o primeiro mamífero clonado a partir de um indivíduo adulto. Não era um organismo transgênico: não possuía nenhum gene modificado. Resposta da questão 18: [D] A molécula de DNA é constituída por uma cadeia de nucleotídeos. Cada nucleotídeo, por sua vez, é formado por um grupo fosfato, um açúcar (desoxirribose) e uma base nitrogenada (timina, citosina, guanina ou adenina). Para formar a molécula de DNA, necessária se faz a ligação entre os nucleotídeos. O grupo hidroxila do carbono-3 da pentose do primeiro nucleotídeo liga-se ao grupo fosfato ligado à hidroxila do carbono-5 da pentose do segundo nucleotídeo. Devido a essa formação, a cadeia de DNA fica com uma direção determinada, isto é, em uma extremidade temos livre a hidroxida do carbono-5 da primeira pentose e na outra temos livre a hidroxila do carbono-3 da última pentose. Isso determina que o crescimento do DNA se faça na direção 5’  3’. A ligação entre o fosfato e o açúcar no processo de replicação do DNA e a atividade da enzima RNA polimerase no processo de transcrição do DNA em RNA ocorre sempre na direção 5’  3’. Resposta da questão 19: [E] A partir do texto podemos deduzir que alguns genes normais que são transcritos nas células embrionárias e fetais não deveriam mais ser transcritos nas células adultas, mas são transcritos nas células cancerosas. Resposta da questão 20: [B] Uma mutação em uma molécula de RNA pode causar alterações moleculares na proteína resultante sua da tradução, que podem culminar numa alteração funcional nessa proteína. Se o RNA for de uma célula que tenha uma transcriptase reversa, alterações na transcrição reversa desse RNA também poderão ser observadas. Apenas não poderão ocorrer alterações na autoduplicação do DNA que o originou. Resposta da questão 21: FFVFV Falso: a vantagem evolutiva ocorre com os sucessivos cruzamentos entre diferentes genótipos de plantas, aumentando a variabilidade genética e as chances de sobrevivência e adaptação ao meio ambiente. O sucessivo replantio de clones de plantas não produz vantagem evolutiva frente às espécies selvagens. Falso: alterações pontuais na composição da cadeia polipeptídica, como ocorre na transgenia, não influenciam o valor nutritivo do alimento de origem vegetal, pois os aminoácidos derivados da quebra proteolítica, durante a digestão, são normalmente utilizados para síntese de novas proteínas. Verdadeiro: plasmídios são utilizados como vetores para genes de interesse. São então incluídos em bactérias, que, ao se dividirem por bipartição, multiplicam naturalmente tais genes. Falso: de maneira geral, a liberação do consumo de plantas transgênicas no Brasil, como a soja, infere a inocuidade do produto. Não existem provas de que haja alergias ou intoxicações relacionadas a esses genótipos. Assim, uma pessoa alérgica à linhagem transgênica também poderá ser alérgica à linhagem selvagem.
  19. 19. Treinamento Ácidos nucléicos – Prof. Emanuel Verdadeiro: uma vez que tal população possui o mesmo genótipo, seria menos adaptável ao meio ambiente e, portanto, mais susceptível a alguma praga, cuja transgenia não tenha produzido resistência. Resposta da questão 22: [D] O DNA formado no ciclo de replicação contendo apenas bases com 14N tem uma densidade menor do que aqueles que contêm bases com 15N. Na primeira geração em presença de 15N, cada uma das fitas de DNA 14N servirá de molde para uma contendo 15N. As duplas hélices dos dois DNAs formados terão, portanto, uma fita com 14N e outra fita com 15N, ambos com uma densidade um pouco maior (intermediária), como mostra o gráfico Y. Na segunda geração, os DNAs, que já possuíam uma fita com 14N e outra com 15N, incorporam apenas bases 15N durante a duplicação. Assim, as fitas originais 14N originarão dois DNAs com densidade intermediária, enquanto que as que já possuíam 15N irão gerar dois DNAs mais pesados ainda, como mostra o gráfico Z. Na terceira geração, existirão muito mais fitas simples de DNA com 15N. Assim, de cada quatro fitas, apenas uma terá ainda 14N, gerando um DNA de densidade intermediária. A maior parte do DNA 3 4       , será mais densa, como mostra o gráfico X. Resposta da questão 23: [D] Como o esquema mostra, a sequência de nucleotídeos inicial do RNA viral induz o reconhecimento do códon de iniciação, que corresponde ao aminoácido metionina. Segue-se a sequência nucleotídica que será traduzida em proteína. A tradução é bloqueada quando o códon de terminação, que não corresponde a aminoácido algum, é atingido. Dessa maneira, se a base adenina (A) do códon de iniciação (AUG) é 1, e a base uracila (U), a primeira de qualquer um dos possíveis códons de terminação (UAG, UAA ou UAC), é 133, pode-se dizer que o número total de bases que formam a sequência que será traduzida em aminoácidos é de 133 - 1 = 132. Como cada 3 bases formam um códon, o número de aminoácidos codificados pelo RNA será de 132 3 = 44. Porém, a metionina introduzida pelo códon de iniciação é imediatamente removida após a síntese, fazendo com que o peptídio formado tenha 44 - 1 = 43 aminoácidos. Como dois códons desse peptídeo são do triptofano (UGG), a proporção desse aminoácido na molécula do peptídeo será de 2 em 43, ou seja, 4,65%. Resposta da questão 24: [B] As amostras de célula de pele foram tiradas de uma mesma rã em fases distintas de seu ciclo de vida (girino e adulta). Como em cada fase de vida, as rãs apresentam características fenotípicas diferentes, diferentes genes são ativados ou desativados. Portanto, em cada amostra de célula retirada, diferentes tipos de RNAm serão encontrados. Por outro lado, as amostras de DNA deverão ser iguais em qualquer fase de desenvolvimento, pois todas as células da rã se originaram de uma única célula-ovo. Resposta da questão 25: [C] As diferenças observadas entre os animais citados no texto se deve à expressão diferencial de seus genes. Resposta da questão 26: [B]
  20. 20. Treinamento Ácidos nucléicos – Prof. Emanuel A replicação semiconservativa do DNA envolve a separação das cadeias da molécula mãe que servirão de molde para a produção das cadeias complementares. Nesse processo, as moléculas de DNA filhas conservam, cada uma, a metade da molécula mãe. Resposta da questão 27: [E] O mosquito transmissor da malária (Anopheles) transgênico é geneticamente modificado, porque recebeu um ou mais genes de outra espécie. Resposta da questão 28: [A] Organismos procariotos, como as arqueobactérias e eubactérias (bactérias e cianobactérias), não possuem núcleo organizado. Em procariotos, os ácidos nucleicos, DNA e RNA, encontram- se dispersos no citosol. Resposta da questão 29: [D] De acordo com a tabela de códons, a sequência será: Fenilalanina – glicina – fenilalanina – treonina – ácido aspártico – prolina – serina. O aminoácido prolina ocorre devido à mutação do códon CGU para CCU. Resposta da questão 30: [D] As enzimas de restrição reconhecem os sítios específicos (palíndromos) e cortam o DNA produzindo segmentos moleculares com extremidades adesivas. Resposta da questão 31: V V F F F. A informação genética está contida no DNA e no RNA. Os nucleotídeos do DNA surgiram a partir dos ribonucleotídeos do RNA. A catálise das ribozimas foi muito eficiente há bilhões de anos, quando a temperatura ambiental era mais elevada. Resposta da questão 32: [B] Os locos 2, 4 e 7 excluem a possibilidade de paternidade pelos supostos pais porque seus microssatélites não aparecem no filho, cuja paternidade é discutida. Resposta da questão 33: 04 + 08 + 16 = 28 01 – Falso – Os processo de transcrição e tradução não ocorrem simultaneamente e sim de forma sequencial: a transcrição (síntese de RNAm a partir de DNA) precede a tradução (síntese de proteínas). 02 – Falso – Hepatócitos (células do fígado) e células epiteliais são células especializadas com diferentes funções no organismo e, apesar de se originarem de uma única célula-ovo e de possuírem o mesmo genoma, expressam esse genoma de forma diferente, ativando lotes diferentes de genes e produzindo diferentes proteínas. 04 – Verdadeiro – 0,25 microlitros é igual a 2,5 x 10 -7 litros (1 microlitro = 10 -6 litros).
  21. 21. Treinamento Ácidos nucléicos – Prof. Emanuel 08 – Verdadeiro – Qualquer mutação que ocorra nos genes (dominantes ou recessivos) dos gametas poderá ser transmitida aos descendentes. 16 – Verdadeiro. Comentário de Física: a partículas ionizadas são precipitadas nas placas eletrizadas, geradoras do campo elétrico da coifa eletrostática. Resposta da questão 34: [C] A terapia gênica somática é o tipo de terapia gênica que melhor pode ser aplicado em atletas. Consiste na adição de genes exógenos em algumas células somáticas com a finalidade de alterar um determinado fenótipo. Esse tratamento poderá melhorar o desempenho esportivo do atleta e pode ser considerado um doping. Resposta da questão 35: (01 + 04 + 16 + 32) = 53. 02) Resposta de Física. Incorreta. O uso das substâncias surfactantes diminuem a tensão superficial da água, liberando o petróleo. 16) Resposta de Física. Correta. Por serem menos densas, as moléculas de petróleo tendem a subir para a superfície da mistura de líquidos no reservatório. 32) Resposta de Física. Correta. As ondas primárias (ou ondas P) são ondas longitudinais que fazem a rocha vibrar. São assim chamadas porque têm maior velocidade de propagação. Na propagação de qualquer onda, a frequência mantém-se constante.

×