Caderno do aluno biologia 2 ano vol 2 2014 2017

12.340 visualizações

Publicada em

Caderno do aluno biologia 2 ano vol 2 2014 2017

Publicada em: Educação
0 comentários
0 gostaram
  • Seja o primeiro a comentar

  • Seja a primeira pessoa a gostar disto

Sem downloads
Visualizações totais
No SlideShare
A partir de incorporações
Número de incorporações
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Caderno do aluno biologia 2 ano vol 2 2014 2017

  1. 1. 2a SÉRIE ENSINO MÉDIO Volume2 BIOLOGIA Ciências da Natureza CADERNO DO ALUNO
  3. 3. Governo do Estado de São Paulo Governador Geraldo Alckmin Vice-Governador Guilherme Afif Domingos Secretário da Educação Herman Voorwald Secretária-Adjunta Cleide Bauab Eid Bochixio Chefe de Gabinete Fernando Padula Novaes Subsecretária de Articulação Regional Rosania Morales Morroni Coordenadora da Escola de Formação e Aperfeiçoamento dos Professores – EFAP Silvia Andrade da Cunha Galletta Coordenadora de Gestão da Educação Básica Maria Elizabete da Costa Coordenadora de Gestão de Recursos Humanos Cleide Bauab Eid Bochixio Coordenadora de Informação, Monitoramento e Avaliação Educacional Ione Cristina Ribeiro de Assunção Coordenadora de Infraestrutura e Serviços Escolares Dione Whitehurst Di Pietro Coordenadora de Orçamento e Finanças Claudia Chiaroni Afuso Presidente da Fundação para o Desenvolvimento da Educação – FDE Barjas Negri
  4. 4. Caro(a) aluno(a) No volume anterior do Caderno do Aluno, as temáticas envolvendo os estudos da Organização Celular da Vida estiveram presentes ao longo de todo o caderno. Esperamos que você tenha iniciado a compreensão da Vida a partir de uma perspectiva microscópica ampliando, assim, os conhecimentos construídos na 1ª série do Ensino Médio. Conceitos sobre a Transmissão da Vida e da Variabilidade Genética também fizeram parte dessa construção. Além disso, você teve a oportunidade de conhecer os princípios das Leis de Mendel, as quais, até hoje, fundamentam a Genética Clássica e a Molecular. Neste volume 2, o objetivo é aprofundar seus conhecimentos sobre Genética, de modo a com- preender não somente os mecanismos de transmissão e de variabilidade genética, mas também como o organismo pode ser controlado pelas proteínas, cujo mecanismo de produção está intimamente associado ao DNA. Para isso, é necessário estudar a estrutura do DNA, compreender os processos de Duplicação, Transcrição e Tradução. Esses mecanismos permitem a transmissão das características e o controle do metabolismo do organismo através das proteínas. Por fim, você terá a oportunidade de consolidar seus conhecimentos sobre alguns assuntos mais recentes em termos de pesquisa científica em Genética, tais como: os testes de identificação através do DNA e a produção dos transgênicos. Estes tópicos ainda são alvo de muita controvérsia na atualidade. Bons estudos! Equipe Curricular de Biologia Área de Ciências da Natureza Coordenadoria de Gestão da Educação Básica – CGEB Secretaria da Educação do Estado de São Paulo
  5. 5. TEMA DNA: A ECE TA DA V DA E SE C D GO A compreensão atual sobre o funcionamento dos seres vivos baseia-se em alguns fundamentos, sendo que um deles estabelece que as proteínas, macromoléculas de aminoácidos, são responsáveis por muitas das atividades das células e dos organismos. S T A O DE AP END AGEM 1 A EST T A DO DNA Você, provavelmente, já conhece a sigla DNA. Seja porque já ouviu falar dela na escola, seja porque leu alguma notícia ou assistiu a um programa de televisão que citava a sigla. Nesta Situação de Aprendizagem, você vai se familiarizar com essa molécula, com as diferentes formas de representá-la e com sua organização molecular. Para começo de conversa O que você conhece sobre o DNA ! ? Leitura e análise de imagem Analise a figura a seguir e depois responda às questões. 5 Biologia – 2ª série – Volume 2
  6. 6. Capa da revista Nature, de 15 de fevereiro de 2001, que anunciou o sequenciamento do genoma humano. eprinted b permission from Macmillan Publishers Ltd: Nature 0 , 22 (15 ebruar 2001) Cover. ©MacmillanPublishers Biologia – 2ª série – Volume 2
  7. 7. DNA José Miguel Wisnik Quando você nasceu ouvi seu grito Embora longe muito longe de você Meu coração bateu tambor aflito Tambor aflito e tonto de bater De tanto ser demais De tanto ser além De tanto bem e eu não ter paz m raio quando cai No medo que me fez Não me sentir capaz de ser seu pai Anos se passaram pela vida e te criaram Noites de lembrar e de esquecer Sonhos que não sei me esconderam e [me mostraram Esse dia em que eu te encontrei moça [e mulher E ali em frente a mim você me disse Que a falta que eu nunca te fiz então se fez E desabando como um edifício Abria um abismo a nossos pés 1. Como a imagem do DNA foi composta na capa da revista 2. Na sua opinião, o que signi ca essa imagem na capa de uma revista que trata sobre o sequen- ciamento do genoma humano . Quais características da molécula de DNA podem ser observadas nessa imagem Leitura e análise de texto Agora você vai ler a letra da música DNA, de José Miguel Wisnik, para responder às questões. Você nos viu tão bem No fundo de ninguém E o que se revelava a sós: Que elo nos valeu Que elo, ela e eu E a lua absurda sobre nós DNA, DNA Dança sua dança Dança em espirais DNA, DNA Ponte indecifrável Onde nos levais Seja onde for Onda do mar Mágica tão frágil Ser e nada mais DNA, DNA Daniela © Maianga Edições Musicais 7 Biologia – 2ª série – Volume 2
  8. 8. 1. Qual é a relação de parentesco entre as personagens da canção Justi que com elementos pre- sentes no texto. 2. As personagens da canção apresentam um elo que não é a convivência. De acordo com a can- ção, que elo é esse 3. Localize, no texto, todas as sequências das letras “D”, “N” e “A” apresentadas nas três últimas estrofes. Liste as palavras que apresentam as três letras simultaneamente. . Com as palavras listadas na questão anterior, o autor da música, José Miguel Wisnik, cria um efeito similar a uma das características da molécula de DNA, observável na capa da revista. Que característica é essa Revelando a organização da molécula de DNA A substância ácido desoxirribonucleico (ADN ou DNA) é um polímero de nucleotídeos. dentifique e escreva os nomes dos componentes de um nucleotídeo na ilustração a seguir. Nucleotídeo Nucleotídeo de DNA + + Biologia – 2ª série – Volume 2
  9. 9. Leitura e análise de texto e imagem O modelo da molécula da vida Em 1 53, rancis Crick e James Watson publicaram um artigo na revista Nature no qual sugeriam um modelo para a molécula do DNA. Segundo esse modelo, a molécula de DNA seria constituída por dois polímeros de nucleotídeos organi- zados em forma de uma dupla-hélice, como uma escada retorcida. Os corri- mãos dessa escada são formados de açúcar e fosfato. A novidade da estrutura proposta, além do formato em dupla-hélice, estava relacionada principalmente à maneira como os elementos estavam dispostos no DNA. De acordo com o modelo, as duas cadeias eram manti- das juntas por quatro bases nitrogena- das, duas purinas (adenina e guanina) e duas pirimidinas (timina e citosina), arranjadas aos pares e dispostas perpen- dicularmente ao eixo da molécula. Essas bases nitrogenadas estariam unidas aos pares por pontes de hidrogênio. Os pares seriam específicos, pois as pontes de hidrogênio só poderiam ocorrer entre uma purina e uma pirimidina. Assim, a adenina (purina) só pode se ligar à timina (pirimidina), e a guanina (purina) só se liga à citosina (pirimidina). sso significava que, se em uma das cadeias a base era uma adenina, o elemento correspondente na outra cadeia deveria ser uma timina. O mesmo ocorreria para o par guanina e citosina. Observe a imagem e faça a correspondência entre as características que estão sublinhadas no texto e as estruturas da ilustração. lustração esquemática de uma molécula de DNA. Cadeia de açúcar e fosfato Adenina Timina Guanina Citosina ©SamuelSilva Biologia – 2ª série – Volume 2
  10. 10. Consolidando os conceitos ácido desoxirribonucleico polímero dupla-hélice fosfatos açúcar bases nitrogenadas adenina citosina guanina forma par com forma par com não estão ligados(as) com são ligam-se entre si por meio deestão ligados(as) com estão ligados(as) com que são formados por é constituído por muitos que se mantém ligada por é formado por uma é a sigla para o é um Você já viu um mapa de conceitos um esquema que explica por meio de texto, ima- gem e fluxo de setas o que acontece em deter- minado fenômeno. No mapa de concei- tos proposto, estão fal- tando alguns elementos. Converse com seus cole- gas e descubra a melhor maneira de completá-lo. Desafio! Mapa de conceitos sobre a estrutura do DNA. tilize as informações do mapa de conceitos que você completou com a ajuda dos colegas, para construir um texto em seu caderno explicando o que é e como está organizada a molécula de DNA. Depois de elaborar o texto, responda à seguinte questão: Na capa da revista Nature, as bases nitrogenadas estão representadas por cores diferentes. Qual é o signi cado disso ©ConexãoEditorial é um tipo de 10 Biologia – 2ª série – Volume 2
  11. 11. VOC AP ENDE 1. Em um segmento de 100 nucleotídeos de uma cadeia de DNA, há 25 adeninas e 15 guaninas; no segmento correspondente da cadeia complementar há 30 adeninas. Com base nesses dados, conclui-se que essa molécula de DNA, considerando as duas cadeias, possui: a) 0 timinas. b) 50 guaninas. c) 30 timinas. d) 25 timinas. e) 5 citosinas. 2. (Enem–200 ) A identi cação da estrutura do DNA foi fundamental para compreender seu papel na continuidade da vida. Na década de 1 50, um estudo pioneiro determinou a propor- ção das bases nitrogenadas que compõem moléculas de DNA de várias espécies. Exemplos de materiais analisados Bases nitrogenadas Adenina Guanina Citosina Timina Espermatozoide humano 30,7% 1 ,3% 1 , % 31,2% ígado humano 30, % 1 ,5% 1 , % 30,2% Medula óssea de rato 2 , % 21, % 21,5% 2 ,5% Espermatozoide de ouriço-do-mar 32, % 17,7% 1 , % 32,1% Plântulas de trigo 27, % 21, % 22,7% 27, % Bactéria Escherichia coli 2 ,1% 2 , % 23, % 25,1% A comparação das proporções permitiu concluir que ocorre emparelhamento entre as bases nitrogenadas e que elas formam: a) pares de mesmo tipo em todas as espécies, evidenciando a universalidade da estrutura do DNA. b) pares diferentes de acordo com a espécie considerada, o que garante a diversidade da vida. c) pares diferentes em diferentes células de uma espécie, como resultado da diferenciação celular. d) pares especí cos apenas nos gametas, pois essas células são responsáveis pela perpetuação das espécies. e) pares especí cos somente nas bactérias, pois esses organismos são formados por uma única célula. 11 Biologia – 2ª série – Volume 2
  12. 12. 3. A publicação do trabalho de rancis Crick e James Watson que estabeleceu o modelo da estru- tura da molécula de ácido desoxirribonucleico (DNA) ocorreu em 1 53. Entre as a rmativas a seguir, assinale a CO ETA: a) ma cadeia simples de DNA é constituída de nucleotídeos, compostos por uma desoxirri- bose ligada a um fosfato e a um aminoácido. b) Os nucleotídeos são ligados entre o fosfato e a base nitrogenada. c) Duas cadeias simples de DNA formam uma dupla-hélice, por meio da formação de ligações de hidrogênio entre as bases nitrogenadas. d) As duas cadeias de uma dupla-hélice possuem a mesma sequência de bases nitrogenadas. e) As ligações de hidrogênio mantêm o fosfato ligado ao açúcar desoxirribose. . (Comvest Vestibular nicamp – 2005) Em 25 de abril de 1 53, um estudo de uma única página na revista inglesa Nature intitulado “A estrutura molecular dos ácidos nucleicos”, quase ignorado de início, revolucionou para sempre todas as ciências da vida, sejam elas de homem, rato, planta ou bactéria. James Watson e rancis Crick descobriram a estrutura do DNA. Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. Explique a que correspondem os “corrimãos” e os “degraus” dessa escada. 12 Biologia – 2ª série – Volume 2
  13. 13. S T A O DE AP END AGEM 2 A D PL CA O DO DNA ma das características mais surpreendentes da molécula de DNA é sua capacidade de se duplicar com o auxílio da enzima DNA polimerase e gerar duas moléculas idênticas. ! ? Com o auxílio de um colega, analise o grá co e responda às questões a seguir descrevendo o que observou. Considere, neste exercício, os conteúdos trabalhados no volume 1 sobre divisão celular. 1. O que está acontecendo durante a mitose 2. No período chamado de intérfase (G1, S e G2), o que aconteceu com a quantidade de DNA 3. Ao longo do ciclo celular, a quantidade de DNA por célula começa e termina com que valor O que isso signi ca Leitura e análise de gráfico O gráfico a seguir descreve a variação da quantidade de DNA de uma célula ao longo de seu ciclo. 2C C G1 S G2 G1 Tempo Mitose Prófase Metáfase Anáfase TelófaseeCitocinese QuantidadedeDNA Quantidade de DNA ao longo do ciclo celular. ©Lieobaashi 13 Biologia – 2ª série – Volume 2
  14. 14. ma vez concluído o trabalho, troque-o com o de outra dupla. Verifique se a descrição feita pelos colegas confere com o que está representado no esquema. Etapas do ciclo celular. ©SamuelSilva Duplicação do DNA Aumento da massa celular Célula Núcleo Divisão celular I nício do ciclo Mitose ase S G1 G2 Aumento da massa celular A duplicação do DNA 1. Com base no que você e seus colegas já conhecem, responda: Como a molécula de DNA con- segue se duplicar As células formadas ao término da mitose são iguais ou diferentes Atividade coletiva: simulando a duplicação do DNA Nessa atividade, seu professor vai organizá-los de acordo com as fileiras da classe. Siga as instru- ções para dramatizar a duplicação de uma molécula de DNA. 1 Biologia – 2ª série – Volume 2
  15. 15. Cada aluno deve escrever em uma folha de papel a base nitrogenada que representa. Cada fileira de carteiras será uma cadeia de DNA. As fileiras 2 e 3 iniciam a atividade definindo qual será a sequência de bases nitrogenadas: adenina (A), timina (T), citosina (C) ou guanina (G). Você e seus colegas podem definir a ordem, porém é importante lembrar da complementaridade das cadeias. Terminada a dramatização, escreva em seu caderno um resumo do que ocorreu. 1. Agora, retome o grá co do início da Situação de Aprendizagem e compare os fenômenos que ocorrem na variação de DNA de uma célula ao longo de seu ciclo com as etapas de dramati- zação que a classe acabou de realizar. 2. Complete a gura a seguir indicando o que representa cada cadeia da imagem de DNA em relação às leiras que a classe formou durante a dramatização. 1o Passo 2o Passo 3o Passo leiraleira leiraleira leiraleira leiraleira leiraleira ©SamuelSilva tas originais derivadas da duplicação Duplicação do DNA de acordo com a dramatização realizada. 15 Biologia – 2ª série – Volume 2
  16. 16. L O DE CASA 1. Elabore um texto em seu caderno explicando como a complementaridade das bases nitrogena- das permite a duplicação do DNA. Atenção! Nesse texto, você deve apresentar: a descrição da estrutura do DNA; a complementaridade das bases nitrogenadas; o processo de duplicação do DNA durante o ciclo celular; a relação entre os eventos anteriores e a produção de duas células idênticas. PESQ SA ND V D AL O que é necessário para que o DNA se duplique? Consulte seu livro didático e identifique o papel da enzima polimerase do DNA (em alguns livros, você encontra o termo DNA polimerase) no processo de duplicação do DNA e as condições para que ela atue. O exercício a seguir requer que você pense no processo de duplicação como algo dinâmico que ocorre na interação entre o DNA e diversas proteínas. Em primeiro lugar, observe o quadro com a estimativa do número de pares de base (em bilhões) do DNA de diferentes espécies. 1 Biologia – 2ª série – Volume 2
  17. 17. Espécie Pares de base do DNA Jiboia 2100000000 Ser humano 3100000000 Gafanhoto 300000000 Cebola 1 000000000 Salamandra 1 0000000000 Ameba 70000000000 Agora, pense no seguinte problema: Para duplicar o DNA, antes da divisão celular, a enzima polimerase do DNA adiciona novos nucleotídeos a uma velocidade aproximada de 00 nucleotídeos por segundo. Quantos dias seriam necessários para uma célula de cada uma das espécies listadas duplicar o seu DNA Espécie Jiboia Ser humano Gafanhoto Cebola Salamandra Ameba Dias possível que você e seus colegas de classe tenham chegado a um número elevado de dias necessários para a duplicação de uma célula de DNA de cada uma das espécies. Sabe-se, no entanto, que o tempo médio de duplicação de uma célula eucariota é de 12 horas. Tendo em vista que a enzima polimerase do DNA apresenta uma velocidade de reação constante para todas as espécies analisadas, converse com seus colegas e apresente uma hipótese para explicar essa aparente contradição. 17 Biologia – 2ª série – Volume 2
  18. 18. VOCÊ APRENDEU? 1. Durante a intérfase da célula, pode-se a rmar que: a) praticamente não há atividade metabólica celular. b) ocorrem alterações no formato da célula. c) ocorre duplicação da célula. d) ocorre duplicação do DNA. e) a dupla- ta do DNA se separa. 2. A sequência de nucleotídeos CTGACCTTCG forma um segmento de DNA dupla-hélice ao se ligar à ta complementar: a) CTGACCTTCG b) GCTTCCAGTC c) GACTGGAAGC d) CTGACCTGCG e) AGCTTCCAGT 3. Para duplicar o DNA antes da divisão celular, existe uma proteína, a enzima DNA polimerase, cuja velocidade de reação é equivalente a aproximadamente 00 nucleotídeos por segundo. Quantos dias seriam necessários para uma célula de mosca-da-fruta duplicar seu DNA, sabendo que cada célula dessa espécie apresenta aproximadamente1 0 milhões de pares de base de DNA? a) 10 b) 5 c) 1 d) 7500 e) 125 . Algumas células não se multiplicam ao longo de sua vida. Entre elas, podem ser citados os neurônios. Para esse tipo celular especí co, como caria o grá co apre- sentado a seguir? 1 Biologia – 2ª série – Volume 2
  19. 19. Densidade do DNA apenas com 1 N Densidade do DNA apenas com 15 N ©SamuelSilva A B C 5. ( uvest–200 ) Bactérias (Escherichia coli) foram cultivadas durante várias gerações em um meio de cultura no qual toda a fonte de nitrogênio era o isótopo pesado15 N. De uma amostra destas bactérias (amostra A), extraiu-se o DNA que foi submetido a uma técnica de centrifugação que permite separar moléculas de DNA de acordo com sua densidade. O restante das bactérias foi transferido para um meio de cultura em que todo o nitrogênio disponível era o isótopo normal 1 N. Retirou-se uma segunda amostra (amostra B), quando as bactérias completaram uma divisão celular neste novo meio, e uma terceira amostra (amostra C), quando as bactérias completaram duas divisões celulares. O DNA das bactérias das amos- tras B e C foi também extraído e centrifugado. A figura mostra o resultado da centrifugação do DNA das três amostras de bactérias. a) Por que, na amostra B, todo o DNA tem uma densidade intermediária entre o que é cons- tituído apenas por 1 N e o que contém apenas 15 N? b) Considerando que, na amostra C, a quantidade de DNA separada na faixa inferior é X, que quantidade de DNA há na faixa superior? APRENDENDO A APRENDER Existe uma série de recursos, disponíveis na internet, que representam o processo de duplicação do DNA de forma dinâmica e animada. Entre em um site de busca e procure pelos termos: replicação DNA; DNA replication animation. 1 Biologia – 2ª série – Volume 2
  20. 20. Dica! nicie sua pesquisa pelos sites (acessos em: 27 fev. 201 ): O DNA vai ao supermercado. Disponível em: http: p-content uploads 2011 10 dna supermercado.pdf ; DNA from the beginning. Disponível em: http: . Site em língua inglesa com várias animações relacionadas ao tema. 20 Biologia – 2ª série – Volume 2
  21. 21. S TUA O DE APREND AGEM 3 DO DNA PROTE NA Nesta Situação de Aprendizagem, você vai relacionar as características da molécula de DNA com a síntese de RNAs e de proteínas e compreender como esses três tipos de substâncias estão envolvidos com a manifestação das características. PESQU SA ND V DUAL O papel das macromoléculas comum referir-se às proteínas como componentes importantes para a organização e o funcio- namento da célula. No entanto, para o desenvolvimento desta Situação de Aprendizagem, é necessário ter essa noção mais clara e aprofundada. Para isso, pesquise em seu livro didático e na internet, converse com seus colegas e preencha a tabela a seguir: ! ? Funções das proteínas Função Descrição Exemplo Enzimática Atuam no metabolismo catalisando reações químicas. Pepsina, catalase, ATP sintetase. Estrutural Movimento Defesa Comunicação celular denti cação das células Transporte Características do DNA e do RNA DNA e RNA são ácidos nucleicos, por isso apresentam algumas semelhanças e algumas diferen- ças. Para estabelecer critérios claros que permitam comparar DNA e RNA, preencha a tabela a seguir consultando seu livro didático ou outra fonte de informação, como a internet. 21 Biologia – 2ª série – Volume 2
  22. 22. DNA RNA 1. Qual é o signi cado da sigla? 2. O nucleotídeo desse ácido nucleico é formado por qual tipo de açúcar? 3. Quais são as bases nitrogenadas que podem formar um nucleotídeo desse ácido nucleico? . A molécula desse ácido nucleico é for- mada por ta simples ou dupla- ta? 5. Quais podem ser as funções desem- penhadas por moléculas desse ácido nucleico? . Em uma célula humana, onde são encontradas as moléculas desse ácido nucleico? Confira com seus colegas o preenchimento da tabela. O RNA mensageiro A seguir, você realizará a leitura da história em quadrinhos (HQ) Lembranças de um RNA mensageiro. Antes dessa leitura, reflita sobre a questão a seguir e registre que informações você espera encontrar nessa HQ. Como as informações contidas no DNA, que passam de uma geração para outra, podem resultar em uma característica? 22 Biologia – 2ª série – Volume 2
  23. 23. ©Karmo 23 Biologia – 2ª série – Volume 2
  24. 24. ©Karmo 2 Biologia – 2ª série – Volume 2
  25. 25. Após a leitura da HQ, discuta com um colega e responda às questões a seguir: 1. Quais são, a partir das informações da HQ, os três tipos de RNA? Pesquise em seu livro didá- tico ou em outras fontes quais são suas respectivas funções. 2. Pelo texto, a tradução do RNA mensageiro começa sempre em uma mesma sequência. Que sequência é essa? 3. Em que local da célula eucariota ocorre a fabricação de RNA mensageiro? . Em que local da célula eucariota ocorre a tradução do RNA mensageiro? 5. De acordo com o texto, quando é encerrada a tradução do RNA mensageiro? . Que palavras podem substituir a expressão “sequências de aminoácidos”? 7. Com base na HQ, redija um texto que descreva a síntese de proteínas. 25 Biologia – 2ª série – Volume 2
  26. 26. Decifrando o código genético Agora, você vai estudar com mais profundidade como uma informação presente no DNA pode se transformar em uma característica. Para isso, discuta com seus colegas a manchete a seguir, tomando como base as seguintes questões: 1. O que é um código? 2. O que signi ca código genético? 3. O que os cientistas mapearam? . O que é o “amarelinho”? 5. O que é o “Genoma Xylella”? Cientistas mapeiam o código genético da praga da laranja inalizado o maior projeto de pesquisa biológica do País, o Genoma Xylella, que pretende acabar com o amarelinho. 2 Biologia – 2ª série – Volume 2
  27. 27. Leitura e análise de tabela O quadro a seguir resume o que a Ciência define como código genético. Com o auxílio de seu professor e do livro didático ou de outras fontes de consulta, procure compreender como o código genético é lido. Em seguida, procure pelo significado do termo “códon” e escreva no espaço a seguir. Códon: O código genético dos seres vivos 1ª- letra do códon 2ª- letra do códon 3ª- letra do códonU C A G U fenilalanina fenilalanina leucina leucina serina serina serina serina tirosina tirosina parada parada cisteína cisteína parada triptofano U C A G C leucina leucina leucina leucina prolina prolina prolina prolina histidina histidina glutamina glutamina arginina arginina arginina arginina U C A G A isoleucina isoleucina isoleucina metionina treonina treonina treonina treonina asparagina asparagina lisina lisina serina serina arginina arginina U C A G G valina valina valina valina alanina alanina alanina alanina ácido aspártico ácido aspártico ácido glutâmico ácido glutâmico glicina glicina glicina glicina U C A G . O que é genoma? 27 Biologia – 2ª série – Volume 2
  28. 28. Leitura e análise de texto O código genético dos seres vivos Uma notícia publicada no ano 2000 apresentava o seguinte título: “Anunciada decifração do código genético da espécie humana”. No entanto, o código genético começou a ser decifrado em 1 1, quando Marshall Nirenberg produziu um RNA mensageiro apenas com nucleotídeos uracila. A proteína formada por Nirenberg era composta apenas de aminoácidos fenilalanina. Antes do término da década de 1 0, o código genético estava completamente decifrado. Para cada trinca de bases nitrogenadas, um aminoácido correspondente já havia sido identificado, conforme mostra o quadro do código genético dos seres vivos. Elaborado por Rodrigo Venturoso Mendes da Silveira especialmente para o São Paulo faz escola. 1. Depois de conversar com os colegas sobre o título da reportagem Cientistas mapeiam o código genético da praga da laranja e de observar o quadro que resume o código genético, escreva como a notícia publicada em 2000 pode ser interpretada. Em seguida, reescreva o título da reporta- gem com base no que você aprendeu. 2. Retome a HQ Lembranças de um RNA mensageiro e descubra: a) Qual a trinca de nucleotídeos (códon) que inicia a síntese de uma proteína. b) Quais os três primeiros aminoácidos codi cados pelo RNA mensageiro da história. 3. Na HQ, o códon UAG desempenha papel importante na síntese de proteínas. Que papel é esse? . Procure no quadro O código genético dos seres vivos outros códons que exerçam a mesma função do códon UAG. 2 Biologia – 2ª série – Volume 2
  29. 29. 5. Quais códons correspondem ao aminoácido arginina e quais codi cam o aminoácido triptofano? . O que pode representar a diferença entre as formas como os aminoácidos arginina e triptofano são codi cados? 7. O que signi ca dizer que o código genético é universal? . Consultando o quadro O código genético dos seres vivos, traduza a sequência de DNA apresen- tada a seguir. Do DNA à proteína ita do DNA a ser transcrita TAC GGA GTA GCT ATA ATT RNA mensageiro Proteína VOCÊ APRENDEU? 1. Um professor de Biologia, procurando explicar de maneira mais simpli cada para seus alunos o processo de síntese de proteínas, utilizou as seguintes analogias: 2 Biologia – 2ª série – Volume 2
  30. 30. – magine que você queira fazer um bolo. A primeira coisa de que você vai precisar é uma receita. O mesmo ocorre em relação à síntese de proteínas. – Para produzir um bolo, além da receita, você precisará de ingredientes. Da mesma forma, a célula precisa de certos ingredientes para produzir proteínas. – Suponha que sua mãe guarde todas as receitas no computador, que ca no escritório ou no quarto de estudos. Para utilizar a receita, você terá de imprimi-la. V – Para fazer o bolo, você se dirige à cozinha com a receita impressa. Lá estão, além dos ingredientes, o forno e os objetos para fazer o bolo. Em uma célula, também há um local onde ocorre a síntese de proteínas. Analise as alternativas e assinale aquela que indica uma correspondência verdadeira: a) O computador com as receitas seria o RNA das células. b) O quarto de estudos é o citoplasma da célula e o computador representa os ribossomos. c) O aluno, ao ler a receita e fazer o bolo na cozinha, representa o processo de tradução. d) A receita impressa corresponde ao RNA transportador. e) O bolo feito corresponde ao gene. 2. ( uvest – 1 ) Existe um número muito grande de substâncias com funções antibióticas. Essas substâncias diferem quanto à maneira pela qual interferem no metabolismo celular. Assim, a TETRAC CL NA liga-se aos ribossomos e impede a ligação do RNA transportador; a M TOM C NA inibe a ação da polimerase do DNA e a ESTREPTOM C NA causa erros na leitura dos códons do RNA mensageiro. Essas informações permitem a rmar que: – A TETRAC CL NA impede a transcrição e leva a célula bacteriana à morte por falta de RNA mensageiro. – A M TOM C NA, por inibir a duplicação do DNA, impede a multiplicação da célula bacteriana. – A ESTREPTOM C NA interfere na tradução e leva a célula bacteriana a produzir proteínas defeituosas. Das alternativas acima, a) apenas é correta. b) apenas e são corretas. c) apenas e são corretas. d) apenas e são corretas. e) , e são corretas. 30 Biologia – 2ª série – Volume 2
  31. 31. 3. Se coletássemos proteínas em um ovo fóssil de certa espécie de dinossauro, seria possível reconstituir o DNA desses animais? Justi que. . ( uvest–2005) A seguir está representada a sequência dos 13 primeiros pares de nucleotídeos da região codi cadora de um gene. --- A T G A G T T G G C C T G --- --- T A C T C A A C C G G A C --- A primeira trinca de pares de bases nitrogenadas à esquerda corresponde ao aminoácido metionina. A tabela a seguir mostra alguns códons do RNA mensageiro e os aminoácidos codificados por cada um deles. Códon do RNAm Aminoácido ACC treonina AGU serina AUG metionina CCU prolina CUG leucina GAC ácido aspártico GGC glicina UCA serina UGG triptofano a) Escreva a sequência de bases nitrogenadas do RNA mensageiro transcrito a partir desse segmento de DNA. b) Utilizando a tabela de código genético fornecida, indique a sequência dos três aminoácidos seguintes à metionina, no polipeptídio codi cado por esse gene. 31 Biologia – 2ª série – Volume 2
  32. 32. c) Qual seria a sequência dos três primeiros aminoácidos de um polipeptídio codi cado por um alelo mutante desse gene, originado pela perda do sexto par de nucleotídeos (ou seja, a deleção do par de bases T A)? Efeito das mutações O termo “mutação” é bastante popular e, normalmente, as pessoas o associam com o surgimento de organismos com características aberrantes. Em Biologia, no entanto, mutações gênicas são alte- rações permanentes na sequência de nucleotídeos do DNA. Essas alterações podem ter diferentes resultados, de acordo com o efeito que produzem na proteína final. Descubra algumas dessas situações resolvendo as questões: 1. Este é o trecho de um gene ( ta molde) fundamental para todos nós, o gene da proteína beta-hemoglobina. Essa proteína é de extrema importância no transporte de gás oxigênio para o corpo e sua função depende de sua estrutura espacial, que por sua vez depende da sequência de aminoácidos que a compõe. … CAC GTG GAC TGA GGA CTC CTC TTC… Lembrando que os códons se referem ao RNAm, consulte o quadro com o código genético para dizer qual é a sequência de aminoácidos correspondente. 2. Suponha que ocorra a seguinte mutação: … CAT GTG GAC TGA GGA CTC CTC TTC… Agora indique qual seria seu possível efeito. 3. Suponha agora a seguinte mutação: … TAC GTG GAC TGA GGA CTC CTC TTC… ndique as consequências em relação à sequência inicial. 32 Biologia – 2ª série – Volume 2
  33. 33. . Considere agora as duas mutações a seguir e seus efeitos. a) … CAC GTG GAC TGA GGA ATC CTC TTC… b) … CAC GT GAC TGA GGA CTC CTC TTC… 5. Para concluir, faça uma pesquisa sobre a anemia falciforme e sua causa genética. 33 Biologia – 2ª série – Volume 2
  34. 34. S TUA O DE APREND AGEM DO DNA CARACTER ST CA A proposta para esta Situação de Aprendizagem é rever alguns conceitos de Genética relacionados às ideias de Mendel sobre a herança biológica e, a partir deles, estabelecer relações com os conteúdos trabalhados sobre a molécula de DNA e a tradução da informação genética. Para começo de conversa Você se lembra do trabalho de Mendel estudado no volume 1? Para iniciar esta Situação de Aprendizagem, será necessário retomá-lo. nterprete o esquema e o mapa conceitual e, a seguir, redija um texto mostrando o que você entendeu. Ao concluir seu texto, troque-o com o de um colega para análise. Ao receber o texto do colega, verifique se os conceitos do mapa foram empregados corretamente para explicar o trabalho de Mendel com as ervilhas. ! ? ©SamuelSilva Esquema do trabalho de Mendel com as ervilhas. 3 Biologia – 2ª série – Volume 2
  35. 35. Mapa conceitual sobre Genética. ORGAN SMOS V VOS são formados por C LULAS possuem estão contidas em um N ORMA ES GEN T CAS GENE em seu conjunto no indivíduo, constituem o são transmitidas entre as gerações pelos formam-se por possibilita a podem ser fundamenta a ocorre nos ME OSE pode apresentar formas alternativas chamadas ALELOSPR ME RA LE DE MENDEL SEGREGA O 3 : 1 pode originar as proporções HOMO G T CA HETERO G T CA se expressam na condição se expressam na condição DOM NANTES RECESS VOS em interação com o ambiente produz o GEN T PO EN T PO GAMETAS ©Adesign 35 Biologia – 2ª série – Volume 2
  36. 36. Leitura e análise de texto Para integrar os conceitos de Biologia Molecular aos conceitos de Genética Clássica, será apresentado como exemplo o trabalho de pesquisadores ingleses. Esses cientistas trabalharam com uma das sete características de ervilha (Pisum sativum) estudadas por Mendel: a textura da semente, em que o estado liso é dominante sobre o rugoso. Do genótipo ao fenótipo Ao pesquisar a causa do fenótipo rugoso, pesquisadores ingleses suspeitaram de que esse fenótipo fosse consequência da grande quantidade de um açúcar simples (amido não ramificado) no cotilédone, o que resultaria no acúmulo de grande quantidade de água. Quando a semente amadurece, ela seca, ou seja, perde água. Como nessa semente há grande acúmulo de água, ela fica muito volumosa e, ao secar, sua película se enruga. A semente lisa possui açúcares com muitas ramificações, não acumulando água, e, como consequência, não tem rugosidade. Esses pesquisadores descobriram que o alto índice de açúcar simples na semente rugosa se deve a um defeito na síntese de amido, o que ocorre em razão da ausência de uma enzima ramificadora do amido (SBE-1, starch-branching enzyme ou enzima ramificadora do amido). Além disso, notaram que as células do cotilédone das ervilhas que acumulam amido não ramificado, por pressão osmótica, retêm mais água. O alelo “R”, que codifica a semente lisa, é um fragmento de DNA com 3,3 mil pares de bases. Esse alelo codifica a enzima SBE-1, responsável pela produção do amido ramificado. O alelo “r”, que codifica a semente rugosa, é um fragmento de DNA com uma inserção de 00 pares de bases, portanto o gene possui ,1 mil pares de bases, e a enzima SBE-1 produzida não é funcional. Assim, não há produção de amido ramificado, o que leva ao maior acúmulo de água; quando a semente seca, torna-se rugosa. Elaborado por Rodrigo Venturoso Mendes da Silveira especialmente para o São Paulo faz escola. Após a leitura, responda às questões a seguir: 1. Qual é o papel da enzima SBE-1 na semente lisa? 3 Biologia – 2ª série – Volume 2
  37. 37. Sementes lisas puras apresentam esta sequência: TAC TCT ATG AAC CTC GTT AAA GTA CTA AAC ACT Sequência complementar: Sementes rugosas puras apresentam a seguinte sequência: TAC TCT ATG AAC CTC GTT AAA GTA CTA AAT AGA AAA ACT TT Sequência complementar: . A seguir, forme o RNA mensageiro, utilizando como molde as sequências apresentadas nos quadros da questão anterior. 5. Para nalizar, faça a tradução das moléculas de RNA mensageiro e escreva no quadro quais são as proteínas formadas para cada tipo de semente. Para isso, consulte o quadro O código genético dos seres vivos apresentado na Situação de Aprendizagem anterior. 2. Segundo o texto, qual a relação entre o fato de uma ervilha ser lisa ou rugosa e a osmose? 3. A seguir, você vai encontrar duas simulações hipotéticas de sequências obtidas na análise do DNA de dois tipos diferentes de ervilhas puras (homozigóticas): com sementes lisas e com sementes rugosas. Qual a sequência complementar do DNA em cada caso? 37 Biologia – 2ª série – Volume 2
  38. 38. Tipo de semente Sequência de aminoácidos lisa rugosa . Qual das sequências de DNA corresponde ao alelo “r”, responsável pelo caráter semente rugosa? 7. Qual das sequências de DNA corresponde ao alelo “R”, responsável pelo caráter semente lisa? . Considere, agora, uma planta de ervilha heterozigótica para a característica textura da ervilha. Quais tipos de alelos ela possui? . Uma ervilha heterozigótica (Rr) apresenta o mesmo fenótipo de uma ervilha homozigótica dominante (RR): ambas são lisas. Esses dois tipos de ervilha são idênticos do ponto de vista molecular? Comente. 3 Biologia – 2ª série – Volume 2
  39. 39. 0 20 30 40 10 50 60 I II III IV V 70 80 90 100 10. Considerando o texto Do genótipo ao fenótipo e o grá co apresentado a seguir, discuta com seus colegas de classe se a sequência dos aminoácidos de uma proteína pode in uenciar no funcio- namento dela. Porcentagem de amido rami cado na presença de diferentes proteínas. Dados ctícios. 11. Se a ervilha apresenta 50% de proteínas do tipo , ela tem qual fenótipo? 12. Procure em seu livro didático as diferenças entre as estruturas primária, secundária e terciária de uma proteína. Estrutura primária: Estrutura secundária: Estrutura terciária: Integrando conceitos As ideias de Mendel foram o ponto de partida para a compreensão atual de como as características biológicas são herdadas e se manifestam. Acontece, entretanto, que em seu tempo Mendel não tinha acesso a uma série de informações conhecidas hoje. Assim, se for feito um paralelo entre as ideias dele, que datam de 1 , e o que se sabe agora, pode-se construir o quadro a seguir: 3 Biologia – 2ª série – Volume 2
  40. 40. Mendel, em 1866, deduziu que: Mendel, hoje, saberia que: As plantas possuem fatores hereditários. As plantas híbridas ( 1) para semente lisa e rugosa possuem os dois alelos (“R” e “r”), que Mendel chamou de fatores. Os fatores são transmitidos de uma geração à outra. A meiose explica como os alelos se separam na for- mação dos gametas. Os fatores podem ser representados por letras: maiúscula (R) para o dominante e minúscula (r) para o recessivo. Durante a meiose, os cromossomos homólogos se separam. As plantas híbridas ( 1) possuem os dois fatores (Rr); só assim podem produzir dois tipos de descendentes ( 2). Os cromossomos são constituídos por DNA e proteínas. Os fatores na planta híbrida não se misturam. O DNA é formado por uma cadeia dupla de nucleotídeos. Os fatores na planta híbrida devem se separar na formação dos gametas, para que cada game- ta possua apenas um dos fatores. A partir do DNA, uma molécula de RNA é sin- tetizada (RNA mensageiro), codi cando uma proteína. Obs.: é importante ressaltar que nessa época nada se sabia sobre cromossomos e meiose. A textura da semente é determinada pela presen- ça da enzima SBE-1 (strach-branching enzyme ou enzima ramificadora do amido). A enzima fun- cional, que permite o acúmulo de água tornando a semente lisa, é codificada pelo alelo R, um fragmento de DNA constituído por 3,3 mil pares de bases. A enzima codificada pelo alelo r (for- mado por ,1 mil pares de bases, contendo um trecho de 00 pares adicionais em sua sequência) não é funcional e impede o acúmulo de água, de modo que a semente torna-se rugosa. Agora, o professor vai organizar a turma, e você deve articular os conceitos apresentados na tabela na forma de um mapa de conceitos. O objetivo desse mapa é integrar os conceitos de Biologia Molecular e de Genética Clássica. Para a construção do mapa, utilize o conjunto de palavras apresentadas na página seguinte e o espaço em branco disponível. Caso o espaço não seja suficiente, faça o mapa em seu caderno. Em seguida, trace linhas, orientadas por setas, relacionando os vários conceitos por meio das expressões de ligação. Se for necessário, crie novas expressões para relacionar os conceitos. aça correlações múltiplas, de modo que o mapa final fique com o aspecto de rede, evitando relações lineares simples. Para isso, o mesmo conceito pode ser conectado a vários outros. Para ter uma noção de como é um mapa de conceitos, retome outros mapas que foram apresentados ao longo deste Caderno. Depois de construir seu mapa de conceitos, avalie os mapas dos colegas, verificando as diferenças e indicando possíveis relações equivocadas. 0 Biologia – 2ª série – Volume 2
  41. 41. Conceitos I Conceitos II Expressões de ligação RR Rr rr R r fatores dominante recessivo ervilha lisa ervilha rugosa fenótipo genótipo heterozigoto homozigoto DNA sem inserção DNA com inserção dupla-hélice de DNA cromossomo proteína SBE-1 funcional proteína SBE-1 não funcional água alelo gene amido rami cado RNA mensageiro não produz produz perde muita perde pouca é são codi ca acumula muita acumula pouca faz composto de 1 Biologia – 2ª série – Volume 2
  42. 42. VOCÊ APRENDEU? 1. ( uvest–2003) Qual das alternativas se refere a um cromossomo? a) Um conjunto de moléculas de DNA com todas as informações genéticas da espécie. b) Uma única molécula de DNA com informação genética para algumas proteínas. c) Um segmento de molécula de DNA com informação para uma cadeia polipeptídica. d) Uma única molécula de RNA com informação para uma cadeia polipeptídica. e) Uma sequência de três bases nitrogenadas do RNA mensageiro correspondente a um ami- noácido na cadeia polipeptídica. 2. ( uvest–2002) Em seu trabalho com ervilhas, publicado em 1 , Mendel representou os fatores hereditários determinantes dos estados amarelo e verde do caráter cor da semente pelas letras A e a, respectivamente. O conhecimento atual a respeito da natureza do material heredi- tário permite dizer que a letra A usada por Mendel simboliza: a) um segmento de DNA com informação para uma cadeia polipeptídica. b) um segmento de DNA com informação para um RNA ribossômico. c) um aminoácido em uma proteína. d) uma trinca de bases do RNA mensageiro. e) uma trinca de bases do RNA transportador. 3. ( uvest–2001) O anúncio do sequenciamento do genoma humano, em 21 de junho de 2000, signi ca que os cientistas determinaram: a) a sequência de nucleotídeos dos cromossomos humanos. b) todos os tipos de proteína codi cados pelos genes humanos. c) a sequência de aminoácidos do DNA humano. d) a sequência de aminoácidos de todas as proteínas humanas. e) o número correto de cromossomos da espécie humana. . (Comvest Vestibular Unicamp–1 ) O metabolismo celular é controlado por uma série de rea- ções em que estão envolvidas inúmeras proteínas. Uma mutação gênica pode determinar a alteração ou a ausência de algumas dessas proteínas, levando a mudanças no ciclo de vida da célula. 2 Biologia – 2ª série – Volume 2
  43. 43. a) Explique a relação que existe entre gene e proteína. b) Por que podem ocorrer alterações nas proteínas quando o gene sofre mutação? c) Em que situação uma mutação não altera a molécula proteica? 5. ( uvest–1 ) Uma doença genética de herança dominante é causada por mutações em um gene localizado em um autossomo. Os indivíduos A, B e C têm mutações em um segmento de DNA desse gene, cuja sequência normal está representada a seguir: Sequência normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivíduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG Indivíduo B CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivíduo C CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG 3 Biologia – 2ª série – Volume 2
  44. 44. Códon Aminoácido Códon Aminoácido AAA lisina CUA leucina AAC asparagina GAU ácido glutâmico AAG lisina GCC alanina ACU treonina GUA valina AGU serina GUU valina AUG metionina UAA de parada CAA glutamina UAC tirosina CAU histidina UGA de parada CCU prolina UUG leucina Usando a tabela que relaciona alguns códons aos respectivos aminoácidos e considerando que a ta molde a ser transcrita é aquela assinalada com a letra m, responda: a) Quais serão os segmentos de proteínas produzidos, respectivamente, pelos indivíduos A, B e C? b) Como será o fenótipo (normal ou afetado) dos indivíduos A, B e C? Por quê? . O esquema a seguir representa uma simpli cação da relação entre genótipo e fenótipo. Com base nele e em outras informações trabalhadas ao longo deste ano, escreva um texto no caderno com o título: Do DNA à característica. Biologia – 2ª série – Volume 2
  45. 45. transcrição tradução duplicação Característica biológica DNA RNA Proteínas 5 Biologia – 2ª série – Volume 2
  46. 46. PARA SABER MA S Livros PERE RA, L gia V. Sequenciaram o genoma humano... e agora? São Paulo: Moderna, 2001. A autora explica as bases do sequenciamento de DNA e discute os impactos desse conhecimento. STRATHERN, Paul. Crick, Watson e o DNA em 90 minutos. Rio de Janeiro: Jorge ahar, 2001. O livro conta a história do trabalho de Watson e Crick e explica a estrutura do DNA. Sites (Acessos em: 27 fev. 201 .) GEN T CA NA ESCOLA. Disponível em: http: . O site apresenta atividades relacionadas aos conteúdos de Genética e Biologia Molecular. PROJETO GENOMA HUMANO. Disponível em: http: video. php?id 311 7 . Neste endereço, está disponível um vídeo que aborda conteúdos de Biologia Molecular. Biologia – 2ª série – Volume 2
  47. 47. 7 TEMA DNA: TECNOLOG AS DE MAN PULA O Neste Caderno, você e seus colegas vão trabalhar com algumas das aplicações tecnológicas desenvolvidas a partir do conhecimento acumulado sobre os mecanismos de herança. Entre elas estão a identificação por perfil de DNA e a produção de organismos transgênicos. S TUA O DE APREND AGEM 5 TESTE DE DENT CA O PELO DNA Para começo de conversa: montagem da molécula de DNA Nas páginas finais deste Caderno, você vai encontrar um esquema com modelos de nucleotídeos para recortar e montar moléculas de ácidos nucleicos. Com a orientação do professor, monte, com um colega, uma molécula de DNA com dez pares de nucleotídeos, considerando que 30% da molécula deve ser formada por adeninas. Depois duplique essa molécula com os nucleotídeos restantes. Por fim, transcreva essa molécula de DNA utilizando apenas uma das fitas como molde para produzir um RNA. Dica: os desoxirribonucleotídeos formam as moléculas de DNA e os ribonucleotídeos formam moléculas de RNA. A seguir, continuaremos o trabalho com biotecnologia mostrando como são feitos os testes de identificação pelo DNA. Trata-se de um tema bastante atual que contribui para a resolução de inúmeros casos de paternidade duvidosa, muitos deles divulgados pela mídia. Além disso, é uma técnica de amplo uso nas diversas áreas de Ciência e Tecnologia. O mistério de Dom Casmurro seria resolvido pelo teste de DNA? Um dos aspectos mais sedutores da obra Dom Casmurro, de Machado de Assis (1 ), é o mistério sobre a possível traição da personagem Capitu com Escobar, o melhor amigo de Bentinho, que é o protagonista e narrador da trama. Machado de Assis constrói um personagem atormentado pelo ciúme, colocando em dúvida, inclusive, a paternidade de seu filho, Ezequiel. Após a morte de Escobar, Bentinho começa a suspeitar da esposa, ao notar o grande sofrimento que ela demonstrou durante o enterro do amigo. A desconfiança de Bentinho chega ao ponto de provocar o rompimento e o fim do casamento. O filho, porém, fica sob a guarda do pai, que, a cada dia, acha que a criança fica mais parecida com Escobar. Essa é uma dúvida que o protagonista não tem como esclarecer; nem consegue provar se Capitu de fato o traiu. Se o romance Dom Casmurro estivesse ambientado nos dias de hoje, talvez não fosse tão encantador. O culpado? O teste de DNA. ! ? 7 Biologia – 2ª série – Volume 2
  48. 48. 1. Como o teste de DNA poderia elucidar esse mistério? 2. Possivelmente, você já ouviu falar em teste de DNA. Em quais veículos de comunicação você tomou contato com esse assunto? Em que situações? Quais são os materiais biológicos coleta- dos dos indivíduos envolvidos para fazer o teste de DNA? Desvendando o mistério de Capitu Para resolver o mistério de Dom Casmurro, seria necessário realizar um teste de DNA. A primeira etapa seria coletar material biológico dos envolvidos: Capitu, Bentinho, Escobar (o melhor amigo de Bentinho) e Ezequiel (o filho). Geralmente, os pesquisadores empregam células presentes no sangue ou na mucosa da boca, mas podem utilizar células da pele ou presentes na raiz do cabelo. O DNA é extraído das células, isolado das demais estruturas celulares e purificado. Depois ele passa por um processo de clonagem molecular. Aqui, o termo “clonagem” refere-se à produção de cópias idênticas da sequência de DNA utilizando nucleotídeos livres e uma enzima já estudada neste volume: a polimerase do DNA. Atualmente, uma das técnicas mais adotadas para aumentar a quantidade de cópias (amplificar) de trechos específicos do DNA é a reação em cadeia da polimerase (PCR). Essa técnica permite que, em curto espaço de tempo, trechos específicos do DNA possam ser amplificados milhões de vezes. Depois de aumentar a quantidade de DNA por meio da clonagem molecular, os pesquisadores utilizam enzimas de restrição, proteínas capazes de cortar o DNA em pontos definidos, ou melhor, em sequências específicas. As “tesouras moleculares” foram descobertas em diferentes bactérias e, para cada uma delas, é quebrada uma sequência específica do DNA. No quadro a seguir, são apresentados algumas enzimas e seus pontos de corte. Biologia – 2ª série – Volume 2
  49. 49. As setas que aparecem na primeira coluna do quadro simbolizam os pontos de quebra da ligação entre um nucleotídeo e outro. Quando isso acontece, os trechos se separam, formando fragmentos de DNA. Simulação do teste de DNA Para simular o teste de paternidade de Ezequiel, você terá acesso a algumas sequências fictícias de DNA humano. Sua tarefa será utilizar a enzima fictícia MDA para produzir os padrões de DNA característicos de cada pessoa. Essa proteína quebra as ligações apenas quando encontra a sequência de DNA apresentada a seguir. As ligações entre o T G e o A C são quebradas nesse local. t t t a t g g g c aaa t a c c c g Esquema para localizar o sítio de restrição da enzima utilizada. Sequência reconhecida Nome Origem 5’ GGATCC 3’ 3’ CCTAGG 5’ BamH Bacillus amyloliquefaciens H 5’ GAATTC 3’ 3’ CTTAAG 5’ EcoR E. coli R 13 5’ GGCC 3’ 3’ CCGG 5’ Hae Haemophilus aegyptius 5’ CTGCAG 3’ 3’ GACGTC 5’ Pst Providencia stuartii 5’ CTCGAG 3’ 3’ GAGCTC 5’ Xho Xanthomonas holcicola Especi cidade de algumas endonucleases de restrição. As setas indicam o ponto de clivagem na cadeia de DNA. onte: AHA, Arnaldo; ERRE RA, Henrique B.; PASSAGL A, Luciane M.P. (orgs.). Biologia molecular básica. . ed. Porto Alegre: Artmed, 2012. p. 33 . Biologia – 2ª série – Volume 2
  50. 50. A seguir, cada dupla-fita de nucleotídeos faz parte de um cromossomo dos personagens de Dom Casmurro. Você deve utilizar a enzima de restrição MDA para separar o DNA dos envolvidos em frag- mentos menores. Para isso, localize no quadro os sítios de restrição da enzima MDA no DNA de todos os indivíduos. gcaatggcacccgttttatgggctggaatggcccctcccaatggcacccgtcacccgtttaaacc cgttaccgtgggcaaaatacccgaccttaccggggagggttaccgtgggcagtgggcaaatttgg tcgcacccgtatggaccgagcccctccccgactccgctctccgaatggcgccctgaaaccgagca agcgtgggcatacctggctcggggaggggctgaggcgagaggcttaccgcgggactttggctcgt gcaatggcacccgttttatgggctggaatggcccctcccaatggcacccgtcacccgtttaaacc cgttaccgtgggcaaaatacccgaccttaccggggagggttaccgtgggcagtgggcaaatttgg ctatgggctgggaatccatggccgcgcgcaatggcacccgtttaaaatggcccctccccgactcc gatacccgacccttaggtaccggcgcgcgttaccgtgggcaaatttttaccgggaggggctgagg cacccgacccgtatggaatggcacccgtcccgaccgacgggccgatgggcccgtcgggcccgtcg gtgggctgggcataccttaccgtgggcagggctggctccccggctgcccgggcagcccgggcagc tcgcacccgtatggaccgagcccctccccgactccgctctccgaatggcgccctgaaaccgagca agcgtgggcatacctggctcggggaggggctgaggcgagaggcttaccgcgggactttggctcgt tcgcacccgtatgcatggagcccctccccgactccgctctccgaatggcgccctgaaaccgagca agcgtgggcatacgtacctcggggaggggctgaggcgagaggcttaccgcgggactttggctcgt cacccgtcgagcacccgtatggacccaatggcacccgtccatggccatggcggacgggcccgtcg gtgggcagctcgtgggcatacctgggttaccgtgggcaggtaccggtaccgcctgcccgggcagc Capitu Ezequiel Bentinho Escobar Simulação de sequências de DNA dos personagens. 50 Biologia – 2ª série – Volume 2
  51. 51. Depois de localizar e indicar os locais de corte pela enzima, confira seus resultados com os dos colegas da classe. Medindo fragmentos de DNA Esquema simpli cado da eletroforese. Após a produção dos fragmentos de diversos tamanhos, é preciso comparar o DNA dos envol- vidos. Para isso, vamos usar uma técnica conhecida como eletroforese. Após as explicações de seu professor sobre a técnica de eletroforese, descreva-a no espaço a seguir. polo negativo polo positivo gelatina banda de DNA + ©JurandirRibeiro SASSON, Sezar; S LVA JUN OR, Cesar da. Biologia – volume único. São Paulo: Saraiva, 2007. p. 5 5. 51 Biologia – 2ª série – Volume 2
  52. 52. O quadro a seguir representa os sítios de restrição do DNA dos envolvidos no caso. Na tabela da próxima página, você deve indicar as bandas de cada um dos envolvidos, de acordo com os números dos pares de nucleotídeos de seu DNA. Quadro indicando os sítios de restrição para enzima do DNA dos personagens. tcgcacccgtatggaccgagcccctccccgactccgctctccgaatggcgccctgaaaccgagca agcgtgggcatacctggctcggggaggggctgaggcgagaggcttaccgcgggactttggctcgt 123419 cacccgacccgtatggaatggcacccgtcccgaccgacgggccgatgggcccgtcgggcccgtcg gtgggctgggcataccttaccgtgggcagggctggctccccggctgcccgggcagcccgggcagc 14546 tcgcacccgtatggaccgagcccctccccgactccgctctccgaatggcgccctgaaaccgagca agcgtgggcatacctggctcggggaggggctgaggcgagaggcttaccgcgggactttggctcgt123419 tcgcacccgtatgcatggagcccctccccgactccgctctccgaatggcgccctgaaaccgagca agcgtgggcatacgtacctcggggaggggctgaggcgagaggcttaccgcgggactttggctcgt 163019 cacccgtcgagcacccgtatggacccaatggcacccgtccatggccatggcggacgggcccgtcg gtgggcagctcgtgggcatacctgggttaccgtgggcaggtaccggtaccgcctgcccgggcagc20913617 gcaatggcacccgttttatgggctggaatggcccctcccaatggcacccgtcacccgtttaaacc cgttaccgtgggcaaaatacccgaccttaccggggagggttaccgtgggcagtgggcaaatttgg514101323 gcaatggcacccgttttatgggctggaatggcccctcccaatggcacccgtcacccgtttaaacc cgttaccgtgggcaaaatacccgaccttaccggggagggttaccgtgggcagtgggcaaatttgg514101323 ctatgggctgggaatccatggccgcgcgcaatggcacccgtttaaaatggcccctccccgactcc gatacccgacccttaggtaccggcgcgcgttaccgtgggcaaatttttaccgggaggggctgagg415131617 Capitu Ezequiel Bentinho Escobar 52 Biologia – 2ª série – Volume 2
  53. 53. Com base no padrão de bandas de DNA de todos os envolvidos é possível determinar as relações de parentesco entre eles. Considere que, em caso de paternidade, deve-se, inicialmente, comparar o perfil de fragmentos de DNA da criança com o da mãe e identificar todos os possíveis fragmentos de DNA da criança que também estão presentes no da mãe. Depois, compare os fragmentos de DNA da criança que sobraram (que não têm correspondência com o DNA da mãe) com os perfis de DNA dos possíveis pais. O provável pai será aquele cujo perfil de DNA contenha todos os fragmentos de DNA complementares aos fragmentos de DNA da criança que não estão presentes no DNA da mãe. Escala em pares de base (pb) Envolvidos Capitu Ezequiel Bentinho Escobar 1 2 3 5 7 10 11 12 13 1 15 1 17 1 1 20 21 22 23 2 Escala em pares de base (pb) Envolvidos Capitu Ezequiel Bentinho Escobar 25 2 27 2 2 30 31 32 33 3 35 3 37 3 3 0 1 2 3 5 7 53 Biologia – 2ª série – Volume 2
  54. 54. Agora, a partir da leitura do padrão de bandas de todos os indivíduos, responda às questões: 1. Quais são as bandas presentes na mãe e no lho? 2. Quais bandas sobraram no padrão do lho sem correspondência com o padrão da mãe? 3. Quem possui todas essas bandas que não têm correspondência com o padrão da mãe? . De acordo com a simulação feita, quem é o provável pai de Ezequiel? 5. Elabore uma história em quadrinhos propondo um desfecho para a obra de Machado de Assis, Dom Casmurro, com base em um suposto teste de DNA. Esse teste não precisa ter o mesmo resultado da simulação feita, ou seja, o pai de Ezequiel pode ser outro personagem de Dom Casmurro. 5 Biologia – 2ª série – Volume 2
  55. 55. L O DE CASA Etapas para obtenção e análise do DNA 1. Complete o quadro a seguir com informações sobre cada uma das etapas, a partir das explica- ções de seu professor e de consultas ao livro didático. 2. Pesquise em seu livro o que são enzimas de restrição e como elas atuam. Extração Quantificação Amplificação Separação Análise e interpretação 55 Biologia – 2ª série – Volume 2
  56. 56. VOCÊ APRENDEU? 1. Cinco casais procuraram a polícia e a rmaram ser os verdadeiros pais de Gabriela. A garota teria sido roubada de uma maternidade em 1 0. Ao assistir à entrevista da garota na TV, esses casais descon aram de que poderiam ser os pais. Todos se submeteram ao teste de identi cação pelo DNA e os resultados são apresentados a seguir. Quem são os verdadeiros pais de Gabriela? Assinale a alternativa correta. 2. Com relação às enzimas de restrição, é correto a rmar que: a) os sítios de restrição nunca acontecem dentro de um gene. b) para um ser vivo, os sítios de restrição são úteis apenas para a técnica inventada para analisar o DNA. c) todo sítio de restrição marca também o início da síntese de proteínas. d) indivíduos de uma mesma espécie possuem o mesmo número de sítios de restrição. e) irmãos sempre apresentam a mesma quantidade de sítios de restrição. 3. ( uvest – 1 7) Enzimas de restrição são fundamentais à Engenharia Genética porque permitem: a) a passagem de DNA através da membrana celular. b) inibir a síntese de RNA a partir de DNA. Gabriela a) Pai Mãe b) Pai Mãe c) Pai Mãe d) Pai Mãe e) Pai Mãe 5 Biologia – 2ª série – Volume 2
  57. 57. c) inibir a síntese de DNA a partir de RNA. d) cortar DNA onde ocorrem sequências especí cas de bases. e) modi car sequências de bases do DNA. . Explique se as a rmações seguintes, sobre o teste de DNA, são verdadeiras ou falsas: a) “O exame de DNA só pode ser feito com sangue.” b) “O resultado mostrou que nós possuímos algumas bandas do mesmo tamanho; logo, está provado que ele é o meu pai.” 5. Com as técnicas estudadas, podemos veri car se existem regiões de interesse na ta de DNA. Chamamos essas regiões de marcadores, já que podemos associá-las a alguma característica em particular. A presença de um marcador no genoma de um indivíduo pode ser visualizada como uma banda de DNA em um gel de eletroforese. Dessa forma, podemos descobrir se um embrião poderá apresentar determinada característica ou doença genética com base na análise de seus marcadores. O esquema a seguir representa a análise de marcadores de DNA de quatro embriões humanos ( , , e V). Apenas a presença de duas bandas (A e B) indica que o indivíduo pode apresentar certa doença quando adulto. I II III IV DNA dos embriões eletroforese Banda A Banda B + – Observe o padrão de bandas do DNA de cada embrião e responda: a) Entre os embriões analisados, quais N O deverão apresentar a doença quando adultos? 57 Biologia – 2ª série – Volume 2
  58. 58. b) Supondo que os quatro embriões sejam irmãos, qual é o padrão de bandas ( , , e V) mais provável PARA CADA UM de seus pais? c) Qual banda é formada por fragmentos de DNA de MENOR tamanho? Justi que. . A síndrome de Do n é ocasionada por uma trissomia do cromossomo 21. Em uma situação hipotética, um casal teve uma criança com a síndrome (C1 ) e, na segunda gravidez, resolveu sub- meter-se a um teste de DNA para veri car se a segunda criança (C2 ) também teria a síndrome. O teste de DNA analisa marcadores para os diferentes cromossomos presentes nas células das pessoas e foi feito a partir do DNA extraído de células sanguíneas dos pais e do primeiro filho (C1 ) e de uma punção do líquido amniótico (amniocentese) para analisar o segundo filho (C2 ). Mãe MãePai Pai Kb Kb C1 C2 7 6 5 4 7 6 5 4 Com base na análise dos resultados expressos na ilustração, responda: a) Qual a origem do cromossomo extra da criança? b) A segunda criança apresenta ou não a síndrome? Justi que. c) aça uma pesquisa e descubra qual a principal razão para que se forme um embrião com trissomia do cromossomo 21. 5 Biologia – 2ª série – Volume 2
  59. 59. APRENDENDO A APRENDER Há diferentes situações nas quais o teste de identificação por DNA pode ser aplicado. Para cada uma das situações a seguir, encontre um exemplo real ou descreva de que forma esse teste é útil. Criminalística Crimes ambientais Tráfico de animais silvestres Pedigree de animais Doenças hereditárias dentificação de vírus e bactérias causadores de doenças 5 Biologia – 2ª série – Volume 2
  60. 60. 0 Biologia – 2ª série – Volume 2
  61. 61. S TUA O DE APREND AGEM COMO PRODU R UM TRANSGÊN CO? Eles estão entre nós. Se perguntar aos outros alunos da escola se já viram um organismo trans- gênico, é provável que a maioria diga que não. No entanto, é possível que a maioria, se não todos, já tenha tido algum contato com produtos derivados de organismos transgênicos. Muitos alimentos industrializados, por exemplo, usam produtos desse tipo em seu processo de fabricação. Da mesma forma, há diversos medicamentos feitos a partir de organismos transgênicos. aça uma pesquisa em seu livro didático ou em outras fontes de informação confiáveis e descubra exemplos de alimentos e medicamentos produzidos a partir de transgênicos. Leitura e análise de imagem 1. Quais são os organismos representados nessa imagem? 2. Os organismos estão representados do modo como os conhecemos? Comente. ©AlexandreCamanho 3. Se a imagem sugerir a representação de um transgênico, que características dos organismos podem ter sido combinadas para gerar um organismo desse tipo? ! ? 1 Biologia – 2ª série – Volume 2
  62. 62. Leitura e análise de texto Troca-troca genético Já viu porco com patas e focinho coloridos? E cabra que dá leite capaz de acelerar a cicatrização de ferimentos? Ao contrário do que você possa estar pensando, não estamos falando de criaturas de filmes de ficção. Esses animais são resultado de experimentos cien- tíficos de verdade! Se você tiver curiosidade, podemos conversar sobre como essas e outras modificações nos seres vivos são possíveis e por que os cientistas fazem isso. Que tal? A cabra e o porco citados na abertura deste texto são apenas exemplos curiosos de seres vivos que receberam características de outras espécies. O porco ganhou a coloração de um tipo de alga marinha. Já na cabra foi introduzida uma característica do sangue responsável pela coagulação, isto é, por evitar hemorragias em cirurgias ou quando você se corta. Como assim? Bem, todos os animais e plantas têm dentro de suas células um conjunto de códigos que os fazem ser do jeito que são. Nos seres humanos, por exemplo, esse conjunto de códigos é responsável por termos dois braços, duas pernas, dois olhos, duas orelhas, um nariz, uma boca, um coração, dois rins... Enfim, por tudo que nos faz ter aparência humana por dentro e por fora. No caso de uma galinha, seu conjunto de códigos é responsável pelas características físicas que ela apresenta. E, assim, cada ser vivo tem o seu próprio conjunto de códigos, que se chama DNA. Guardou isso? Então, vamos adiante porque a conversa só está esquentando! Você, agora, precisa saber que cada código que forma esse conjunto recebe o nome de gene e que cada gene tem sua função. De novo, vamos pensar em nós, humanos: temos genes responsáveis pelo formato das nossas orelhas; pela cor dos nossos olhos; pela produção de substâncias que nos permitem digerir os alimentos... Enfim, como temos muitas caracterís- ticas, nosso DNA é formado por milhares de genes. Pense bem: se cada espécie de animal e de planta tem características próprias determi- nadas pelo conjunto de seus genes – isto é, pelo seu DNA –, o que acontece se os cientistas transferirem genes de uma espécie para outra? A espécie que receber os genes irá desenvolver uma ou mais características que não eram suas naturalmente, certo? Pois foi exatamente isso que aconteceu com a cabra ao receber o gene do homem responsável pelo desenvolvimento do fator de coagulação humano no seu leite. E também com o porco, que recebeu da alga marinha o gene responsável pela sua cor. Quando um ser vivo recebe um gene de outra espécie de animal ou vegetal, ele é chamado transgênico. Mas os cientistas podem, também, transferir genes entre seres da mesma espécie; estes são chamados organismos geneticamente modificados. ODA, Leila M.; CARNE RO, Júlia D. Troca-troca genético. Revista Ciência Hoje das Crianças. Rio de Janeiro: nstituto Ciência Hoje, mar. 2002. 2 Biologia – 2ª série – Volume 2
  63. 63. 1. Quais relações você faz entre a imagem anterior e o título do texto Troca-troca genético? 2. Utilize os termos “seres vivos”, “células”, “DNA”, “genes”, “características biológicas”, “transgê- nicos” e “organismos geneticamente modi cados” (OGMs) e construa um mapa de conceitos. Para isso, explore as informações do texto e pesquise também em seu livro didático ou em outras fontes con áveis. 3 Biologia – 2ª série – Volume 2
  64. 64. Leitura e análise de texto Para que trocar genes? Ao transferir genes de uma espécie para outra, os cientistas não estão pensando apenas em produzir porcos coloridos ou cabras com genes humanos. Experimentos como esses são válidos para testar se a troca genética é realmente possível. Se for, plantas podem receber genes de vírus, por exemplo. Este é o caso da alface transgênica, desenvolvida recentemente. Ela recebeu o gene que produz o antígeno do vírus da hepatite B e que pode virar uma vacina! Você comeria uma alface dessas? Pense duas vezes antes de dizer que não, porque o antígeno é a parte do vírus usada nas vacinas. Quando ele entra em nosso corpo, estimula o organismo a se defender da doença causada pelo vírus. Logo, a alface transgênica funciona como uma vacina para a hepatite B. Então, você prefere alface ou injeção? Gostou da vacina de alface? Melhor é a bebida láctea transgênica! Você sabe do que se trata: são aquelas pequenas garrafinhas que contêm leite fermentado com lactobacilos, bactérias que ajudam a proteger o intestino. Em breve, teremos lactobacilos transgênicos, com os antígenos de seis vírus diferentes. A vacina de leite fermentado vai combater doenças como a difteria, a coqueluche, o tétano, a caxumba, a rubéola e o sarampo, entre outras. No futuro, é provável que as vacinas sejam todas assim. Como é bom sonhar com o adeus às agulhadas... Podemos, ainda, citar as chances de os organismos transgênicos se tornarem substitutos de remédios, vitaminas e outras substâncias que nosso organismo necessita. Veja: em 1 5, começou a ser vendido o primeiro produto proveniente de um transgênico – a insulina, substância que controla a quantidade de açúcar no sangue. O gene humano responsável pela produção de insulina foi retirado de uma célula do pâncreas de uma pessoa saudável e transferido para uma bactéria, que começou a produzir a substância. Hoje, a insulina trans- gênica ajuda a salvar vidas de pessoas que têm diabetes, uma doença causada pela falha do corpo na produção dessa substância. Quer saber um pouco mais sobre a cabra que pode ser usada para melhorar a saúde das pessoas? Pois anote: a cabra transgênica (a vaca também pode ser usada), que recebe o gene humano responsável pela coagulação do sangue, produz no próprio leite a substância que possibilita a cicatrização de cortes e machucados nas pessoas. Essa substância é muito impor- tante para tratar os hemofílicos, que não a produzem em quantidades suficientes e podem ter grandes hemorragias a partir do mais simples sangramento. ODA, Leila M.; CARNE RO, Júlia D. Troca-troca genético. Revista Ciência Hoje das Crianças. Rio de Janeiro: nstituto Ciência Hoje, mar. 2002. Biologia – 2ª série – Volume 2
  65. 65. 1. denti que, no texto, exemplos de uso dos transgênicos. 2. O que esses exemplos apresentam em comum? Leitura e análise de imagem A imagem a seguir é um esquema que busca explicar como se produz insulina transgênica. Após a leitura, responda às questões a seguir. Esquema da produção de insulina. Bactéria DNA da bactéria ragmento de DNA humano com o gene responsável pela produção de insulina nsulina transgênica produzida pela bactéria Célula humana 1 1 1 2 2 3 3 4 4 Isolamento do DNA bacteriano e do DNA humano Corte de ambos os DNAs com enzima de restrição Mistura de ambos os DNAs. Eles se juntam, formando uma molécula de DNA recombinante O DNA recombinante é introduzido em bactérias ©Aeroestudio 5 Biologia – 2ª série – Volume 2
  66. 66. 1. Elabore um texto descrevendo os eventos representados. 2. Como são produzidos os fragmentos de DNA de interesse? 3. Por que o fragmento de interesse pode se ligar ao DNA da bactéria? . Como é possível aumentar o número de cópias desse DNA recombinante? Biologia – 2ª série – Volume 2
  67. 67. Consolidando os conceitos Leitura e análise de texto Troca entre iguais Agora, vamos falar da troca de genes entre seres da mesma espécie: os organismos geneticamente modificados! Alguém poderia perguntar: para que trocar genes entre seres iguais? Que diferença isso pode fazer? hora de dizer que, embora organismos da mesma espécie tenham DNA exageradamente semelhante, existem mínimas diferenças que fazem cada ser ter o seu próprio código genético. Por isso, mesmo tendo dois braços, duas pernas, um nariz etc. etc. etc. como o seu vizinho, você é diferente dele! Com os bichos e as plantas também é assim: mesmo tendo um DNA que os caracteriza como sendo de determinada espécie, cada ser tem um código genético só seu. O uso de plantas geneticamente modificadas também pode aumentar a produção agrí- cola, o que traz vantagens para o meio ambiente. Quando as lavouras produzem mais vegetais de melhor qualidade, diminui a necessidade de desmatar novas áreas para plantações. Além disso, as plantas podem ser modificadas para que consumam menos água durante o cresci- mento. Assim o planeta economiza, pois cerca de dois terços de toda a água doce do mundo são consumidas na agricultura. A transferência de genes entre iguais também pode melhorar a qualidade dos alimentos, tornando-os mais nutritivos. o caso, por exemplo, de um arroz transgênico chamado golden rice (ou “arroz dourado”, em português). Ele é mais rico em vitamina A e ferro do que o arroz comum. A carência dessas substâncias no organismo pode causar problemas sérios, como cegueira e anemia. Olha que os animais também podem ser modificados para melhorar sob o ponto de vista alimentar. Cuba, por exemplo, criou uma tilápia transgênica e o Canadá, o salmão transgênico. Esses peixes tiveram alterado o gene responsável pelo crescimento e, por isso, crescem mais e concentram maior quantidade de proteínas. Apesar das vantagens, muitas pessoas temem as consequências do consumo de produtos transgênicos ou geneticamente modificados. Afinal de contas, esses experimentos são muito recentes. Os próprios cientistas trabalham com cautela, avaliando, a cada nova descoberta, se ela não oferece riscos ao homem e à natureza. E é normal que muitas pessoas tenham receio das novas tecnologias; as maiores descobertas científicas da História também encon- traram resistência na sua época. Mas quem sabe? Talvez esse troca-troca genético não pareça nada estranho daqui a um tempo. ODA, Leila M.; CARNE RO, Júlia D. Troca-troca genético. Revista Ciência Hoje das Crianças. Rio de Janeiro: nstituto Ciência Hoje, mar. 2002. 7 Biologia – 2ª série – Volume 2
  68. 68. Após a leitura do texto, responda às questões: 1. Qual o termo mais apropriado para substituir a expressão “código genético” no texto? 2. Com base no texto, faça uma lista de benefícios decorrentes do uso de transgênicos. 3. As autoras se posicionam em relação aos transgênicos ou são imparciais? Criação de um título para o texto O texto a seguir trata do tema que estamos estudando. Leia com atenção e crie um título. Lembre-se de que, nesse caso, além de indicar o assunto tratado, o título deve ser atraente para o leitor. Título: Ocorreu em um dos melhores hospitais de São Paulo. azia menos de 2 horas que ele havia nascido quando me apresentaram um papel para assinar autorizando o procedimento. Consultei o médico, que me assegurou que era o recomendado. azer o quê? Autorizei. A injeção foi indolor e logo depois me entregaram a carteira de vacinação. iquei feliz, meu filho havia sido vacinado contra o vírus da hepatite B. Se você acha que isso é uma grande novidade, ainda em fase experimental, está enganado. Neste ano, o Ministério da Saúde adquiriu milhões de doses dessa vacina e agora ela faz parte do programa de imunização do governo brasileiro. Nos próximos anos, praticamente todas as crianças recém-nascidas serão imunizadas com esta vacina “recombinante”, um nome mais “delicado” e que sofre menos discriminação que “transgênica”, apesar de significar exatamente a mesma coisa. Biologia – 2ª série – Volume 2
  69. 69. 1. Qual parece ser a posição do autor em relação ao uso dos transgênicos? O termo significa que o produto injetado foi produzido por um organismo genetica- mente modificado (OGM), assim como o óleo de soja que consumimos, o algodão de muitas das roupas que vestimos ou a insulina que a maioria dos diabéticos recebe todos os dias. Ao contrário da hepatite A, que geralmente não deixa sequelas, uma infecção pelo vírus da hepatite B é muito mais séria. Ela pode deixar sequelas crônicas no fígado e uma parte dos pacientes pode desenvolver câncer. Como é difícil produzir grandes quantidades desse vírus, o desenvolvimento de uma vacina eficaz e segura só foi possível devido aos avanços da biotecnologia. A partir do sequenciamento do genoma do vírus, foi identificado o gene que codifica a proteína capaz de tornar as pessoas imunes ao próprio vírus. Esse gene foi retirado do vírus e transferido para um fungo (semelhante àquele que utili- zamos para fazer cerveja). O fungo modificado, por ter em seu genoma um gene originário do vírus, é denominado transgênico. Ele se torna capaz de produzir grandes quantidades da proteína viral. O fungo é cultivado, a proteína purificada e utilizada na produção da vacina. Se neste ano estamos comemorando nossa autossuficiência em petróleo, nos últimos anos deveríamos ter comemorado nossa autossuficiência na produção dessa vacina. A vacina recombinante contra o vírus da hepatite B foi desenvolvida no nstituto Butantan com a ajuda de um cientista que emigrou da ex-União Soviética, na década de 0. A adoção em larga escala dessa vacina nos programas de vacinação do governo vai permitir diminuir a incidência da doença e, de quebra, diminuir o número de casos de câncer de fígado. Espero que ela também ajude a diminuir a desinformação que ronda os transgênicos e os OGMs, afinal é um produto comercial, desenvolvido, aprovado e distribuído pelo governo brasileiro. Quando recebi meu filho na saída da maternidade, tive a curiosidade de verificar se tinham pendurado nele um “rótulo” com a advertência “pode conter transgênicos”, como exigido pelo governo brasileiro para qualquer produto contendo derivados da soja transgênica. Não encon- trei. Tampouco vejo a frase “contém transgênico” tatuada nos diabéticos que devem sua sobre- vivência exatamente ao fato de receber, todos os dias, uma dose de insulina transgênica. RE NACH, ernando. njetaram proteína transgênica no meu lho! São Paulo. O Estado de S.Paulo, 2 abr. 200 . Vida . Disponível em: http: Estado Colunas 200 7 ---2 -abr-200 .doc . Acesso em: 27 fev. 201 . Biologia – 2ª série – Volume 2
  70. 70. 2. O conceito de organismo geneticamente modi cado apresentado no terceiro parágrafo do texto é semelhante ao apresentado no texto Troca-troca genético? 3. O que signi ca “autossu ciência” em vacinas? . Qual é a posição do autor em relação à legislação brasileira de identi cação dos produtos que contêm transgênicos? 5. Qual é a principal ideia do texto Troca-troca genético? E do texto de ernando Reinach? 70 Biologia – 2ª série – Volume 2
  71. 71. . Do que você mais gostou nos textos? L O DE CASA Construção de um texto argumentativo Leitura e análise de texto Consumo de organismos transgênicos No blog do jornalista Marcelo Leite (disponível em: http: cienciaemdia.folha. ; acesso em: 27 fev. 201 ), ele comenta o artigo do cientista ernando Reinach reproduzido neste Caderno. O jornalista considera que o cientista usou apenas exemplos em que produtos extraídos de organismos transgênicos são isolados antes de ser utilizados. Por exemplo, quando o bebê citado no texto recebe a vacina contra hepatite, nada proveniente do fungo transgênico é consumido, apenas a vacina purifi- cada. sso, segundo o jornalista, é bem diferente de um produto como biscoitos ou bolachas feitos com farinha de soja. Para a produção da farinha, a semente de soja transgênica inteira é triturada e consumida. Todas as proteínas da semente, bem como todo o DNA de cada célula, serão consumidas também. Apesar da visão crítica do jornalista, sua posição quanto aos alimentos transgênicos não fica evidente. Ele critica que Reinach tenha usado um exemplo que subestima o problema dos alimentos transgênicos, afinal, ingerir DNA transgênico não é igual a se alimentar de um produto obtido desse material. Para Marcelo Leite, a adoção da vacina seria comparada ao uso do óleo de soja, mas não à ingestão do alimento contendo a semente da soja, como o salgadinho. Elaborado por Paulo Cunha especialmente para o São Paulo faz escola. 71 Biologia – 2ª série – Volume 2
  72. 72. Tomando por base as considerações do jornalista, faça uma redação analisando o artigo do cientista ernando Reinach. No primeiro parágrafo, você deve apresentar o texto que será analisado. No segundo, você pode destacar os aspectos positivos do texto. No terceiro, seus aspectos negativos. Ao longo da redação, deve estar bem explícito o que é fato, o que é opinião do cientista e o que é sua opinião. 72 Biologia – 2ª série – Volume 2
  73. 73. VOCÊ APRENDEU? 1. Pesquisadores inseriram dois genes bacterianos na Arabidopsis thaliana, uma espécie de agrião, e criaram uma planta que não tolera solos contaminados. Nesse caso, é correto a rmar que: a) houve melhoramento genético e, além da qualidade desejada, outras qualidades foram transferidas, porque, invariavelmente, a planta resultante é melhor. b) a planta recebeu naturalmente os genes, pois o próprio ar ou os insetos realizam a troca do pólen contido nas ores das plantas. c) foi realizada uma transformação genética e apenas os genes de interesse foram transfe- ridos, o que resultou em uma bactéria transgênica. d) os pesquisadores construíram uma bactéria e uma planta transgênicas com os dois genes de interesse. e) foi realizada uma transformação genética e apenas os genes de interesse foram transfe- ridos, o que resultou em uma planta transgênica. 2. Com relação aos organismos transgênicos, é correto a rmar que: a) são seres cuja informação genética provém de outra espécie. b) são seres que possuem parte de sua informação genética proveniente de outra espécie. c) são seres que apresentam substâncias mais saudáveis e devem ser consumidos por toda a população. d) devem ser evitados, uma vez que, por apresentarem composição química modi cada, não são produtos saudáveis. e) são seres que, durante o processo de alimentação, incorporam material genético das espécies ingeridas. 3. (Enem – 2012) O milho transgênico é produzido a partir da manipulação do milho original, com a transferência, para este, de um gene de interesse retirado de outro organismo de espécie diferente. A característica de interesse será manifestada em decorrência: a) do incremento do DNA a partir da duplicação do gene transferido. b) da transcrição do RNA transportador a partir do gene transferido. c) da expressão de proteínas sintetizadas a partir do DNA não hibridizado. d) da síntese de carboidratos a partir da ativação do DNA do milho original. e) da tradução do RNA mensageiro sintetizado a partir do DNA recombinante. 73 Biologia – 2ª série – Volume 2
  74. 74. . Analise a charge a seguir: Mariano. Jornal da Ciência, ed. 515, 10 out. 2003. Qual deve ser a opinião do autor da charge sobre a liberação das plantações de soja transgênica? A partir dos elementos presentes na imagem, elabore um texto justi cando sua resposta. 5. A soja transgênica resistente a uma marca de herbicida foi produzida pela Empresa Brasileira de Pesquisa Agropecuária (Embrapa) e está passando por testes de segurança alimentar e ambiental. Esse processo dura aproximadamente três anos e consiste na produção de 200 plantas resistentes ao herbicida. A partir desse lote, os pesquisadores escolhem as dez plantas com maior capacidade de gerar descendentes também resistentes. Esses lhotes do lote inicial são expostos a doses de herbicida três vezes maiores que as aplicadas convencionalmente. Por m, as melhores são separa- das e apenas uma delas é levada a testes de segurança. Não existe a possibilidade de cruzamento dessas plantas com outras e o risco de polinização cruzada com outro tipo de soja é de apenas 1%. Por isso, os riscos ambientais causados pela soja transgênica são pequenos. Com base no texto, explique por que a soja transgênica apresenta baixo risco ambiental. ©JornaldaCiência 7 Biologia – 2ª série – Volume 2
  75. 75. 75 Biologia – 2ª série – Volume 2
  76. 76. S TUA O DE APREND AGEM 7 DEBATE SOBRE TRANSGÊN COS Construindo argumentos e aprofundando o conhecimento Neste Caderno, tratamos das tecnologias do DNA e de suas possíveis aplicações. Acontece que a utilização dessas e de outras tecnologias não é um assunto que deve ficar restrito à comunidade científica. necessário que diferentes segmentos da sociedade opinem, atuem e ajudem a regularizar a aplicação e o uso de novas tecnologias. com essa intenção que convi- damos você e seus colegas a organizar um debate cujo tema é a implantação da unidade de uma empresa de biotecnologia (fictícia) que utiliza diferentes tipos de organismo transgênico no município de Ecoli (também fictício). Leitura e análise de texto Caros cidadãos de Ecoli, Gostaria de solicitar a participação de todos em um debate muito importante para a nossa cidade. A Transbio, que é uma empresa de biotecnologia, acaba de inaugurar suas instalações em Ecoli. Ela utiliza organismos transgênicos para a produção de diversos materiais. Nessa nova unidade, a empresa atua na área alimentícia, produzindo óleo de soja trans- gênica e arroz com vitamina B; na área da saúde, insulina humana transgênica; e, na área agropecuária, agrotóxico e soja transgênica resistente a esse agrotóxico. Além de plantar esses organismos na região, ela quer vender tais produtos para nossa população. Gostaria de contar com a ajuda de vocês, representantes de diversos setores de nossa sociedade, para elaborar uma carta manifestando a posição dos cidadãos de Ecoli sobre alguns questionamentos: 1. Devemos liberar a produção de todos esses materiais? E a venda? Quais condições devem ser atendidas pela empresa? 2. Que cuidados devemos ter com a saúde de nossa população? 3. Quais são os benefícios dessa atividade para nossa cidade? E os riscos? Conto com a colaboração de todos. Atenciosamente, O prefeito. Elaborado especialmente para o São Paulo faz escola. ! ? 7 Biologia – 2ª série – Volume 2
  77. 77. Depois de ler a carta, siga a orientação de seu professor a respeito da organização do debate. A turma será dividida em equipes que representarão os diferentes grupos sociais envolvidos na situação. Grupos sociais Cada grupo vai elaborar uma pesquisa, selecionar e organizar argumentos para defender seu ponto de vista durante o debate. Essa pesquisa pode ser feita em sites, em revistas ou em livros didáticos. Seu professor vai marcar uma data para que os grupos apresentem os resultados dessa pesquisa. Veja os grupos participantes do debate. Empresa de biotecnologia ormado por administradores e técnicos em biotecnologia, este grupo representa os interesses da indústria Transbio. Seus principais produtos são: na área alimentícia, óleo de soja transgênica e arroz com vitamina B; na área da saúde, insulina humana transgênica; e, na área agropecuária, agrotóxico e soja transgênica resistente a esse agrotóxico. A empresa paga todos os seus impostos e está instalada em cidades do interior de São Paulo com baixa renda per capita, como Ecoli. Suas plantações transgênicas são acompanhadas por órgãos de fiscalização e estão de acordo com as regras estabelecidas até o momento. Profissionais de saúde ormado por médicos, nutricionistas, enfermeiros e outros profissionais ligados à saúde humana, este grupo representa os interesses da população relacionados ao bem-estar físico. Preocupados com a presença da indústria Transbio na região, esses profissionais começaram a levantar dados sobre a população local para verificar os efeitos do trabalho em plantações trans- gênicas e, principalmente, as consequências do consumo de alimentos e medicamentos transgê- nicos. Além da toxicidade de produtos utilizados pela indústria, os profissionais de saúde preocupam-se com as taxas de alergia dos moradores locais. Setor agropecuário ormado por proprietários de fazendas de pequeno, médio e grande portes e por trabalhadores rurais, este grupo representa os interesses dos produtores agrícolas, que visam aumentar a produtividade do setor. Segundo eles, a indústria Transbio traria benefícios para a cidade por meio da geração de empregos e de maior atividade econômica na região. No entanto, o setor agropecuário está preocupado com os gastos com matéria-prima e com a rejeição do mercado consumidor. Poder público ormada por vereadores e secretários municipais, esta parte do poder público deve avaliar quais seriam os benefícios das atividades da Transbio para a economia local assim como analisar 77 Biologia – 2ª série – Volume 2
  78. 78. as relações comerciais entre a empresa e o setor agropecuário, principalmente no que diz respeito aos royalties ou direitos intelectuais. A legislação sobre a venda de transgênicos ao consumidor é responsabilidade deste setor. Cabe também ao poder público propor às empresas estratégias de investimento na qualidade de vida da população, como investir nos hospitais da região parte do dinheiro que pagariam em impostos. Pesquisadores da área de ecologia ormado por biólogos, ambientalistas e ONGs de preservação do meio ambiente, este setor está preocupado com os impactos das atividades da Transbio na área natural da cidade. Ecoli apresenta uma vegetação de cerrado e de mata atlântica, dois importantes biomas no Brasil que estão em risco, pois se encontram muito reduzidos. Este setor deve avaliar os impactos em espécies nativas da região, pensando em como monitorá-los, e levantar infor- mações sobre pesquisas na área. Elaborado especialmente para o São Paulo faz escola. Apresentando os resultados da pesquisa Após a pesquisa, você e seus colegas de grupo devem discutir seus argumentos e elaborar uma resposta à solicitação do prefeito, considerando o ponto de vista que representam. importante que vocês esgotem todas as dúvidas e verifiquem a exatidão das informações dos colegas de grupo para que os dados e os argumentos sejam consistentes. No espaço a seguir, anote resumidamente os argumentos apresentados separadamente pelos grupos sociais. 7 Biologia – 2ª série – Volume 2
  79. 79. Agora a turma será reorganizada para iniciar o debate entre os representantes dos diferentes grupos. Após o debate, os representantes devem elaborar uma carta de consenso. Nela, os diferentes pontos de vista devem ser incorporados caso não seja possível uma proposta única. Registre, no espaço a seguir, a carta de consenso elaborada pela turma. 7 Biologia – 2ª série – Volume 2
  80. 80. PARA SABER MA S Livros BRAS L. M N ST R O DA AGR CULTURA, PECUÁR A E ABASTEC MENTO. Produtos orgânicos: o olho do consumidor. Secretaria de Desenvolvimento Agropecuário e Cooperativismo. Brasília: Mapa ACS, 200 . Trata-se de uma cartilha do Ministério da Agricultura produzida para orientar o consumidor sobre o novo selo de certificação de produtos orgânicos, o Sistema Brasileiro de Avaliação da Conformidade Orgânica (Sisorg). A publicação é ilustrada pelo cartunista iraldo e explica o que é produto orgânico, suas qualidades e como ele deve ser produzido para ganhar o selo. LE TE, Marcelo. Os alimentos transgênicos. São Paulo: Publifolha, 2000. O jornalista explica os diferentes aspectos do tema. LORETO, lgion L.S.; SEPEL, Lenira M.N. Atividades experimentais e didáticas de Biologia Molecular e Celular. São Paulo: Editora da Sociedade Brasileira de Genética, 2003. v. 1. Esta obra apresenta materiais simples que podem ser utilizados na pro- dução de atividades práticas sobre o tema. Site e revista REV STA DE B OTECNOLOG A. Disponível em: http: . Revista eletrônica com atualidades em biotecnologia. Acesso em: 27 fev. 201 . RUMJANEK, ranklin D.; R N LER, Conc M.C. Os exames de DNA nos tri- bunais. Revista Ciência Hoje, Rio de Janeiro, v. 2 , n. 1 , mar. 2001. Documentários e filme Gattaca: a experiência genética (Gattaca). Direção: Andre Niccol. EUA, 1 7. 112 min. 1 anos. icção científica sobre uma sociedade organizada com base nas carac- terísticas genéticas das pessoas. Genoma humano: decodificando a vida (Decoding life: the blueprint of the human body). Produção: Télé mages. rança, 1 . 50 min. Série transmitida pela TV Escola que apresenta diferentes situações relacionadas ao estudo do genoma humano (câncer, herança e envelhecimento, entre outras). Mendel e a manipulação dos genes (Big questions: Mendel and the gene splicers). Produção: Channel Learning England. nglaterra, 200 . 1 min. Exibido pela TV Escola, este episódio da série Ciência em foco retrata o trabalho de Mendel e seus desdobramentos no conhecimento atual sobre a herança biológica. 0 Biologia – 2ª série – Volume 2
  81. 81. Desafio! Conforme proposto no início da Situação de Aprendizagem 1, recorte os nucleotídeos do esquema a seguir e monte as moléculas de DNA e de RNA complementar. Seu professor vai orientá-lo nessa tarefa. Boa sorte! Desoxirribose Desoxirribose Desoxirribose Desoxirribose DesoxirriboseDesoxirriboseDesoxirribose Desoxirribose Desoxirribose Desoxirribose Desoxirribose Desoxirribose Desoxirribose Desoxirribose Desoxirribose Desoxirribose Ribose Ribose P P P PCCCC CU P P P PCCCC CU A G TTTU A G TTTU Desoxirribose Desoxirribose Desoxirribose Desoxirribose Desoxirribose Desoxirribose Desoxirribose Desoxirribose Ribose A A Ribose Ribose Ribose Ribose Ribose Ribose Ribose Ribose Ribose Ribose Ribose Ribose Ribose AAA AAA GGG G GGG G P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P 1 Biologia – 2ª série – Volume 2
  82. 82. 3 Biologia – 2ª série – Volume 2
  83. 83. Biologia – 2ª série – Volume 2
  84. 84. 5 Biologia – 2ª série – Volume 2
  85. 85. Biologia – 2ª série – Volume 2
  86. 86. CONCEPÇÃO E COORDENAÇÃO GERAL NOVA EDIÇÃO 2014-2017 COORDENADORIA DE GESTÃO DA EDUCAÇÃO BÁSICA – CGEB Coordenadora Maria Elizabete da Costa Diretor do Departamento de Desenvolvimento Curricular de Gestão da Educação Básica João Freitas da Silva Diretora do Centro de Ensino Fundamental dos Anos Finais, Ensino Médio e Educação Profissional – CEFAF Valéria Tarantello de Georgel Coordenadora Geral do Programa São Paulo faz escola Valéria Tarantello de Georgel Coordenação Técnica Roberto Canossa Roberto Liberato Suely Cristina de Albuquerque Bomfim EQUIPES CURRICULARES Área de Linguagens Arte: Ana Cristina dos Santos Siqueira, Carlos Eduardo Povinha, Kátia Lucila Bueno e Roseli Ventrella. Educação Física: Marcelo Ortega Amorim, Maria Elisa Kobs Zacarias, Mirna Leia Violin Brandt, Rosângela Aparecida de Paiva e Sergio Roberto Silveira. Língua Estrangeira Moderna (Inglês e Espanhol): Ana Beatriz Pereira Franco, Ana Paula de Oliveira Lopes, Marina Tsunokawa Shimabukuro e Neide Ferreira Gaspar. Língua Portuguesa e Literatura: Angela Maria Baltieri Souza, Claricia Akemi Eguti, Idê Moraes dos Santos, João Mário Santana, Kátia Regina Pessoa, Mara Lúcia David, Marcos Rodrigues Ferreira, Roseli Cordeiro Cardoso e Rozeli Frasca Bueno Alves. Área de Matemática Matemática: Carlos Tadeu da Graça Barros, Ivan Castilho, João dos Santos, Otavio Yoshio Yamanaka, Rosana Jorge Monteiro, Sandra Maira Zen Zacarias e Vanderley Aparecido Cornatione. Área de Ciências da Natureza Biologia: Aparecida Kida Sanches, Elizabeth Reymi Rodrigues, Juliana Pavani de Paula Bueno e Rodrigo Ponce. Ciências: Eleuza Vania Maria Lagos Guazzelli, Gisele Nanini Mathias, Herbert Gomes da Silva e Maria da Graça de Jesus Mendes. Física: Anderson Jacomini Brandão, Carolina dos Santos Batista, Fábio Bresighello Beig, Renata Cristina de Andrade Oliveira e Tatiana Souza da Luz Stroeymeyte. Química: Ana Joaquina Simões S. de Mattos Carvalho, Jeronimo da Silva Barbosa Filho, João Batista Santos Junior, Natalina de Fátima Mateus e Roseli Gomes de Araujo da Silva. Área de Ciências Humanas Filosofia: Emerson Costa, Tânia Gonçalves e Teônia de Abreu Ferreira. Geografia: Andréia Cristina Barroso Cardoso, Débora Regina Aversan e Sérgio Luiz Damiati. História: Cynthia Moreira Marcucci, Maria Margarete dos Santos Benedicto e Walter Nicolas Otheguy Fernandez. Sociologia: Alan Vitor Corrêa, Carlos Fernando de Almeida e Tony Shigueki Nakatani. PROFESSORES COORDENADORES DO NÚCLEO PEDAGÓGICO Área de Linguagens Educação Física: Ana Lucia Steidle, Eliana Cristine Budiski de Lima, Fabiana Oliveira da Silva, Isabel Cristina Albergoni, Karina Xavier, Katia Mendes e Silva, Liliane Renata Tank Gullo, Marcia Magali Rodrigues dos Santos, Mônica Antonia Cucatto da Silva, Patrícia Pinto Santiago, Regina Maria Lopes, Sandra Pereira Mendes, Sebastiana Gonçalves Ferreira Viscardi, Silvana Alves Muniz. Língua Estrangeira Moderna (Inglês): Célia Regina Teixeira da Costa, Cleide Antunes Silva, Ednéa Boso, Edney Couto de Souza, Elana Simone Schiavo Caramano, Eliane Graciela dos Santos Santana, Elisabeth Pacheco Lomba Kozokoski, Fabiola Maciel Saldão, Isabel Cristina dos Santos Dias, Juliana Munhoz dos Santos, Kátia Vitorian Gellers, Lídia Maria Batista Bomfim, Lindomar Alves de Oliveira, Lúcia Aparecida Arantes, Mauro Celso de Souza, Neusa A. Abrunhosa Tápias, Patrícia Helena Passos, Renata Motta Chicoli Belchior, Renato José de Souza, Sandra Regina Teixeira Batista de Campos e Silmara Santade Masiero. Língua Portuguesa: Andrea Righeto, Edilene Bachega R. Viveiros, Eliane Cristina Gonçalves Ramos, Graciana B. Ignacio Cunha, Letícia M. de Barros L. Viviani, Luciana de Paula Diniz, Márcia Regina Xavier Gardenal, Maria Cristina Cunha Riondet Costa, Maria José de Miranda Nascimento, Maria Márcia Zamprônio Pedroso, Patrícia Fernanda Morande Roveri, Ronaldo Cesar Alexandre Formici, Selma Rodrigues e Sílvia Regina Peres. Área de Matemática Matemática: Carlos Alexandre Emídio, Clóvis Antonio de Lima, Delizabeth Evanir Malavazzi, Edinei Pereira de Sousa, Eduardo Granado Garcia, Evaristo Glória, Everaldo José Machado de Lima, Fabio Augusto Trevisan, Inês Chiarelli Dias, Ivan Castilho, José Maria Sales Júnior, Luciana Moraes Funada, Luciana Vanessa de Almeida Buranello, Mário José Pagotto, Paula Pereira Guanais, Regina Helena de Oliveira Rodrigues, Robson Rossi, Rodrigo Soares de Sá, Rosana Jorge Monteiro, Rosângela Teodoro Gonçalves, Roseli Soares Jacomini, Silvia Ignês Peruquetti Bortolatto e Zilda Meira de Aguiar Gomes. Área de Ciências da Natureza Biologia: Aureli Martins Sartori de Toledo, Evandro Rodrigues Vargas Silvério, Fernanda Rezende Pedroza, Regiani Braguim Chioderoli e Rosimara Santana da Silva Alves. Ciências: Davi Andrade Pacheco, Franklin Julio de Melo, Liamara P. Rocha da Silva, Marceline de Lima, Paulo Garcez Fernandes, Paulo Roberto Orlandi Valdastri, Rosimeire da Cunha e Wilson Luís Prati. Física: Ana Claudia Cossini Martins, Ana Paula Vieira Costa, André Henrique Ghelfi Rufino, Cristiane Gislene Bezerra, Fabiana Hernandes M. Garcia, Leandro dos Reis Marques, Marcio Bortoletto Fessel, Marta Ferreira Mafra, Rafael Plana Simões e Rui Buosi. Química: Armenak Bolean, Cátia Lunardi, Cirila Tacconi, Daniel B. Nascimento, Elizandra C. S. Lopes, Gerson N. Silva, Idma A. C. Ferreira, Laura C. A. Xavier, Marcos Antônio Gimenes, Massuko S. Warigoda, Roza K. Morikawa, Sílvia H. M. Fernandes, Valdir P. Berti e Willian G. Jesus. Área de Ciências Humanas Filosofia: Álex Roberto Genelhu Soares, Anderson Gomes de Paiva, Anderson Luiz Pereira, Claudio Nitsch Medeiros e José Aparecido Vidal. Geografia: Ana Helena Veneziani Vitor, Célio Batista da Silva, Edison Luiz Barbosa de Souza, Edivaldo Bezerra Viana, Elizete Buranello Perez, Márcio Luiz Verni, Milton Paulo dos Santos, Mônica Estevan, Regina Célia Batista, Rita de Cássia Araujo, Rosinei Aparecida Ribeiro Libório, Sandra Raquel Scassola Dias, Selma Marli Trivellato e Sonia Maria M. Romano. História: Aparecida de Fátima dos Santos Pereira, Carla Flaitt Valentini, Claudia Elisabete Silva, Cristiane Gonçalves de Campos, Cristina de Lima Cardoso Leme, Ellen Claudia Cardoso Doretto, Ester Galesi Gryga, Karin Sant’Ana Kossling, Marcia Aparecida Ferrari Salgado de Barros, Mercia Albertina de Lima Camargo, Priscila Lourenço, Rogerio Sicchieri, Sandra Maria Fodra e Walter Garcia de Carvalho Vilas Boas. Sociologia: Anselmo Luis Fernandes Gonçalves, Celso Francisco do Ó, Lucila Conceição Pereira e Tânia Fetchir. Apoio: Fundação para o Desenvolvimento da Educação - FDE CTP, Impressão e acabamento Plural Indústria Gráfica Ltda.
  87. 87. A Secretaria da Educação do Estado de SÀrack_delegati1
