SlideShare uma empresa Scribd logo
 DOCENTE: Maria Daniela
 CURSO: Licenciatura em Ciências Biológicas
 DISCENTES: Altamira Ramos, Eveline Rocha, Isadora Oliveira
Lourdes Maria e Marília Pio
 TEMA: Polimorfismo genético
Polimorfismo
Genético
ESTRUTURA:
 1- Introdução
 2- Conceito
 3- Alelos
 4- Sistema ABO
 5- SNPs (polimorfismos nucleotídicos Únicos/Simples
 6- VNTR (Números Variável de Repetições Sequenciais/em Tandem.
 7- Herança ???
 8- Referências bibliográficas9- Mapa conceitual
Introdução:
A mutação é a base da evolução, a fonte de toda variabilidade genética.
Ao contrário da recombinação, que organiza a variação previamente existente a
mutação cria os novos elementos (alelos) que irão ou não fazer parte do pool
genético de uma população.
Quando uma variante genética alcança uma frequência de 1%, é denominada
POLIMORFISMO.
Origem da palavra
 O termo Polimorfismo é originaria do
Grego e significa “muitas formas”
 Poli = muitas
Morphos = formas
Polimorfismo genéticos
 Os genes são constituídos basicamente de DNA, que é uma molécula enorme , composta de sequências
complexas de nucleotídeos. Variações nessas sequências que ocorrem na população de forma
estável, sendo encontradas com frequência de 1% ou superior, são denominadas polimorfismos
genéticos.
 De maneira mais clara : o polimorfismo é considerado a variação genética, encontrada em pelo
menos 1% da população, e que não causa doença letal .
 Os polimorfismos podem contribuir para traços como cor da pele, tipo sanguíneo (ABO), e
também podem contribuir para a susceptibilidade a algumas doenças e/ou diferentes respostas
a agentes farmacológicos
O genoma humano possui cerca de 30.000 genes, com um total de 3,12 bilhões de nucleotídeos, os
quais apresentam mais de dois milhões de polimorfismos ocorrendo com frequência de 1 a cada 1.250
pares de bases.
As formas mais comuns de polimorfismos genéticos são
deleções,
mutações
substituições de base única
o que são Polimorfismo?
 dentro de uma espécie, os cromossomos homólogos são bastante similares entre si, mas em
determinadas localizações do cromossomo (loci) pode haver variabilidade na sequência superior a
1% da população, denomina-se polimorfismo.
 Polimorfismos podem atuar como marcadores genéticos, já que são transmitidos associados a outros
genes localizados na região cromossômica próxima a eles (linhagem).
 desta forma, se um gene próximo a um marcador causa uma doença, todos os indivíduos afetados
na família recebem tanto o marcador como o gene causador da doença .
 Os polimorfismo também são responsáveis pela diversidade humana.
 Diferentes fenótipos são decorrentes de diferentes polimorfismos.
 De outro modo, os polimorfismos podem influenciar diretamente sobre fatores de risco associados a
doenças comuns.
Conceito:
 Diferentes versões de uma certa sequência de DNA em determinado local
cromossômico (locus) são chamados de alelos.
 A coexistência de alelos múltiplos em um locus é chamado de POLIMORFISMO
GENÉTICO(Flávia Scapin)
 Caramujo (Capea nemoralis)
 Mariposa (Biston betulária)
Características dos polimorfismos:
Existem diversos tipos de polimorfismo.
Polimorfismo de sítio de restrição (RFLP)
Polimorfismo de nucleotídeo único (SNP)
Polimorfismos de inserção/deleção (indels)
Polimorfismos de minissatélites (VNTR)
Polimorfismos de microssatélites (SRT)
Trataremos de 2 tipos, que são bastante comuns:
SNPs (Polimorfismos Nucleotídicos Únicos/Simples) e os
VNTRs (Número Variável de Repetições).
Polimorfismos de nucleotídeo único (SNP)
 é uma variação na sequência de DNA que afeta somente uma base
(adenina (A), timina (T), citosina (C) ou guanina (G)) na sequência do genoma.
Estas variações devem ocorrer em no mínimo 1% de
uma determinada população para ser considerada como
um SNP. Se, por outro lado, a frequência de uma variação
for inferior a 1%, a mesma será considerada
simplesmente uma mutação.
Os SNPs constituem 90% de todas as variações genômicas humana
e aparecem, em média, uma vez a cada 1.300 bases, ao longo do
gnoma humano. Dois terços dos SNP correspondem a substituições
de uma citosina (C) por uma timina (T). Além de poder acarretar
mudanças morfológicas, essas variações na sequência do DNA
podem influenciar a resposta dos organismos a
doenças, bactérias, vírus, produtos químicos, fármacos, etc.
os SNP consistem de modificações em um único nucleotídeo, que pode:
i) ser substituído; ii) ser excluído ou iii) ser adicionado.
Em todas as três possibilidades há modificação na sequência de DNA. Considere a
seguinte sequência como exemplo:
Sequência original
Substituição
Deleção
Adição
:ATCGATCGATCGATCGATCGACTAGCTA
:ATCGATCGTTCGATCGATCGACTAGCTA
:ATCGATCGTCGATCGATCGACTAGCTA
:ATCGATCGTATCGATCGATCGACTAGCTA
Polimorfismos de minissatélites (VNTR)
As VNTR consistem de sequências nucleotídicas repetidas que
variam no número de ocorrências do motivo básico. Por
exemplo, considere o motivo básico CAG. Alguns indivíduos na
população podem apresentar 5 vezes este motivo em uma região
específica do genoma, ao passo que outros indivíduos podem
apresentar 6, 7, 8, 9, n repetições.
ATG,CAT,GC,CAG,CAG,CAG,CAG,CAG,AGA,TGA,TGC,ATG,CAT,CGT
ATG,CAT,GC,CAG,CAG,CAG,CAG,CAG,CAG,TGC,ATG,CAT,GCA,TCG
ATG,CAT,GC,CAG,CAG,CAG,CAG,CAG,CAG,CAG,GAT,GCA,TGC,ATC
ATG,CAT,GC,CAG,CAG,CAG,CAG,CAG,CAG,CAG,CAG,ATG,CAT,GCT
ATG,CAT,GC,CAG,CAG,CAG,CAG,CAG,CAG,CAG,CAG,CAG,AGT,CAT
Alelos Múltiplos
Alelos Múltiplos
É quando vários alelos condicional
um único caráter.
Exemplo:
Cor da pelagem em coelhos.
Grupo sanguíneo.
Tabela:
Fenótipos Gene Genótipos Cor da pelagem
Aguti ou
selvagem
C CC,CCch,CCh,
Ca
Preto ou marrom
escuro
Chinchila Cch CchCch,CchCh,
CchCa
Cinza claro
Himalaia Ch ChCh,ChCa, Branco com as
extremidades
escuras
Albino Ca Branco com o
olho vermelho
Tipos de pelagem
 Aguti ou selvagem  Chinchila
Tipos de pelagem
 Himalaia  Albino
Grupo sanguíneo
Componentes do sangue
 Plasma sanguíneos : é o
componente líquido do sangue, n
o qual as células sanguíneas estão
suspensas. O plasma é um líquido
de cor amarelada e é o maior
componente do
sangue, compondo cerca de 82%
de seu volume total.
Elementos figurados:
Hemácias;
Leucócitos e
Plaquetas
Hemácias:
 São células em forma de disco
bicôncavo.
 São anucleadas.
 Dura cerca de 120 dias.
 São produzidas pela medula
óssea vermelha.
 Função: atuam no transporte de
gases respiratórios.
Leucócitos:
 São células esféricas maiores que
as hemácias porem presentes no
sangue em menor quantidade.
 São nucleadas.
 São produzidas pela medula
óssea e pelos nódulos linfáticos
 Função: atuam na defesa do
organismo através da produção
de anti corpos.
Plaquetas:
 São anucleadas.
 Não são células e sim fragmentos.
 São produzidas na medula óssea
vermelha a partir de células
denominadas megacariocitos.
 Função: atuam no processo da
coagulação do sangue.
Sistema ABO:
 São quatro os tipos de sangue:
A, B, AB e O.
 é caracterizado pela presença ou
ausência de aglutinogênio, nas
hemácias, e aglutinina, no plasma
sanguíneo.
Aglutinogênios:
 são antígenos encontrados na superfície das hemácias e são
responsáveis pela determinação do fenótipo sanguíneo.
Grupo sanguíneo: Aglutinogênio nas hemácias
A A
B B
AB AB
O -
Genética do sistema ABO:
 O sistema ABO apresenta herança que é
determinada por uma série de três alelos
múltiplos: IA, IB, i.
Transfusão:
 Tipo A recebe do tipo A e do O
 Tipo B recebe do tipo B e do O
 Grupo AB recebe dos grupos
A, B, AB e O pois não possuem
aglutininas no plasma.
 Grupo O só podem receber
sangue de pessoas do grupo O.
 O e doador universal e AB
receptor universal.
Fator RH:
 O fator Rh é um dos dois grupos de antígenos eritrocitários de maior
importância clínica, estando envolvido nas reações transfusionais
hemolíticas e na Doença Hemolítica do Recém-Nascido.
Observação:
 Fator RH+ : Presença de aglutinogênios.
 Fator RH - : Ausência de aglutinogênios e aglutininas.
Fator RH
Genética Fator RH
 Fenótipos: RH+ Genótipos: Rr e r
 Fenótipos: RH- Genótipos: rr
Usos e exemplos
 A maioria dos polimorfismos não têm efeito sobre o
fenótipo, porque eles estão em regiões não codificastes, alguns
afetam nosso fenótipo (altura alta / baixa, luz de cabelo /
escuro, cor dos olhos, etc.) e um número muito pequeno de
polimorfismos são responsáveis ​​por doenças genéticas, como uma
em cada 20 pessoas do norte da Europa leva o gene para a fibrose
cística.
Polimorfismos de DNA de Interesse Forense
A análise de marcadores polimórficos de DNA é atualmente reconhecida
mundialmente como uma técnica forense padrão para a investigação e detecção de uma ampla
variedade de crimes, desde pequenos delitos até crimes hediondos (estupros ou latrocínios)
O DNA pode ser encontrado em qualquer amostra de
tecido, incluindo sangue, sêmen, e até mesmo em saliva
e cabelo.
Os genes, que servem de molde para a produção de
proteínas nas células, constituem somente 5% de uma
cadeia de DNA. O restante é não-codificável e inclui
muitos pares de base repetidos
(VNTRs)
(STRs)
10 a 100 bases
1 a 4 bases
Minisatélite
Microsatélite.
Short Tandem Repeats
Variable Number Tandem Repeat
O método mais usado hoje em dia, é o estudo de regiões repetitivas de DNA
chamadas de minissatélites (VNTRs) e microssatélites (STRs)
Uma técnica muito utilizada para visualização e
separação de moléculas de DNA é a
eletroforese. Esta técnica separa moléculas de DNA de
acordo com o tamanho (massa), forma e compactação.
Técnicas e métodos.
Método RFLP (Polimorfismo por Comprimento de Fragmento de Restrição)
Até 25 fios de cabelo
Uma mancha de fluidos corpóreos
do tamanho de uma moeda de 10 centavos
Pode demorar até um mês [fonte: Baden]
Já não é utilizado atualmente
(VNTRs)
A análise RFLP requer que os investigadores dissolvam o DNA
em uma enzima que quebra a cadeia em pontos específicos. O
número de repetições afeta o comprimento de cada cadeia de
DNA resultante. Os investigadores comparam amostras por
meio da comparação dos comprimentos das cadeias. A
análise RFLP requer uma amostra de DNA bastante grande e
que não tenha sido contaminada por sujeira.
requer o exame de seções múltiplas do feixe de
DNA, para localizar variações, o que aumenta a
possibilidade de erro humano
Método por PCR (Reação em Cadeia de Polimerase)
replicar uma pequena quantidade de
DNA, criando quantidade maior para análise
dura cerca de cinco minutos
mais precisão
pode transformar o DNA em uma amostra
bem menor
O desenvolvimento da técnica de PCR proporcionou
uma revolução no processo de identificação humana
por DNA, ao permitir, em poucas horas, a obtenção de
bilhões de cópias de um determinado locus presente em
um pequeno fragmento de DNA. A amplificação do DNA
por PCR resultou em um grande aumento de
sensibilidade, fazendo com que materiais biológicos
degradados, encontrados em pequenas quantidades
em cenas de crime, pudessem ser analisados com
sucesso. Dessa forma, marcadores genéticos polimórficos
analisáveis em pequenos fragmentos de DNA (o que não
é o caso dos minissatélites) passaram a representar a
base que fundamenta a identificação humana por DNA
(Butler, 2005; Goodwin et al, 2007; Jobling e Gill, 2004)
polimerase de DNA resistente ao calor - uma enzima especial que se une ao DNA e permite
sua réplica - é acrescida. Em seguida, a amostra de DNA é aquecida a 93 graus para separar
os feixes. Depois, a amostra é refrigerada e aquecida novamente. O reaquecimento duplica
o número de cópias. Depois que o processo é repetido cerca de 30 vezes, existe DNA
suficiente para análise posterior.
Referências bibliográficas
 http://www.ebah.com.br/content/ABAAAfL3QAD/apostila-
genetica-forense
 http://pessoas.hsw.uol.com.br/prova-de-dna1.htm
 http://aprendendogenetica.blogspot.com.br/2010/06/genetica-
molecular-polimorfismos.html
 http://geneticanaescola.com.br/wp-home/wp-
content/uploads/2012/10/Genetica-na-Escola-51-Artigo-08.pdf
 http://ciencia.hsw.uol.com.br/evidencias-de-dna1.htm
 http://genetica.ufcspa.edu.br/biomedic/conteudo/genetica_mole
cular/polimorfgen.PDF

Mais conteúdo relacionado

Mais procurados

Prova enfermagem primeiro semestre 2014
Prova enfermagem primeiro semestre 2014Prova enfermagem primeiro semestre 2014
Prova enfermagem primeiro semestre 2014
Rodrigo Luciano
 
ERROS INATOS DO METABOLISMO -EIM- conceitos- MED UNIR
ERROS INATOS DO METABOLISMO -EIM- conceitos- MED UNIRERROS INATOS DO METABOLISMO -EIM- conceitos- MED UNIR
ERROS INATOS DO METABOLISMO -EIM- conceitos- MED UNIR
Gabriela Toledo
 
Aula 4 imunidade adquirida humoral_2-2011
Aula 4 imunidade adquirida humoral_2-2011Aula 4 imunidade adquirida humoral_2-2011
Aula 4 imunidade adquirida humoral_2-2011
mfernandamb
 
Semiologia 02 roteiro prático de anamnese e exame físico
Semiologia 02   roteiro prático de anamnese e exame físicoSemiologia 02   roteiro prático de anamnese e exame físico
Semiologia 02 roteiro prático de anamnese e exame físico
Jucie Vasconcelos
 
Fisiologia Humana 5 - Sistema Cardiovascular
Fisiologia Humana 5 - Sistema CardiovascularFisiologia Humana 5 - Sistema Cardiovascular
Fisiologia Humana 5 - Sistema Cardiovascular
Herbert Santana
 

Mais procurados (20)

Leucemias
Leucemias Leucemias
Leucemias
 
Autoimunidade
AutoimunidadeAutoimunidade
Autoimunidade
 
ICSA17 Imunologia (Prática) - Citometria de fluxo
ICSA17 Imunologia (Prática) - Citometria de fluxoICSA17 Imunologia (Prática) - Citometria de fluxo
ICSA17 Imunologia (Prática) - Citometria de fluxo
 
6 pigmentacoes e calcificacoes v2 (1)
6 pigmentacoes e calcificacoes v2 (1)6 pigmentacoes e calcificacoes v2 (1)
6 pigmentacoes e calcificacoes v2 (1)
 
Aula Pcr
Aula PcrAula Pcr
Aula Pcr
 
Prova enfermagem primeiro semestre 2014
Prova enfermagem primeiro semestre 2014Prova enfermagem primeiro semestre 2014
Prova enfermagem primeiro semestre 2014
 
Agonista e antagonista colinérgico
Agonista e antagonista colinérgicoAgonista e antagonista colinérgico
Agonista e antagonista colinérgico
 
Alterações eritrocitárias
Alterações eritrocitáriasAlterações eritrocitárias
Alterações eritrocitárias
 
ERROS INATOS DO METABOLISMO -EIM- conceitos- MED UNIR
ERROS INATOS DO METABOLISMO -EIM- conceitos- MED UNIRERROS INATOS DO METABOLISMO -EIM- conceitos- MED UNIR
ERROS INATOS DO METABOLISMO -EIM- conceitos- MED UNIR
 
Pato 03
Pato 03Pato 03
Pato 03
 
Carcinogenese e Bases Moleculares Da Oncologia
Carcinogenese e Bases  Moleculares Da OncologiaCarcinogenese e Bases  Moleculares Da Oncologia
Carcinogenese e Bases Moleculares Da Oncologia
 
Aula 4 imunidade adquirida humoral_2-2011
Aula 4 imunidade adquirida humoral_2-2011Aula 4 imunidade adquirida humoral_2-2011
Aula 4 imunidade adquirida humoral_2-2011
 
Sangue e hematopoiese
Sangue e hematopoieseSangue e hematopoiese
Sangue e hematopoiese
 
Replicação do DNA
Replicação do DNAReplicação do DNA
Replicação do DNA
 
Semiologia 02 roteiro prático de anamnese e exame físico
Semiologia 02   roteiro prático de anamnese e exame físicoSemiologia 02   roteiro prático de anamnese e exame físico
Semiologia 02 roteiro prático de anamnese e exame físico
 
PCR- Reação em cadeia pela DNA POLIMERASE!
PCR- Reação em cadeia pela DNA POLIMERASE!PCR- Reação em cadeia pela DNA POLIMERASE!
PCR- Reação em cadeia pela DNA POLIMERASE!
 
Autossomica dominante
Autossomica dominanteAutossomica dominante
Autossomica dominante
 
Aula - Farmacologia básica - Parâmetros farmacocinéticos
Aula - Farmacologia básica - Parâmetros farmacocinéticosAula - Farmacologia básica - Parâmetros farmacocinéticos
Aula - Farmacologia básica - Parâmetros farmacocinéticos
 
Linfócitos B
Linfócitos BLinfócitos B
Linfócitos B
 
Fisiologia Humana 5 - Sistema Cardiovascular
Fisiologia Humana 5 - Sistema CardiovascularFisiologia Humana 5 - Sistema Cardiovascular
Fisiologia Humana 5 - Sistema Cardiovascular
 

Destaque

Polimorfismo
PolimorfismoPolimorfismo
Polimorfismo
Caveiras
 
Polimorfismos Geneticos
Polimorfismos GeneticosPolimorfismos Geneticos
Polimorfismos Geneticos
mauroberta
 
Genetica polomorfismos-1
Genetica polomorfismos-1Genetica polomorfismos-1
Genetica polomorfismos-1
willy5121
 
Mutaciones y snps
Mutaciones y snpsMutaciones y snps
Mutaciones y snps
Edith Arias
 
Polimorfismo variabilidad
Polimorfismo variabilidadPolimorfismo variabilidad
Polimorfismo variabilidad
Alfonso
 

Destaque (20)

Polimorfismo
PolimorfismoPolimorfismo
Polimorfismo
 
Polimorfismo
PolimorfismoPolimorfismo
Polimorfismo
 
Polimorfismos Geneticos
Polimorfismos GeneticosPolimorfismos Geneticos
Polimorfismos Geneticos
 
Genetica polomorfismos-1
Genetica polomorfismos-1Genetica polomorfismos-1
Genetica polomorfismos-1
 
Polimorfismo ppt
Polimorfismo  pptPolimorfismo  ppt
Polimorfismo ppt
 
10 Polimorfismo
10   Polimorfismo10   Polimorfismo
10 Polimorfismo
 
Polimorfismo
PolimorfismoPolimorfismo
Polimorfismo
 
Polimorfismo genetico
Polimorfismo geneticoPolimorfismo genetico
Polimorfismo genetico
 
Polimorfismo
PolimorfismoPolimorfismo
Polimorfismo
 
POO - Aula 10 - Polimorfismo
POO - Aula 10 - PolimorfismoPOO - Aula 10 - Polimorfismo
POO - Aula 10 - Polimorfismo
 
Mutaciones y snps
Mutaciones y snpsMutaciones y snps
Mutaciones y snps
 
Polimorfismo java
Polimorfismo javaPolimorfismo java
Polimorfismo java
 
Polimorfismo variabilidad
Polimorfismo variabilidadPolimorfismo variabilidad
Polimorfismo variabilidad
 
POO: Herencia, Abstraccion y Polimorfismo
POO: Herencia, Abstraccion y PolimorfismoPOO: Herencia, Abstraccion y Polimorfismo
POO: Herencia, Abstraccion y Polimorfismo
 
Int. à Bioinformática (FMU - 08/05/2012)
Int. à Bioinformática (FMU - 08/05/2012)Int. à Bioinformática (FMU - 08/05/2012)
Int. à Bioinformática (FMU - 08/05/2012)
 
Genética e Biologia Molecular
Genética e Biologia MolecularGenética e Biologia Molecular
Genética e Biologia Molecular
 
Amostras Degradadas
Amostras DegradadasAmostras Degradadas
Amostras Degradadas
 
POO - Aula 09 - Herança
POO - Aula 09 - HerançaPOO - Aula 09 - Herança
POO - Aula 09 - Herança
 
ONCOgenics
ONCOgenicsONCOgenics
ONCOgenics
 
Pós em Perícias Forenses
Pós em Perícias ForensesPós em Perícias Forenses
Pós em Perícias Forenses
 

Semelhante a Polimorfismo final

Os princípios da mutação, recombinação gênica, seleção natural e adaptação.ppt
Os princípios da mutação, recombinação gênica, seleção natural e adaptação.pptOs princípios da mutação, recombinação gênica, seleção natural e adaptação.ppt
Os princípios da mutação, recombinação gênica, seleção natural e adaptação.ppt
RafaelLustosaLustosa
 
Genética introdução
Genética introduçãoGenética introdução
Genética introdução
Dalu Barreto
 

Semelhante a Polimorfismo final (20)

Apostila etec biologia
Apostila etec   biologiaApostila etec   biologia
Apostila etec biologia
 
Genetica 110513181400-phpapp01
Genetica 110513181400-phpapp01Genetica 110513181400-phpapp01
Genetica 110513181400-phpapp01
 
Os princípios da mutação, recombinação gênica, seleção natural e adaptação.ppt
Os princípios da mutação, recombinação gênica, seleção natural e adaptação.pptOs princípios da mutação, recombinação gênica, seleção natural e adaptação.ppt
Os princípios da mutação, recombinação gênica, seleção natural e adaptação.ppt
 
Slide Genética
Slide GenéticaSlide Genética
Slide Genética
 
Noção Gentica introdutiva
Noção Gentica introdutivaNoção Gentica introdutiva
Noção Gentica introdutiva
 
Apresentação1 genetica
Apresentação1 geneticaApresentação1 genetica
Apresentação1 genetica
 
CNVs (copy number variations) em populacoes humanas e sua relacao com variaca...
CNVs (copy number variations) em populacoes humanas e sua relacao com variaca...CNVs (copy number variations) em populacoes humanas e sua relacao com variaca...
CNVs (copy number variations) em populacoes humanas e sua relacao com variaca...
 
Alterações do material genético
Alterações do material genéticoAlterações do material genético
Alterações do material genético
 
CNVs e mosaicismo durante o desenvovimento somático
CNVs e mosaicismo durante o desenvovimento somáticoCNVs e mosaicismo durante o desenvovimento somático
CNVs e mosaicismo durante o desenvovimento somático
 
Especialidade de Hereditariedade - Clube de Desbravadores
Especialidade de Hereditariedade - Clube de DesbravadoresEspecialidade de Hereditariedade - Clube de Desbravadores
Especialidade de Hereditariedade - Clube de Desbravadores
 
Genes ligados
Genes ligadosGenes ligados
Genes ligados
 
Divisão celular e alterações dos cromossomos
Divisão celular e alterações dos cromossomosDivisão celular e alterações dos cromossomos
Divisão celular e alterações dos cromossomos
 
Genética introdução
Genética introduçãoGenética introdução
Genética introdução
 
Mutações
MutaçõesMutações
Mutações
 
Genética neurologia-04-2017
Genética neurologia-04-2017Genética neurologia-04-2017
Genética neurologia-04-2017
 
Genética introdução
Genética introduçãoGenética introdução
Genética introdução
 
Neoplasias
NeoplasiasNeoplasias
Neoplasias
 
Neoplasias
NeoplasiasNeoplasias
Neoplasias
 
A genética
A genéticaA genética
A genética
 
Genetica
GeneticaGenetica
Genetica
 

Mais de Isadora Oliveira (10)

Resposta imune contra Helmintos
Resposta imune contra HelmintosResposta imune contra Helmintos
Resposta imune contra Helmintos
 
Conceição do cóite
Conceição do cóiteConceição do cóite
Conceição do cóite
 
Genética
GenéticaGenética
Genética
 
Licenciamento e legislação ambiental
Licenciamento e legislação ambientalLicenciamento e legislação ambiental
Licenciamento e legislação ambiental
 
Biologia marinha - recife de corais
Biologia marinha - recife de coraisBiologia marinha - recife de corais
Biologia marinha - recife de corais
 
Miologia – estudos dos músculos em ANATOMIA COMPARADA
Miologia – estudos dos músculos em ANATOMIA COMPARADAMiologia – estudos dos músculos em ANATOMIA COMPARADA
Miologia – estudos dos músculos em ANATOMIA COMPARADA
 
Tecido ósseo
Tecido ósseoTecido ósseo
Tecido ósseo
 
Embriologia
EmbriologiaEmbriologia
Embriologia
 
Os primeiros vertebrados
Os primeiros vertebradosOs primeiros vertebrados
Os primeiros vertebrados
 
Doença de de parkinson
Doença de de parkinsonDoença de de parkinson
Doença de de parkinson
 

Polimorfismo final

  • 1.  DOCENTE: Maria Daniela  CURSO: Licenciatura em Ciências Biológicas  DISCENTES: Altamira Ramos, Eveline Rocha, Isadora Oliveira Lourdes Maria e Marília Pio  TEMA: Polimorfismo genético
  • 3. ESTRUTURA:  1- Introdução  2- Conceito  3- Alelos  4- Sistema ABO  5- SNPs (polimorfismos nucleotídicos Únicos/Simples  6- VNTR (Números Variável de Repetições Sequenciais/em Tandem.  7- Herança ???  8- Referências bibliográficas9- Mapa conceitual
  • 4. Introdução: A mutação é a base da evolução, a fonte de toda variabilidade genética. Ao contrário da recombinação, que organiza a variação previamente existente a mutação cria os novos elementos (alelos) que irão ou não fazer parte do pool genético de uma população. Quando uma variante genética alcança uma frequência de 1%, é denominada POLIMORFISMO.
  • 5. Origem da palavra  O termo Polimorfismo é originaria do Grego e significa “muitas formas”  Poli = muitas Morphos = formas
  • 6. Polimorfismo genéticos  Os genes são constituídos basicamente de DNA, que é uma molécula enorme , composta de sequências complexas de nucleotídeos. Variações nessas sequências que ocorrem na população de forma estável, sendo encontradas com frequência de 1% ou superior, são denominadas polimorfismos genéticos.  De maneira mais clara : o polimorfismo é considerado a variação genética, encontrada em pelo menos 1% da população, e que não causa doença letal .  Os polimorfismos podem contribuir para traços como cor da pele, tipo sanguíneo (ABO), e também podem contribuir para a susceptibilidade a algumas doenças e/ou diferentes respostas a agentes farmacológicos O genoma humano possui cerca de 30.000 genes, com um total de 3,12 bilhões de nucleotídeos, os quais apresentam mais de dois milhões de polimorfismos ocorrendo com frequência de 1 a cada 1.250 pares de bases. As formas mais comuns de polimorfismos genéticos são deleções, mutações substituições de base única
  • 7. o que são Polimorfismo?  dentro de uma espécie, os cromossomos homólogos são bastante similares entre si, mas em determinadas localizações do cromossomo (loci) pode haver variabilidade na sequência superior a 1% da população, denomina-se polimorfismo.  Polimorfismos podem atuar como marcadores genéticos, já que são transmitidos associados a outros genes localizados na região cromossômica próxima a eles (linhagem).  desta forma, se um gene próximo a um marcador causa uma doença, todos os indivíduos afetados na família recebem tanto o marcador como o gene causador da doença .  Os polimorfismo também são responsáveis pela diversidade humana.  Diferentes fenótipos são decorrentes de diferentes polimorfismos.  De outro modo, os polimorfismos podem influenciar diretamente sobre fatores de risco associados a doenças comuns.
  • 8. Conceito:  Diferentes versões de uma certa sequência de DNA em determinado local cromossômico (locus) são chamados de alelos.  A coexistência de alelos múltiplos em um locus é chamado de POLIMORFISMO GENÉTICO(Flávia Scapin)
  • 9.  Caramujo (Capea nemoralis)  Mariposa (Biston betulária)
  • 10. Características dos polimorfismos: Existem diversos tipos de polimorfismo. Polimorfismo de sítio de restrição (RFLP) Polimorfismo de nucleotídeo único (SNP) Polimorfismos de inserção/deleção (indels) Polimorfismos de minissatélites (VNTR) Polimorfismos de microssatélites (SRT) Trataremos de 2 tipos, que são bastante comuns: SNPs (Polimorfismos Nucleotídicos Únicos/Simples) e os VNTRs (Número Variável de Repetições).
  • 11. Polimorfismos de nucleotídeo único (SNP)  é uma variação na sequência de DNA que afeta somente uma base (adenina (A), timina (T), citosina (C) ou guanina (G)) na sequência do genoma. Estas variações devem ocorrer em no mínimo 1% de uma determinada população para ser considerada como um SNP. Se, por outro lado, a frequência de uma variação for inferior a 1%, a mesma será considerada simplesmente uma mutação. Os SNPs constituem 90% de todas as variações genômicas humana e aparecem, em média, uma vez a cada 1.300 bases, ao longo do gnoma humano. Dois terços dos SNP correspondem a substituições de uma citosina (C) por uma timina (T). Além de poder acarretar mudanças morfológicas, essas variações na sequência do DNA podem influenciar a resposta dos organismos a doenças, bactérias, vírus, produtos químicos, fármacos, etc.
  • 12. os SNP consistem de modificações em um único nucleotídeo, que pode: i) ser substituído; ii) ser excluído ou iii) ser adicionado. Em todas as três possibilidades há modificação na sequência de DNA. Considere a seguinte sequência como exemplo: Sequência original Substituição Deleção Adição :ATCGATCGATCGATCGATCGACTAGCTA :ATCGATCGTTCGATCGATCGACTAGCTA :ATCGATCGTCGATCGATCGACTAGCTA :ATCGATCGTATCGATCGATCGACTAGCTA
  • 13. Polimorfismos de minissatélites (VNTR) As VNTR consistem de sequências nucleotídicas repetidas que variam no número de ocorrências do motivo básico. Por exemplo, considere o motivo básico CAG. Alguns indivíduos na população podem apresentar 5 vezes este motivo em uma região específica do genoma, ao passo que outros indivíduos podem apresentar 6, 7, 8, 9, n repetições. ATG,CAT,GC,CAG,CAG,CAG,CAG,CAG,AGA,TGA,TGC,ATG,CAT,CGT ATG,CAT,GC,CAG,CAG,CAG,CAG,CAG,CAG,TGC,ATG,CAT,GCA,TCG ATG,CAT,GC,CAG,CAG,CAG,CAG,CAG,CAG,CAG,GAT,GCA,TGC,ATC ATG,CAT,GC,CAG,CAG,CAG,CAG,CAG,CAG,CAG,CAG,ATG,CAT,GCT ATG,CAT,GC,CAG,CAG,CAG,CAG,CAG,CAG,CAG,CAG,CAG,AGT,CAT
  • 14.
  • 15.
  • 17. Alelos Múltiplos É quando vários alelos condicional um único caráter. Exemplo: Cor da pelagem em coelhos. Grupo sanguíneo.
  • 18. Tabela: Fenótipos Gene Genótipos Cor da pelagem Aguti ou selvagem C CC,CCch,CCh, Ca Preto ou marrom escuro Chinchila Cch CchCch,CchCh, CchCa Cinza claro Himalaia Ch ChCh,ChCa, Branco com as extremidades escuras Albino Ca Branco com o olho vermelho
  • 19. Tipos de pelagem  Aguti ou selvagem  Chinchila
  • 20. Tipos de pelagem  Himalaia  Albino
  • 22. Componentes do sangue  Plasma sanguíneos : é o componente líquido do sangue, n o qual as células sanguíneas estão suspensas. O plasma é um líquido de cor amarelada e é o maior componente do sangue, compondo cerca de 82% de seu volume total. Elementos figurados: Hemácias; Leucócitos e Plaquetas
  • 23. Hemácias:  São células em forma de disco bicôncavo.  São anucleadas.  Dura cerca de 120 dias.  São produzidas pela medula óssea vermelha.  Função: atuam no transporte de gases respiratórios.
  • 24. Leucócitos:  São células esféricas maiores que as hemácias porem presentes no sangue em menor quantidade.  São nucleadas.  São produzidas pela medula óssea e pelos nódulos linfáticos  Função: atuam na defesa do organismo através da produção de anti corpos.
  • 25. Plaquetas:  São anucleadas.  Não são células e sim fragmentos.  São produzidas na medula óssea vermelha a partir de células denominadas megacariocitos.  Função: atuam no processo da coagulação do sangue.
  • 26. Sistema ABO:  São quatro os tipos de sangue: A, B, AB e O.  é caracterizado pela presença ou ausência de aglutinogênio, nas hemácias, e aglutinina, no plasma sanguíneo.
  • 27. Aglutinogênios:  são antígenos encontrados na superfície das hemácias e são responsáveis pela determinação do fenótipo sanguíneo. Grupo sanguíneo: Aglutinogênio nas hemácias A A B B AB AB O -
  • 28. Genética do sistema ABO:  O sistema ABO apresenta herança que é determinada por uma série de três alelos múltiplos: IA, IB, i.
  • 29. Transfusão:  Tipo A recebe do tipo A e do O  Tipo B recebe do tipo B e do O  Grupo AB recebe dos grupos A, B, AB e O pois não possuem aglutininas no plasma.  Grupo O só podem receber sangue de pessoas do grupo O.  O e doador universal e AB receptor universal.
  • 30. Fator RH:  O fator Rh é um dos dois grupos de antígenos eritrocitários de maior importância clínica, estando envolvido nas reações transfusionais hemolíticas e na Doença Hemolítica do Recém-Nascido. Observação:  Fator RH+ : Presença de aglutinogênios.  Fator RH - : Ausência de aglutinogênios e aglutininas.
  • 32. Genética Fator RH  Fenótipos: RH+ Genótipos: Rr e r  Fenótipos: RH- Genótipos: rr
  • 33. Usos e exemplos  A maioria dos polimorfismos não têm efeito sobre o fenótipo, porque eles estão em regiões não codificastes, alguns afetam nosso fenótipo (altura alta / baixa, luz de cabelo / escuro, cor dos olhos, etc.) e um número muito pequeno de polimorfismos são responsáveis ​​por doenças genéticas, como uma em cada 20 pessoas do norte da Europa leva o gene para a fibrose cística.
  • 34. Polimorfismos de DNA de Interesse Forense A análise de marcadores polimórficos de DNA é atualmente reconhecida mundialmente como uma técnica forense padrão para a investigação e detecção de uma ampla variedade de crimes, desde pequenos delitos até crimes hediondos (estupros ou latrocínios) O DNA pode ser encontrado em qualquer amostra de tecido, incluindo sangue, sêmen, e até mesmo em saliva e cabelo. Os genes, que servem de molde para a produção de proteínas nas células, constituem somente 5% de uma cadeia de DNA. O restante é não-codificável e inclui muitos pares de base repetidos
  • 35. (VNTRs) (STRs) 10 a 100 bases 1 a 4 bases Minisatélite Microsatélite. Short Tandem Repeats Variable Number Tandem Repeat O método mais usado hoje em dia, é o estudo de regiões repetitivas de DNA chamadas de minissatélites (VNTRs) e microssatélites (STRs)
  • 36. Uma técnica muito utilizada para visualização e separação de moléculas de DNA é a eletroforese. Esta técnica separa moléculas de DNA de acordo com o tamanho (massa), forma e compactação. Técnicas e métodos.
  • 37. Método RFLP (Polimorfismo por Comprimento de Fragmento de Restrição) Até 25 fios de cabelo Uma mancha de fluidos corpóreos do tamanho de uma moeda de 10 centavos Pode demorar até um mês [fonte: Baden] Já não é utilizado atualmente (VNTRs) A análise RFLP requer que os investigadores dissolvam o DNA em uma enzima que quebra a cadeia em pontos específicos. O número de repetições afeta o comprimento de cada cadeia de DNA resultante. Os investigadores comparam amostras por meio da comparação dos comprimentos das cadeias. A análise RFLP requer uma amostra de DNA bastante grande e que não tenha sido contaminada por sujeira. requer o exame de seções múltiplas do feixe de DNA, para localizar variações, o que aumenta a possibilidade de erro humano
  • 38. Método por PCR (Reação em Cadeia de Polimerase) replicar uma pequena quantidade de DNA, criando quantidade maior para análise dura cerca de cinco minutos mais precisão pode transformar o DNA em uma amostra bem menor O desenvolvimento da técnica de PCR proporcionou uma revolução no processo de identificação humana por DNA, ao permitir, em poucas horas, a obtenção de bilhões de cópias de um determinado locus presente em um pequeno fragmento de DNA. A amplificação do DNA por PCR resultou em um grande aumento de sensibilidade, fazendo com que materiais biológicos degradados, encontrados em pequenas quantidades em cenas de crime, pudessem ser analisados com sucesso. Dessa forma, marcadores genéticos polimórficos analisáveis em pequenos fragmentos de DNA (o que não é o caso dos minissatélites) passaram a representar a base que fundamenta a identificação humana por DNA (Butler, 2005; Goodwin et al, 2007; Jobling e Gill, 2004) polimerase de DNA resistente ao calor - uma enzima especial que se une ao DNA e permite sua réplica - é acrescida. Em seguida, a amostra de DNA é aquecida a 93 graus para separar os feixes. Depois, a amostra é refrigerada e aquecida novamente. O reaquecimento duplica o número de cópias. Depois que o processo é repetido cerca de 30 vezes, existe DNA suficiente para análise posterior.
  • 39. Referências bibliográficas  http://www.ebah.com.br/content/ABAAAfL3QAD/apostila- genetica-forense  http://pessoas.hsw.uol.com.br/prova-de-dna1.htm  http://aprendendogenetica.blogspot.com.br/2010/06/genetica- molecular-polimorfismos.html  http://geneticanaescola.com.br/wp-home/wp- content/uploads/2012/10/Genetica-na-Escola-51-Artigo-08.pdf  http://ciencia.hsw.uol.com.br/evidencias-de-dna1.htm  http://genetica.ufcspa.edu.br/biomedic/conteudo/genetica_mole cular/polimorfgen.PDF