Indian journal of research in pharmacy and biotechnology vol 1-issue-6-nove-dec 2013

Indian Journal of Research in Pharmacy and Biotechnology
ISSN: 2320-3471 (Online)
ISSN: 2321-5674 (Print)

Editor
B.Pragati Kumar, M.Pharm, Assistant Professor,
Nimra College of Pharmacy

Consulting editor
Dr. S Duraivel, M.Pharm, Ph.D., Principal,
Nimra College of Pharmacy

Associate Editors
Mr. Debjit Bowmick, M.Pharm., (Ph.D)
Assistant Professor, Nimra College of Pharmacy
Mr. Harish Gopinath, M.Pharm., (Ph.D)
Assistant Professor, Nimra College of Pharmacy
Dr. M. Janardhan, M.Pharm., Ph.D.
Professor, Nimra College of Pharmacy
Dr. A. Ravi Kumar, M.Pharm., Ph D.
Professor, Bapatla College of Pharmacy

Editorial Advisory Board
Dr.Y.Narasimaha Reddy, M. Pharm., Ph D.
Principal, University college of Pharmaceutical
Sciences, Kakatiya University, Warangal.
Dr.V.Gopal, M. Pharm., Ph D.

Dr. Biresh Kumar Sarkar,
Asstt.Director (Pharmacy),
Kerala
Dr. M.Umadevi, M.Sc. (Agri), Phd

Principal, Mother Theresa Post Graduate & Research
Institute of Health Sciences,Pondicherry-6

Research Associate, Tamil Nadu Agricultural
University, Coimbatore

Dr. J.Balasubramanium, M. Pharm., Ph D.

Dr. V.Prabhakar Reddy, M. Pharm., Ph D.

General Manager, FR&D
R A Chem Pharma Ltd., Hyderabad

Principal, Chaitanya College of Pharmacy Education &
Research, Warangal

Dr.P.Ram Reddy, M. Pharm., Ph D.

Dr. S.D.Rajendran, M. Pharm., Ph D.
Director, Pharmacovigilance, Medical Affairs,
Sristek Consultancy Pvt. Ltd, Hyderabad

General Manager, Formulation,
Dr.Reddy’s Laboratory, Hyderabad

IJRPB 1(6)

www.ijrpb.com

November-December 2013

INDIAN JOURNAL OF RESEARCH IN PHARMACY AND BIOTECHNOLOGY
Instructions to Authors
Manuscripts will be subjected to peer review process to determine their suitability for publication
provided they fulfill the requirements of the journal as laid out in the instructions to authors. After the
review, manuscripts will be returned for revision along with reviewer’s and/or editor’s comments. Don’t
copy and paste the article content from internet or other sources like e-books etc. Authors are the sole
responsible persons for the article, article content; results of the research conducted and copy right issues
if any. The editor and the editorial board are not entitled to change the article content, results and
diagrammatic representations which are given by authors. The article will be published only after getting
the approved galley proof from the authors.
Kindly follow the below guidelines for preparing the manuscript:
1. Prepare the manuscript in Times New Roman font using a font size of 12. There shall not be any
decorative borders anywhere in the text including the title page.
2. Don’t leave any space between the paragraphs.
3. Divide the research article into
a. Abstract
Visit us at
b. Introduction
www.ijrpb.com
c. Materials and Methods
Contact us/ send your articles to:
d. Results
Email: ijrpb@yahoo.com
e. Discussion
Phone no: 9490717845; 9704660406
f. conclusion
g. References
4. References should include the following in the same order given below
a) Author name followed by initials
b) Title of the book/ if the reference is an article then title of the article
c) Edition of the book/ if the reference is an article then Journal name
d) Volume followed by issue of the journal
e) Year of publication followed by page numbers
5. Download the author declaration form from the web site www.ijrpb.com, fill it and submit it
after signing by corresponding and co-authors to IJRPB. You can send the filled in form by post
or scanned attachment to ijrpb@yahoo.com.
6. Keep in touch with the editor through mail or through phone for further clarifications as well as
for timely publication of your article.
Indian Journal of Research in Pharmacy and Biotechnology is a bimonthly journal, developed and
published in collaboration with Nimra College of Pharmacy, Ibrahimpatnam, Vijayawada, Krishna
District, Andhra Pradesh, India-521456
Printed at:
F. No: 501, Parameswari Towers,
Ibrahimpatnam, Vijayawada, India -521456

IJRPB 1(6)

www.ijrpb.com


ISSN: 2321-5674 (Print)
S.No.
1
2

3

4
5

6

7

8

9
10
11

12

13
14

15

16

17

18

19

Contents
Authentication of traditional crop Kalongi (Nigella sativa L.) by LAMP marker
Showkat Hussain Ganie, Deepak Yadav, Altaf Ahmad, Anis Chadhry, Mohd Asif

Page No.
765-771

Comparative in-vitro dissolution study of five brands of Diclofenac sodium delayed release
tablets in QbD environment
V Malleswari Bai, M Prasada Rao, M Chandana, K Naga Harini, B Naga Deepthi, K Thirumala
Devi1, P Lakashmana Rao, Vinay U rao and J Naga raja
Development and validation of a stability indicating HPLC method for analysis of Altretamine
in bulk drug and pharmaceutical formulations
M. Karimulla Santhosh, A. Sreedevi, L. Kalyani, A. Lakshmana Rao
A review of various analytical methods on Atrovastatin
N.Delhiraj, P.Ashok,U.Ravikiran,P.Abhinandhana

772-777

A review on the use of Bleomycin-Cisplatin-Vinblastine combinations in therapy of testicular
cancer
Praveen D, Ranadheer Chowdary P
Method development and validation for the simultaneous estimation of Ofloxacin and
Tinidazole in bulk and pharmaceutical dosage form by reverse phase HPLC method
Y.Bhargav, K Haritha Pavani, S Amareswari
Evaluation of nephro protective activity of methanolic extract of seeds of Vitis vinifera against
Rifampicin and carbon tetra chloride induced nephro toxicity in wistar rats
Kalluru Bhargavi, N Deepa Ramani, Janarthan M, Duraivel S
Method development and validation for the simultaneous estimation of Atazanavir and
Ritonavir in tablet dosage form by RP-HPLC
Nuli Vasavi, Afroz Patan
Evaluation of anti arthritic activity of aqueous extract of Hibiscus Platinifolius in albino rats
Marri Praveen, M.Janarthan
Some H.R. methodology/ techniques for costs reduction in companies to improve profit
M. Sarkar, B. K. Sarkar, M. D. Gora, S. C. Verma

793-796

Analytical method development and validation of Artesunate and Amodiaquine hydrochloride
in tablet dosage form by RP-HPLC
P RajaRao, Nanda Kishore Agarwal
Analytical method development and validation for the simultaneous estimation of
Rabeprazole sodium and Itopride hydrochloride in bulk and pharmaceutical dosage forms by
RP-HPLC
Syed Shaheda, Nanda Kishore Agarwal
Formulation and evaluation of herbal anti-dandruff shampoo
Anusha Potluri*, Harish. G, B. Pragathi Kumar, Dr. Durraivel

822-827

Paracetamol and Tapentadol by RP-HPLC in bulk and pharmaceutical dosage forms
V.Praveen Kumar Reddy, Aneesha, D.Sindhura, M.Sravani, Thandava Krishna Reddy
Protective role of methanolic extract of Polygonum glabrum willd against Cisplatin and
Gentamycin induced nephrotoxicity in Albino rats
Radha.B, Janarthan M, Durraivel S
Rosuvastatin and Finofibate in tablet dosage form by reverse phase high performance liquid
chromatography
M. Sumalatha, K.Haritha Pavani
A new development and validated RP-HPLC method for the assay and related substances of
Itraconazole in capsule dosage form
Sarvani Paruchuri, Haritha Pavani K
Evalution of anti urolithiatic activity of aqueous extract of stem core of Musa paradisiaca
againest ethylene glycol and ammonium chloride induced urolithiasis on wistar rats
Thirumala K, Janarthan M, Firasat Ali M
Preparation and characterization of bioadhesive vaginal gel of Propranolol hydrochloride
Hardeep Singh Dhaliwal, Dhruba Sankar Goswami

840-845

Volume 1 Issue 6

www.ijrpb.com

778-785

786-792

797-802

803-807

808-814

815-818
819-821

828-834

835-839

846-849

850-856

857-865

866-868

869-874


20

21

22

23
24
25

26

27

28

ISSN: 2321-5674 (Print)
Topical herbal analgesic and anti arthritic (max-relief) versus Diclofenac in symptomatic
treatment of osteoarthritis of the knee: a randomized controlled trial
Md Q Azam, Abdallah A Al-Othman, Mir Sadat-Ali, Ahmed A Tantawy
Analytical method development and validation for the estimation of Olmesartan medoxomil
by RP-UPLC in bulk and pharmaceutical dosage forms
Farhana Pattan, Haritha Pavani, Chandana N, Karimulla M
Modern hygienic industrial canteen amenity: A change factor for healthy physical work
environment of the work force in Indian industrial units
TN Murty, GV Chalam, Md Aasif Siddique Ahmed Khan, T Abhinov and T Abhilash
Design and development of Metformin hydrochloride Trilayered sustained release tablets
Venkateswara Rao T, Bhadramma N, Raghukiran CVS and Madubabu K
Amlodipine: the upcoming threat to Periodontist
Sivaranjani, Vineet Kashyap, S.P.K.Kennedy Babu, Ajish Paul K,
Study of the influence of Hydrophillic polymers and Citric acid on Bi-layered floating tablets
of Diltiazem hydrochloride
Venkateswara Rao T, Bhadramma N, Raghukiran CVS2 and Madubabu K3
Development and optimization of Diltiazem hydrochloride loaded microspheres by using
different Eudragit polymers
V. Kamalakkannan, K.S.G.Arul Kumaran
Formulation, characterization and optimization of Methotrexate loaded sodium alginate
chitosan Nanoparticles using 32 factorial design
S.Daisy Chella Kumari, C.B.Tharani , N.Narayanan , C.Senthil Kumar
Strategies in Dendritic architecture for drug delivery – An over review
Pandurangan Dinesh Kumar, Palanirajan Vijayaraj Kumar, Govindaraj Saravanan

Volume 1 Issue 6

www.ijrpb.com

875-880

881-885

886-892

893-897
898-900
901-907

908-914

915-921

922-934


Mohd Asif et.al


ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)

Authentication of traditional crop Kalongi (Nigella sativa L.) by LAMP marker
Showkat Hussain Ganie1, Deepak Yadav1, Altaf Ahmad2, Anis Chadhry1, Mohd Asif1*
1. Department of Ilmul-Advia, Faculty of Medicine, Jamia Hamdard, New Delhi-110062 India
2. Department of Botany, Faculty of Science, Jamia Hamdard, New Delhi-110062
*Corresponding author: Email: profasif2012@gmail.com, Phone: 8860142069
ABSTRACT
Nigella sativa, commonly known as kalongi is an important drug of traditional system of
medicine, commonly used against cough, fever, abdominal disorders, skin infections, paralysis and
jaundice. Because of increased demand and high price, there are chances that the herb could be
adulterated in the trade by other related species. Therefore, a reliable authentication method is needed
to facilitate identification of this genuine material from its adulterants. To carry out the work, the
market samples were procured from the crude-drug markets of different geographical regions of India.
The RAPD derived LAMP technique was employed for the characterization of different accessions of
Kalongi. 19 primers were used of which one unique band, common in all accessions were eluted,
cloned and sequenced. LAMP primers were designed and LAMP product formation was detected at
60°C.Out of 25 primers, 19 primers amplified a total of 524 reproducible, clear and scorable bands.
One monomorphic RAPD fragment present in all the accessions, amplified by OPAA-09 primer, was
developed into LAMP marker for identification of N. Sativa. The primers successfully amplified the
genome of kalongi while as in negative control (Catharanthus roseus) there was no amplification. The
LAMP markers developed in this study may provide guidance for the authentication of plant materials
traded as Kalongi.
Key words: Adulteration; Authentication; loop mediated isothermal amplification (LAMP);
Molecular markers; kalongi; RAPD.
1. INTRODUCTION
The traditional knowledge of herbal
medicine is widespread- ranging from tribal folklore
use to age-old practices and closely guarded recipes
handed down from generation to generation, to
highly evolved systems of medicine like Ayurveda,
Unani and Siddha. These systems have served the
humanity through the centuries and it is certain that
they will continue to be in use for times to come.
However, in the process of urbanization the contact
with nature was cut off and, consequently, the
knowledge about the identification of medicinal
plants deteriorated to a great extent. Additionally,
the crude drugs sold in the market are adulterated,
sophisticated or substituted by quite unrelated plant
materials. The adulteration of market samples is one
of the greatest drawbacks in promotion of herbal
products (Dubey, 2004). Plant samples in the market
are stored under undesirable conditions over the
years and often contain a mixture of other plant
species (Khatoon, 1993), thus, adversely affecting
their bio efficacy. The efficacy of many of the drugs
has become suspect because of the adulterated, dried
raw materials profusely available in the indigenous
market (Anonymous, 1996). Very often the identity
of market drugs is taken for granted without
subjecting the plant material to stringent methods of
botanical identification. This result in the loss of
therapeutic potential of the preparations if the plant
used is adulterated or substituted. It results in the
production of misleading or overlapping data on

IJRPB 1(6)

www.ijrpb.com

phytochemical, pharmacological, pharmacognostical
and clinical aspects.
Nigella sativa (Family: Ranunculaceae) is
considered one of the most important medicinal herb
used in various Indigenous System of Medicine. The
plant cultivated almost all over India, is an annual
herb with linear- lance late leaves. Pale blue flowers
are solitary, fruit is capsule; seeds are black,
flattened, angular and funnel shaped. Seeds of the
herb are mostly used in medicine. Many
formulations containing Kalongi as a single drug or
in combination with other drugs are available in
Indian market. The important Unani formulations
using the drug are “Anquriya Kabir, Habe-e-Halteet,
Roghan Kalan, Qairuti Arad Karsana, Mujun
Nankhaw”. Traditionally the drug is used against
cough, fever, abdominal disorders, skin infections,
paralysis and jaundice (Paarakh, 2010). Seed oil is
used as a local anaesthetic (Paarakh, 2010). As far
as its pharmacological activities are concerned, the
drug
is
hypoglycaemic,
hypocholestermic
(Bamosaet, 2002) and antioxidant (Kanter, 2003).
Thymoquinone (constituent of seed oil extract) is
antitumor, found to kill the pancreatic cancer cells
and its derivatives are used in blood, skin and breast
cancers (Paarakh, 2010).
The aqueous decoction of kalonji revealed
significant
antibacterial
potential
against
Staphylococcus aureus, Micrococcus roseus,
Streptococcus mutans, Streptococcus morbillorium,
Streptococcus sanguis, Streptococcus intermedius,

November – December 2013

Page 765

Mohd Asif et.al


Klebsiella ozaenae, Aeromonas hydrophila, and
Streptococcus salivarius (Chaudhry and Tariq,
2008). Considering the medicinal importance of
Kalongi, the authentication of this herb is highly
mandatory. DNA fingerprinting techniques are very
useful for correct identification of taxa. Among
various DNA markers, loop-mediated isothermal
amplification (LAMP) is convenient because the
reaction could be conducted under isothermal
conditions, thereby facilitating amplification and the
results could be achieved in less than 1 hr.
To the best of our knowledge, no attempt
has been made to characterize this herb using
molecular biology. To fill this gap, we employed
LAMP markers to authenticate the said drug. For
this, samples were collected from the crude drug
dealers of North and West India.
2. MATERIALS ANDMETHODS
2.1. Plant material: The samples of N. Sativa were
collected from crude drug dealers of Delhi,
Kolkatta, Uttarakhand and Uttar Pradesh. Voucher
specimens of these samples were prepared and kept
in the Herbarium, Department of Botany, Hamdard
University, New Delhi, 110062. The seeds are
stored in seed bank, Department of Botany,
Hamdard University, New Delhi, 110062. The
identified specimens were compared with
authenticated voucher specimens preserved in the
herbarium of National Institute of Science and
Information Resources (NISCAIR). The seeds were
used for DNA isolation.
2.2. DNA Isolation: The modified CTAB protocol
of Doyle and Doyle (1990) and purification kit
(HiPurA, India) were used to extract DNA from the
overnight soaked seeds.
2.2.1. Reagents and Solutions: CTAB extraction
buffer (2M Sodium Chloride, 100mM TrisHCl (pH
8), 20 mM EDTA) 0.2% β-mercaptoethanol,
Chloroform:Isoamylalcohol (24:1), absolute alcohol,
3M Potassium acetate, Isoamyl alcohol. All the
chemicals chemical were of analytic grade.
Enzymes (Taq polymerase, Bst polymerase and
RNAase A), Taq buffer, MgCl2 and dNTPs were
purchased from Bangalore Genei (Bangalore, India).
2.2.2. Protocol: In order to avoid surface
contamination, the seeds were washed with 0.2%
Cetrimide for 3 min, followed by treatment with
0.5% streptomycin sulphate and 0.5% bavistine for
5 min each. After these treatments the seeds were
rinsed with 70% alcohol for 1 min andfinally
washed with sterile double distilled water and kept
overnight. 1g seeds were pulverized to fine powder
by liquid nitrogen in a chilled mortar and pestle
followed by the addition of 100 mg of poly vinyl
pyrollidone (PVP, insoluble) and 10 ml pre-heated

IJRPB 1(6)

www.ijrpb.com


CTAB buffer (containing 0.2 % β-mercaptoethanol).
The slurry was transferred into autoclaved 50 ml
centrifuge tube and incubated at 60oC for 1 hr. 10 ml
of Chloroform, Isoamyl alcohol (CHCl3: IAA, 24:1)
was added to the centrifuge tubes and mixed
carefully for 15 min.
The content was centrifuged at 8000 rpm for
15 min. at 15oC. The upper phase was transferred
into new autoclaved centrifuge tubes. 10µl of
RNAase was added and the tubes were incubated at
37oC for 30 min. 10 ml of CHCl3: IAA (24:1) was
added carefully and the tubes were centrifuged at
8000 rpm for 15min at 15oC. The upper phase was
transferred again into autoclaved centrifuge tube and
0.5 vol. of 3M Potassium acetate (pH 5.2) was
added. For DNA precipitation equal volume of
chilled isopropanol (chilled absolute ethanol was
also used) was used and the tubes were kept at -20oC
for 2 hrs. It was recentrifuged at 8000 rpm for 15
min at 4oC. The supernatant was discarded and the
pellet was washed with 70% ethanol, air dried and
dissolved in 250 µl of sterile water. The DNA thus
obtained was purified by DNA purification
(HiPurA, India) kit according to manufacturer’s
instructions.
2.3. Polymerase Chain Reaction (PCR)
Amplification: The PCR was carried out in 20 µl
reaction volume containing 50ng DNA, 0.5 u/µl Taq
DNA polymerase, 1.66 mM MgCl2, 30 pmol 10-mer
primers, 200 µM of each dNTPs, 2x Taq polymerase
buffer with minor changes as described by Shaik et
al. (2006). The final volume was made-up with
sterile MilliQ water. The amplifications were carried
out in DNA thermal cycler (Eppendorf, Germany).
The PCR amplification conditions for RAPD
consisted of initial step of denaturation at 94°C for 4
min, 35 cycles of denaturation at 94°C for 1 min,
annealing at 35°C for 1 min, extension at 72°C for 2
min, followed by final extension at 72°C for 10 min.
The amplified DNA was loaded on 1.2% agarose gel
in 0.5x TBE buffer containing 10 µl of EtBr
(10mg/ml)
and
photographed
using
gel
documentation system (UVP, Germany). Twenty
10-mer RAPD primer series OPAA, purchased from
Qiagen, USA and five (BG series) from Bangalore
Genei (India) were screened.
2.4. Gel purification, Cloning and sequencing of
RAPD amplified product: RAPD fragment was
excised from the gel with a sharp and sterile scalpel
to avoid any contamination. Elution of DNA from
agarose gel was carried out using MiniElute® kit
from Qiagen (USA) following manufacturer’s
instructions and the product was run on 1.2% gel
along with the Gene Rular DNA ladder, to check the
presence of the desired product. The eluted DNA
was ligated into pGEM®-T easy vector (Promega,


Page 766

Mohd Asif et.al


USA). Ligation reaction was carried out in 10μl
reaction containing 10x ligase buffer (5.0 μl),
pGEM®-T easy vector (0.5 μl), T4 DNA Ligase
(1.0 μl) and PCR product 3.0 μl) and the final
volume was set up with autoclaved Milli Q water.
Competent cells of E. coli DH5α were prepared by
CaCl2 method (Sambrook et al. 2001) and 5μl of the
ligation mixture was mixed with an aliquot of 100 μl
competent cells. The transformed cells were plated
on LB-X-gal/Amp plates and the recombinant
colonies were selected through blue-white
screening. The plasmid was isolated from the
positive bacterial colonies using plasmid isolation
kit (Qiagen, Germany). The cloned fragments were
sequenced using T7 primers through the centre for
Genomic Application, New Delhi, India.
2.5. Design of LAMP Oligonucleotides: A total set
of four LAMP primers were designed using Primer
Explorer
V3
(http://primerexplorer.jp/elamp3.0.0/index.html) for
the specific detection of PCR product. The primer
set consisted of two outer (F3 and B3), and two
inner (FIP and BIP); the inner primers cover two
distinct sequences of the target (F1c/B1c and
F2c/B2c). Sequences of the LAMP primers are
given in table 1.
2.6. LAMP reaction: The LAMP reaction was
carried out in a 25 µl reaction volume containing
60pmol each of the primers FIP and BIP, 10 pmol
each of the outer primers F3 and B3, 8mM MgSO4,
1.4mM dNTPs, 0.8M betaine, 10 units of the Bst
DNA polymerase and 2 µl of DNA template. The
optimum temperature for the LAMP reaction was
60°C. 1μlSYBR Green-Ι dye was added at the end
of the reaction. Visual inspection for amplifications
was performed through observation of colour
change following addition of 1μl of SYBR Green I
(fluorescent dsDNA intercalating dye) to the tube.


3. RESULTS
RAPD reaction was performed in order to
find out unique specie specific monomorphic bands
present in all the samples, meant for LAMP
analysis. Twenty five 10-mer RAPD primers were
used of which six did not amplify the DNA. Each
RAPD reaction was repeated thrice and only
reproducible bands were taken in to account. A total
of 524RAPD bands (table 2) were obtained and to
develop the LAMP marker, we analyzed the
nucleotide sequences of 5 species-specific RAPD
amplicons, consisting of 5 DNA fragments for N.
saitva. From the resulting nucleotide sequences, one
unique RAPD amplicon from primer OPAA-9 has
been registered in the NCBI Gene Bank dbGSS, and
used to develop RAPD derived LAMP marker (Fig.
1). The specific amplicon of 600bp (fig.2) RAPD
fragment, specific for all the accessions of N. sativa,
was used for designing primers of LAMP reaction.
The reaction was carried out using genomic
DNA as a template to determine the optimal
temperature and reaction time and to evaluate the
use of primers. LAMP product formation was
detected at a temperature range of 60−64°C and
consequently, 60°C was considered to be the
optimal reaction temperature for the LAMP assay.
The tube containing the amplified products were
visualised in the presence of fluorescent
intercalating dye SYBR Green I under UV
transilluminator. In case of positive amplification,
the original colour of the dye was changed into
green that was judged under natural light as well as
under UV light (302 nm) with the help of UV
transilluminator. In case of negative control
(Catharanthus roseus) there was no amplification,
the original orange colour of the dye was retained
(Figure.3)

Figure.1. RAPD profile of Kalonji (N. sativa) representing specific band present in all accessions amplified with
OPAA-09 primer.Lane M, molecular marker 200-1700 bp, Lanes K1–K5 corresponds to the 5 accessions (K1Kolkatta, k2- Govindpuri- New Delhi, K3- KhariBaowli- Delhi, K4- Aligarh- Uttar Pradesh, K5- DehradunUttarakhand)

IJRPB 1(6)

www.ijrpb.com


Page 767

Mohd Asif et.al



gctgcaccacctctgtggctgggacctctggtactgcttccacctgtgtctggcccatttgccccgacggcgccggcagcggggcga
ggacaccctgctctacgatgccttcgtggtctttgacaaggcgcagagtgcagtggccgactgggtgtacaacgagctccgcgtgca
gctggaggagcgccgcgggcgccgggcgctccgcctctgcctggaggagcgagactggctccctggcaagacgctcttcgagaa
cctgtgggcctcggtctacagcagccgcaagaccatgttcgtgctggaccacacggaccgggtcagcggcctcctgcgcgccagct
tcctgctggcccagcagcgcctgttggaggaccgcaaggacgtcgtggtgctggtgatcctgcgccccgccgcctaccggtcccgct
acgtgcggctgcgccagcgcctctgccgccagagcgtcctcctctggccgcaccagcccagtggccagggtagcttctgggccaac
ctgggcatggccctgaccagggacaaccgccacttctataaccggaacttctgccggggccccacgacagccgaatagcac

Figure.2.Nucleotide sequence of RAPD amplicon (600 bp) of N. sativa used for development LAMP marker

Figure.3.Analysis of LAMP under UV light (A) and natural light (B). 1-5 accessions of Nigella sativa.(1- Kolkatta,
2- Govindpuri- New Delhi, 3- KhariBaowli- Delhi, 4- Aligarh- Uttar Pradesh, 5- Dehradun- Uttarakhand, CNegative control (Catharanthus roseus)

Name
F3
B3
FIP (F1c+F2)
BIP (B1+B2c)

Table 1.Primer Sequences used in this study
sequence (5′ → 3′)
catttgccccgacggc
cggctgctgtagaccga
tcggccactgcactctgcgcgaggacaccctgctct
tccgcctctgcctggaggaccacaggttctcgaagagc

Bases
16
17
36
38

Table 2.Number of amplified products generated by 20 arbitrary primers in 5 accessions of Kalonji (Nigella
sativa)
Primer code
sequence (5′ → 3′)
No. of amplification products
Fragment size (kb)
OPAA -01
AGACGGCTCC
37
0.45-1.20
OPAA -02
GAGACCAGAC
31
0.3-1.15
OPAA -03
TTAGCGCCCC
29
0.3-1.20
OPAA -04
AGGACTGCTC
0
0
OPAA -05
GGCTTTAGCC
20
0.3-1.00
OPAA -06
TCAAGCTAAC
11
0.5-1.10
OPAA -07
CTACGCTCAC
24
0.2-1.20
OPAA -08
TCCGCAGTAG
29
0.4-1.40
OPAA -09
AGATGGGCAG
35
0.5-1.20
OPAA -10
TGGTCGGGTG
34
0.3-1.15
OPAA -11
ACCCGACCTG
32
0.35-1.10
OPAA -12
GGACCTCTTG
40
0.35-1.20
OPAA -13
GAGCGTCGCT
26
0.35-1.10
OPAA -14
AACGGGCCAA
14
0.5-1.00
OPAA -15
ACGGAAGCCC
14
0.3-1.20
OPAA -16
GGAACCCACA
33
0.3-1.20
OPAA -17
GAGCCCGACT
23
0.3-1.10
OPAA -18
TGGTCCAGCC
39
0.4-1.15
OPAA -19
TGAGGCGTGT
28
0.3-1.20
OPAA-20
TTGCCTTCGG
32
0.4-1.20
Total
524

IJRPB 1(6)

www.ijrpb.com


Page 768

Mohd Asif et.al


4. DISCUSSION
Correct identification of plants forming
the drug is a prerequisite and fundamental to
whole realm of medicine and science. Most of
the regularity guidelines and pharmacopoeia
recommend macro- and microscopic evaluation
and chemical analysis of botanical material for
quality and quantity control and standardization
(Anonymous,
1996).
Morphological
or
macroscopic identification of plant materials is
based on parameters like shape, size, texture,
colour, surface feature, odour, taste and other
organoleptic characters that are compared to
standard reference materials. Though this
method is simple and direct, its accuracy and
authenticity which are sometimes subjective,
depends on examiners.
Histological
or
microscopic
examinations are done to study comparative
microscopic inspection of broken as well as
powdered, crude, botanical materials to reveal
the characteristics of tissue structure and
arrangement of cells in different organs and
tissues. Chemical authentication establishes a
chemical composition of plant, which is used
for differentiation. The variation of chemical
composition may hinder the authentication, and
in some cases, may be misleading if the samples
are adulterated. Moreover, it is difficult to
distinguish closely related species due to similar
chemical compounds. Molecular or DNA-based
markers are now becoming a popular means for
the identification of medicinal plants (Yip,
2007).
Molecular markers have the advantage
over chemical markers as the genetic
composition is unique for each individual and is
least affected by age (Kumble, 2003),
environmental factors and physiological
conditions (Macbeath and Schreiber, 2000),
harvest, storage and processing of the samples
(Schweitzer, 2003). Molecular markers are not
stage and tissue specific and thus can be
detected at any stage of development. Ours is
the first attempt to characterize Kalongi using
LAMP markers. Although in earlier reports
RAPDs were used for the authentication
purpose (Rivera-Arce, 2007; Shinde, 2007;
Hammad and Qari 2010; Ganie, 2012),
however, these markers are very sensitive and
the big blow to these markers are
IJRPB 1(6)

www.ijrpb.com


reproducibility problem. Therefore, in the
present study RAPDs were converted into
LAMP markers. These markers are very
specific and highly reproducible because these
markers could amplify a specific gene from the
whole genome discriminating a single
nucleotide difference (Parida, 2008). As the
reaction is carried out under optimal and
isothermal conditions, therefore, there are
negligible chances of inhibition reaction at the
later stage of amplification compared with the
PCR.
The results can be easily monitored by
checking the turbidity obtained from the
precipitate and most importantly the detection
of the desired gene could be completed in a
single step by incubating mixture of gene
sample, primers, DNA polymerase with strand
displacement activity and substrates at constant
temperature (Parida, 2008). In our study, the
amplification was not detected when the
concentration of the template was 0.3 ng,
however when the template concentration was
in the range of 0.8-1.5 ng, amplifications
occurred; therefore, it was thought that DNA
concentration of 0.8 ng is the detection limit in
N. sativa. Such type of results was also
observed in the studies of P. Ginseng (Sasaki,
2008) in which 0.5 ng of template was the
detection limit.
The optimized reaction parameters that
showed positive results were 10 ng template
DNA, 10pmol of outer primers (F3 and B3),
60pmol of each of forward internal and
backward outer primers (FIP and BIP), 20 mM
reaction buffer, 10 mmMgSO4, 0.8 M betaine
and 10 units of Bst DNA polymerase. The
optimum temperature for the reaction was set at
60°C, which is considered optimum for the
activity of Bst DNA polymerase. The use of
LAMP markers for the authentication of
medicinal plants, although is rare; however,
there are some recent reports in which the
technique has been successfully applied for the
identification purposes and some of which
include Curcuma longa (Sasaki and Nagumo;
2007), Panex ginseng (Sasaki, 2008),
Catharanthus roseus (Choudhry, 2011).
We have developed LAMP, a rapid,
highly sensitive, and specific method for the
authentication of N. sativa. The present study

Page 769

Mohd Asif et.al


could be applicable to identify N. Sativa to
differentiate the herb from the spurious and
adulterated drugs sold in the market in the name
of geniuine drugs. Efforts are in progress to
develop LAMP markers to medicinal plants in
order to provide accurate method for
authenticating the medicinal plants.
5. CONCLUSION


based on RAPD analysis. Genet. Mol. Res. 9,
2010, 2412-2420.
Kanter, M., Meral, I.,Dede, S., Effects of
Nigella sativa L. and Urticadioica L. on lipid
peroxidation, antioxidant enzyme systems and
some liver enzymes in CCl4-treated rats. J. Vet.
Med. Physiol. Pathol. Clin. Med. 50, 2003, 264268.

LAMP technology could be efficiently used to
characterize the medicinal plants like of N.
sativa. By analysing the genetic profiling it is
possible to identify the said drug; this
information
could
be
employed
for
identification of authenticN. sativa devising
from the spurious and adulterated drugs.

Khatoon, S., Mehrotra, S., Shome, U.,
Mehrotra, B.N., Analysis of commercial
Ratanjot; by TLC fluorescence fingerprinting.
Int. J. Pharmacol. 31, 1993, 269-277.

ACKNOWLEDGMENTS

MacBeath, G., Schreiber, S.L., Printing proteins
as microarrays for high-throughput function
determination. Sci., 289, 2000, 1760-1763.

This work was financed by the CCRUM,
AYUSH, Ministry of Health and Family
Welfare, Government of India.
REFERENCES
Anonymous, The Useful Plants of India. PID,
CSIR, 1996, New Delhi
Bamosa A.O, Ali B.A, Al-Hawsawi Z.A, The
effects of thymoquinone on blood lipids on rats,
Indian. J. Physio. Pharmacol, 46, 2002, 195201.
Chaudhary A.A, Hemant, Mohsin M, Ahmad A,
Application of loop-mediated isothermal
amplification (LAMP)-based technology for
authentication of Catharanthus roseus (L.) G.
Don. Protoplasma, 249, 2012, 417-422.
Chaudhry N.M.A, Tariq P, In-vitro anti
bacterial activities of Kalonji, Cumin and Poppy
Seed. Pak. J. Bot, 40, 2008, 461-467.
Doyle J.J, Doyle J.J, Isolation of plant DNA
from fresh tissue, Focus, 12, 1990, 13-15.
Dubey N.K, Kumar R, Tripathi P, Global
promotion of herbal medicine: India’s
opportunity. Curr. Sci. 86, 2004, 37-41.
Ganie S.H, Srivastava P.S, Narula A, Ali Z,
Sharma M.P., Authentication of shankhpushpi
by RAPD markers. Eurasia. J. Biosci, 6, 2012,
39-46.
Hammad I, Qari S.H, Genetic diversity among
Zygophyllum (Zygophyllaceae) populations
IJRPB 1(6)

www.ijrpb.com

Kumble, K.D., Protien microarrays, new tools
for pharmaceutical development. Analyt. Bio.
Chem. 377, 2003, 812-819.

Paarakh, P.M., Nigella sativa Linn.- A
Comprehensive Review. Ind. J. Nat. Prod.
Resour. 1, 2010, 409-429.
Parida, M., Sannarangaiah, S., Dash, P.K., Rao,
P.V.L., Morita, K., Loop mediated isothermal
amplification (LAMP): a new generation of
innovative gene amplification technique;
perspectives in clinical diagnosis of infectious
diseases. Rev. Med. Virol. 18, 2008, 407-421.
Rivera-Arce, E., Gattuso, M., Alvarado, R.,
Zarate, E., Aguero, J., Feria, I., Lozoya, X.,
Pharmacognostical studies of the plant drug
Mimosa tenuifloraecortex. J. Ethnopharmaco.
113, 2007, 400-408.
Sasaki, Y., Komatsu, K., Nagumo, S., Rapid
detection of Panax ginseng by loop-mediated
isothermal amplification and its application to
authentication of Ginseng. Biol. Pharm. Bull,
31, 2008, 1806-1808.
Sasaki, Y., Nagumo, S., Rapid identification of
Curcuma longa and C. aromatic by LAMP.
Biol. Pharm. Bull, 30, 2007, 2229-2230.
Schweitzer, B., Predki, P., Synder, M.,
Microarrays to characterize protein interactions
on a whole-protoeme scale. Proteomics. 3,
2003, 190-199.
Shaik Y.B, Castellani M.L, Perrella A, Conti
F, Salini V, Tete S, Madhappan B, Vecchiet
J, De Lutiis M.A, Caraffa A, Cerulli G, Role of
quercetin (a natural herbal compound) in allergy

Page 770

Mohd Asif et.al



and inflammation, J. Biol. Regul. Homeost.
Agents, 20(3-4), 2006, 47-52.

Medicine, Evi. Based Complemen. Alterna.
Med, 4, 2007, 21-23.

Shinde M, Dhalwal K, Mahadik K.R, Joshi,
K.S, Patwardhan B.K, RAPD Analysis for
Determination of Components in Herbal

Yip P.Y, Chau C.F, Mak C.Y, Kwan H.S, DNA
methods for identification of Chinese medicinal
materials, J. Chin. Med, 2, 2007, 1-19.

IJRPB 1(6)

www.ijrpb.com


Page 771

Malleswari et.al



Comparative in-vitro dissolution study of five brands of Diclofenac sodium delayed
release tablets in QbD environment
V Malleswari Bai*1, M Prasada Rao1, M Chandana1, K Naga Harini1, B Naga Deepthi1, K Thirumala Devi1,
2
P Lakashmana Rao1, Vinay U rao and J Naga raja1
1. Department o f Pharmaceuitical Analysis, Medarametla Anjamma Masthanrao College of Pharmacy, Narasarao
Pet, Guntur district, Andhra Pradesh, India.
2. Institutes of Pharmaceutical Sciences, Hyderabad-500049
*Corresponding author: E.Mail:malleswari.v4@gmail.com
ABSTRACT
Diclofenac sodium tablets are available as delayed release tablets in the market. Delayed release
tablets are typically produced by coating the tablet with enteric coating polymers. These polymers provide
the resistance of drug release in acidic environment of stomach and allow the drug to be released in
alkaline environment of the intestine. A large number of enteric polymers are available which provide
excellent protection to drug release in acidic environment. However, each polymer dissolves at different
alkaline pH. For e.g. Eudragit L-100 dissolves at pH 6 and above while Eudragit S-100 dissolves at pH
6.5 and above. HPMC Phthalate P5.5 dissolves at pH 5.5 and above while HPMC Phthalate P dissolves at
pH 6 and above. Hence, for the same drug the bioavailability can subtly but significantly change based on
which enteric polymer is used to provide the delayed release. The aim of the current work was to
comparatively evaluate five brands of Diclofenac sodium enteric coated tablets and determine which
brands may be equivalent to each other based on in vitro testing. Comparative dissolution profile testing
was carried out in pH 5.5, pH 6 and pH 6.8 buffers. It was determined that brand 1 and 5 are equivalent to
each other while brands 2, 3 and 4 are equivalent to each other. Similarity factor f2 was used for
comparing the dissolution profiles. Alcohol dumping studies indicated that only brand 1 was able to
withstand the enteric effect at 40% level of alcohol. All other marketed brands fail the alcohol dumping
test. This indicates that patients may have to counsel not to concomitantly consume alcohol while on
Diclofenac sodium delayed release tablets.
Key words: Diclofenac sodium, Quality by design (QbD), Delayed release, Dissolution test
INTRODUCTION
Quality by Design (QbD) is a concept first
outlined by well-known quality expert Joseph M
Juran in various publications, most notably Juran on
Quality by Design. Juran believed that quality could
be planned, and that most quality crises and problems
relate to the way in which quality was planned in the
first place. While Quality by Design principles has
been used to advance product and process quality in
every industry, and particularly the automation
industries, they have most recently been adopted by
the U.S Food and Drug administration (FDA) as a
vehicle for the transformation of how drugs are
discovered,
developed,
and
commercially
manufactured (Juran, 1992).
MATERIALS AND METHODS
Development of a predictive dissolution method:
The effects of dissolution medium pH, stirring speed,
volume of the dissolution medium, type of apparatus
used were systemically evaluated to develop the
predictive dissolution method

using USP apparatus 2 .Effect of dissolution medium
pHof both the innovator product and the four brands
were subjected to dissolution testing using USP
apparatus 2 at 50 rpm in 900 mL of various media
including water, 0.1 N HCl, pH 5.5 phosphate buffer,
and pH 6.8 phosphate buffer. The drug release of the
marketed samples in comparison with the innovator at
different time intervals was obtained in all the
mediums. The similarity factor of the brands using
innovator product as the reference is calculated
Effect of dissolution medium volume: The drug
release of innovator products and all the marked
brands was evaluated using pH 1.2(0.1N HCl)
dissolution medium volumes of1000ml and 500ml.
The stirring speed was 50 rpm in each case. The drug
release profile of the marketed samples in comparison
with the innovator product at various time intervals
were obtained in all two volumes. The similarity
factor of the brands using innovator product as the
reference is calculated

Effect of dissolution medium: An initial attempt at
developing the discriminating dissolution method that
would be predictive of in vivo performance was made

Effect of stirring speed: Dissolution testing of all the
marketed samples and the innovator product was
conducted at25, 50, 75, and 100 rpm in 900 mL of pH
1.2(0.1NHCl) dissolution medium. The similarity

IJRPB 1(6)


www.ijrpb.com

Page 772

Malleswari et.al


factor of the brands using innovator product as the
reference is calculated



Effect of type of dissolution apparatus: Dissolution
testing of all the marketed samples and the innovator
product was conducted using both USP1 (Basket) and
USP2 (Paddle) apparatus in 900ml of pH
1.2(0.1NHCl) dissolution medium. The drug release
profiles of all the marketed samples in comparison
with the innovator product at various time intervals
were obtained. The similarity factor of the brands
using innovator product as the reference is calculated



QbD development process includes:
 Begin with the target product profile that
describes the use, safety and efficacy of the
product.
 Defining a target quality profile that will be
used by formulators and process engineers as
a quantitative surrogate for aspects of clinical
safety and efficacy during product
development.
 Gather relevant prior knowledge about the
substance, potential excipients and process
operation.
 Design a formulation and identify the quality
attributes to the final product that must be
controlled to meet the target product quality
profile.
 Design a manufacturing process to produce a
final product having this critical material
attributes.
 Identify the critical process parameters and
raw material attributes that must be controlled
to achieve these critical material attributes of
the final product.
 Establish a control strategy for the entire
process that may include input material
controls, process controls and monitors design
space around individual or multiple unit
operation and/ or final product tests.
 Continually monitor and update the process to
assure consistent quality.












Dissolution is the process by which a solid
solute enters a solution, and is characterized
by rate (amount dissolved by time).
In the pharmaceutical industry, it may be
defined as the amount of drug substance that
goes into solution per unit time under
standardized conditions of liquid/solid
interface,
temperature
and
solvent
composition.
Dissolution is the quality control measure and
potential to provide in sight into the in vivo
performance of the drug product.
In vitro release test that predicts the drug in
vivo would be optimal and highly desirable.
A variety of designs of apparatus for
dissolution testing have been proposed and
tested, varying from simple beaker with stirrer
to complex systems.
Different
apparatus,
procedures
and
techniques are required for different dosage
forms because of significant differences in
formulation design and the physicochemical
properties of the drugs.
Dissolution tests have been developed for
various drug delivery systems including
immediate release solid dosage forms, several
controlled release solid dosage forms and
many novel and special dosage forms.

Most of the tests with recommended apparatus and
other specifications are now available as compendial
standards in Pharmacopoeias and are used in
pharmaceutical analysis and drug development for the
various drug delivery systems.

Dissolution testing and drug release:
 Dissolution testing has been widely used as
the primary tool to evaluate drug release

RESULTS AND DISCUSSION
Five brands of Diclofenac sodium delayed
release tablets 50 mg were procured from the market
and subjected to assay and comparative dissolution
profile testing as per USP guidelines for determining
in vitro equivalence of modified release products.
Assay of Diclofenac sodium delayed release tablets:
Twenty tablets were weighed and crushed using
mortar and pestle. Quantity of powder equivalent to
100 mg of Diclofenac sodium was weighed accurately
and transferred to 100 ml volumetric flask.
Approximately 70 ml of methanol AR grade was
added and syndicated for 15 minutes. The volume was
made up to 100 ml with methanol and filtered. From
the clear filtrate and aliquot equivalent to 100 ppm
was pipette out and transferred to 10 ml volumetric
flask. The volume was made up to 10 ml with
Methanol (10 µg/ml solution). The absorbance of this

IJRPB 1(6)


Quality by Design for drug release
Two primary aspects:
1. Clinical relevance of release and stability
specifications
2. Correlation between process parameters
and ability to achieve specifications (and
therefore remain clinically relevant)

www.ijrpb.com

Page 773

Malleswari et.al


solution was measured on UV spectrophotometer at
276 nm wavelength. The drug content was calculated
by simultaneously measuring the absorbance of a
standard 10 µg/ml solution of Diclofenac sodium. The
assay values for all five brands are given in Table 1.
Disintegration test for Enteric coated tablets (IP):
The DT test for enteric coated tablets as described in
IP was performed for 6 tablets of each brand and it
was observed that all brands pass this test
Comparative dissolution testing in 0.1N HCl: It is
mandatory for all delayed release products to show <
10% drug release in 0.1N HCl when in vitro
dissolution testing is performed for 2 hours in this
medium. The results for the dissolution testing of the
5 brands are given in Table 2 and shown in Figure.1.
All five brands passed the criteria of <10% in two
hours in pH 1.2 medium.
Comparative dissolution testing in pH 5.5: pH 5.5
simulates the duodenum and upper intestinal portion.
Comparative dissolution testing was conducted in pH
5.5 acetate buffer for 1 hour (Figure.2)
The dissolution profiles were statistically
compared by calculating the similarity factor (f2). The
f2 factor for brand 2, 3, 4 and 5 was calculated by
comparing with brand 1. Only brand 5 showed f2 >
50. Hence this may be considered as equivalent to
brand 1 for dissolution profile testing in pH 5.5. The
comparing with brand 2. Brand 3 and 4 showed f2 >
50. Hence these may be considered as equivalent to
comparing with brand 3. Brand 5 showed f2 > 50.
Hence this may be considered as equivalent to brand 3
for dissolution profile testing in pH 5.5. The f2 factor
for brand 1, 2, 3 and 5 was calculated by comparing
with brand 4. Brand 2 showed f2 > 50. Hence this may
be considered as equivalent to brand 4 for dissolution
profile testing in pH 5.5. The f2 factor for brand 1, 2,
3 and 4 was calculated by comparing with brand 5 as
standard. Only brand 1 showed f2 > 50. Hence this
may be considered as equivalent to brand 5 for
dissolution profile testing in pH 5.5.
simulates the duodenum and upper intestinal portion.
6.0 Phosphate buffer for 1 hour. (Figure.3)


comparing with brand 1. Only brand 5 showed f2 >
50. Hence this may be considered as equivalent to
brand 5 for dissolution profile testing in pH 6.0.
simulates the middle and lower portion of the gut.
6.0 Phosphate buffer for 1 hour. (Figure.4).
comparing with brand 5. Brand 1, 2 and 3 showed f2 >
brand 5 for dissolution profile testing in pH 6.8.


The multimedia dissolution study indicates
that the differences in the rate and extent of
dissolution between different brands are significantly
more at pH 5.5 and pH 6 than at pH 6.8. This may
most likely be due to the fact that each brand may
have been coated with enteric materials of different
chemistries having different solubility profiles in

IJRPB 1(6)


www.ijrpb.com

Page 774

Malleswari et.al



alkaline pH. For e.g. the reported solubility of
Eudragit L100 is pH 6 and above while that of
Eudragit L100-55 is pH 5.5 and above. Consequently,
tablets coated with L-100-55 will show significantly
faster and more complete dissolution at pH 5.5 as
compared to Eudragit L-100. All pH dependent
enteric polymers completely dissolve at pH 6.8 and
above. Hence the difference between the brands is
significantly reduced in case of dissolution profile
testing in pH 6.8 buffer.
In order to simulate the way the dosage form is
exposed to pH change in vivo, dissolution profile
testing for all brands was conducted by using the in
situ pH change method. The in situ pH change method
of dissolution testing indicates that all five brands
achieve > 80% release within 30 minutes of reaching
the pH 6.8. However, dissolution profiles for Brand 1
and brand 5 are significantly faster at pH 6 than those
of brands 2, 3 and 4. Hence, from this study it may be
predicted that Brands 1 and 5 may show therapeutic
equivalence to each other while brands 2, 3 and 4 may
be equivalent to each other. But brand 1 and 5 may
not show therapeutic equivalence to brands 2, 3 and
4.(Figure.7).

different solubility profiles in commonly used
solvents. The probability that this may affect the
intended release profile in vivo is very genuine if we
consider that patients may consume alcohol when
under treatment with modified release products. The
solubility profile of the polymer in alcohol may
adversely affect the release rate of the drug from the
dosage form and the actual drug release may be
entirely different from the intended release.
Hence, the US FDA in its latest guidelines has
mandated that the alcohol dumping studies should be
carried out for modified release products in order to
demonstrate that the dosage form is able to perform
within its specified standards even in presence e of
significant levels of alcohol. For the five marketed
brands of Diclofenac sodium delayed release tablets, a
comparative alcohol dumping study was performed in
0.1N HCl without alcohol, and 0.1N HCl with 5%,
10% 20% and 40% v/v of alcohol respectively. The
dissolution profile testing was carried out for two
hours. The study indicates that only Brand 1 is able to
maintain the enteric effect of < 10% release in acidic
pH even in presence of 40% alcohol. All other brands
fail the alcohol dumping test at 40% level of alcohol.
Brand 2 fails the test even at 10% and 20% level of
alcohol. (Figure.8).

Alcohol dumping study: For modified release
products, different types of polymers are used to get
the same kind of effect. Each of these polymers has
Table.1. Assay values for all five Brands of Diclofenac sodium 50 mg delayed release tablets
BRANDS
% Assay

Brand 1
98.76

Brand 2
99.27

Brand 3
97.54

Brand 4
98.04

Brand 5
97.56

Table.2.Comparative dissolution profile testing in 0.1N Hcl
Time

Brand1

Brand2

Brand3

Brand4

Brand5

0
30
45
60
120

0
2.78
5.8
7.9
9.17

0
1.45
3.55
5.07
6.17

0
2.87
4.07
6.27
6.59

0
2.87
3.09
4.13
5.87

0
1.56
2.34
4.09
4.35

Figure.1. Dissolution profiles for 5 brands of Diclofenac
sodium delayed release tablets in 0.1N HCl

IJRPB 1(6)

www.ijrpb.com

Figure.2.Comparative dissolution profile of five brands in
ph 5.5


Page 775

Malleswari et.al



Figure.3.Comparative Dissolution Profile In Ph 6.0
Phosphate Buffer

Phosphate Buffer

Figure.5. Comparative Dissolution Profile In Ph 6.0
Phosphate Buffer

Phosphate Buffer

Figure.7. Dissolution profile by in situ ph change method

Figure.8.Alcohol Dumping study for Diclofenac sodium
delayed release tablets market brands

SUMMARY AND CONCLUSION

dissolves at pH 5.5 and above while HPMC Phthalate
P dissolves at pH 6 and above. Hence, for the same
drug the bioavailability can subtly but significantly
change based on which enteric polymer is used to
provide the delayed release.

Diclofenac sodium tablets are available as
delayed release tablets in the market. Delayed release
tablets are typically produced by coating the tablet
with enteric coating polymers. These polymers
provide the resistance of drug release in acidic
environment of stomach and allow the drug to be
released in alkaline environment of the intestine. A
large number of enteric polymers are available which
provide excellent protection to drug release in acidic
environment. However, each polymer dissolves at
different alkaline pH. For e.g. Eudragit L-100
dissolves at pH 6 and above while Eudragit S-100
dissolves at pH 6.5 and above. HPMC Phthalate P5.5

IJRPB 1(6)

www.ijrpb.com

The aim of the current work was to
comparatively evaluate five brands of Diclofenac
sodium enteric coated tablets and determine which
brands may be equivalent to each other based on in
vitro testing. Comparative dissolution profile testing
was carried out in pH 5.5, pH 6 and pH 6.8 buffers. It
was determined that Brand 1 and 5 are equivalent to
each other while brands 2, 3 and 4 are equivalent to


Page 773
Page 776

Malleswari et.al



each other. Similarity factor f2 was used for
comparing the dissolution profiles.

alcohol while on Diclofenac sodium delayed release
tablets.

Alcohol dumping studies indicated that only
brand 1 was able to withstand the enteric effect at
40% level of alcohol. All other marketed brands fail
the alcohol dumping test. This indicates that patients
may have to counsel not to concomitantly consume

ACKNOWLEDGEMENT
The authors are grateful thanks to Indian
Pharmaceutical Sciences, Arabindo pharma lim,
EMCO industries-hyd, FMC-US, Ashaland specialty
chemicals-US for providing gift samples of
Diclofenac Sodium.

REFFERECES
1. Juran JM, Juran on Quality by Design, The Free
Press, A Division of Macmillan, Inc., New York,
1992, 407-425
2. Kearney PM, Baigent C, Godwin J, Halls H,
Emberson JR, Patrono C: Do selective cyclooxygenase-2 inhibitors and traditional non-steroidal
anti-inflammatory drugs increase the risk of
atherothrombosis? Meta-analysis of randomised trials,
BMJ, 3, 2006, 1302
3. Solomon DH, Avorn J, Sturmer T, Glynn RJ,
Mogun H, Schneeweiss S: Cardiovascular outcomes
in new users of coxibs and Nonsteroidal antiinflammatory drugs: high-risk subgroups and time
course of risk, Arthritis Rheum, 54(5), 2006, 137889.
4. FitzGerald GA, Patrono C, The coxibs, selective
inhibitors of cyclooxygenase-2, N Engl J Med, 345(6),
2001, 433-42.
5. Graham DJ: COX-2 inhibitors, other NSAIDs, and
cardiovascular risk: the seduction of common sense,
JAMA, 296(13), 2006, 1653-6.
6. Brater DC, Renal effects of cyclooxygyenase-2selective inhibitors, J Pain Symptom Manage, 23(4
Suppl), 2002, 15-20.
7. Sigma Aldrich Gan TJ: Diclofenac: an update on its
mechanism of action and safety profile, Curr Med
Res Opin, 26(7), 2010, 1715-31.

IJRPB 1(6)

www.ijrpb.com


Page 773
Page 777

Lakshmana Rao et.al



Development and validation of a stability indicating HPLC method for analysis of
Altretamine in bulk drug and pharmaceutical formulations
M. Karimulla Santhosh, A. Sreedevi, L. Kalyani, A. Lakshmana Rao*
V.V. Institute of Pharmaceutical Sciences, Gudlavalleru, Andhra Pradesh, India.
*
Corresponding author: E-mail: dralrao@gmail.com
ABSTRACT
A simple, sensitive and accurate stability indicating HPLC method has been developed and
validated for determination of Altretamine in its bulk form and pharmaceutical formulations.
Chromatographic separation was achieved on a Hypersil BDS C18 column (100 mm x 4.6 mm I.D.,
particle size 5 µm) by a mobile phase consisted of phosphate buffer and acetonitrile (90:10, v/v) with
apparent pH of 3.1±0.5 and a flow rate of 1.0 mL/min. The detection wave length was set at 227 nm. An
excellent linearity was observed for Altretamine in the concentration range of 25-150 µg/mL with a
correlation coefficient of 0.999. The retention time was 2.533 min. The percentage assay of Altretamine
was 99.98%. The method developed was validated for accuracy, precision, linearity, ruggedness,
robustness, solution stability, selectivity and forced degradation studies like acidic, alkaline, oxidative,
thermal, hydrolytic and photolytic stress conditions were performed as per ICH guidelines. The results
demonstrated that the method would have a great value when applied in quality control and stability
studies of Altretamine.
Key Words: HPLC, Altretamine, Stability, Formulation.
INTRODUCTION
Altretamine (Figure 1) is a synthetic cytotoxic
antineoplastic agent (Neil, 2006). Chemically it is
N,N,N',N',N'',N''-hexamethyl-1,3,5-triazine-2,4,6triamine. Altretamine is indicated for use as a single
agent in the palliative treatment of patients with
persistent or recurrent ovarian cancer following firstline therapy with a cisplatin and/or alkylating agentbased combination (Wiernik, 1992). Altretamine is
structurally related to the alkylating agents. Its precise
mechanism of action is unknown but hydroxy methyl
intermediates in the metabolism process are possibly
the reactive species, and may act as alkylating agents
(Rhoda, 1995). Altretamine interferes with the growth
of cancer cells and slows their growth and spread in
the body.
Literature survey revealed that few HPLC
methods (Ghiorghis, 1991; Barker, 1994) were
reported for the determination of Altretamine. But no
stability indicating HPLC method was reported.
Hence the objective of this method is to develop and
validate a simple, rapid and accurate stability
indicating HPLC method (Snyder, 1997) in
accordance with ICH guidelines (ICH Q2(R1), 2005;
ICH Q1A(R2), 2003) for the determination of
Altretamine in bulk sample and its pharmaceutical
formulations.

MATERIALS AND METHODS
Chemicals and solvents: The working standard
of Altretamine was provided as gift sample from
Spectrum Labs, Hyderabad, India. The market
IJRPB 1(6)

www.ijrpb.com

formulation CANTRET capsules (Altretamine 50
mg) were procured from local market. HPLC
grade acetonitrile and water were purchased from
E.Merck (India) Ltd, Mumbai, India. Potassium
dihydrogen phosphate, orthophosphoric acid and
triethylamine of AR grade were obtained from
S.D. Fine Chemicals Ltd, Mumbai, India.
Instrumentation:
To
develop
a
high
performance liquid chromatographic method for
quantitative determination of Altretamine using
Waters HPLC system on Hypersil BDS C18
column (100 mm x 4.6 mm I.D., particle size 5
µm) was used. The instrument is equipped with
an auto sampler and UV detector. A 10 μL
rheodyne injector port was used for injecting the
samples. Data was analyzed by using Empower 2
software.
Chromatographic conditions: A mixture of
phosphate buffer pH 3.1 and acetonitrile (90:10,
v/v) was found to be the most suitable mobile
phase for ideal chromatographic separation of
Altretamine. The solvent mixture was filtered
through 0.45 μ membrane filter and sonicated
before use. It was pumped through the column at
a flow rate of 1.0 mL/min. Injection volume was
10 µL and the column was maintained at a
temperature of 300C. The column was
equilibrated by pumping the mobile phase
through the column for at least 30 minutes prior

Page 778

Lakshmana Rao et.al


to the injection of the drug solution. The detection
of the drug was monitored at 227 nm. The run
time was set at 6 minutes.
Preparation of phosphate buffer pH 3.1: 2.72
grams of potassium dihydrogen phosphate was
weighed and transferred into a 1000 mL beaker
and dissolved. 1 mL of triethylamine solution was
added to the above solution and diluted to 1000
mL with HPLC water. pH was adjusted to 3.1
with orthophosphoric acid solution.
Preparation of mobile phase and diluent: 900
mL of phosphate buffer was mixed with 100 mL
of acetonitrile and was used as mobile phase. The
solution was degassed in an ultrasonic water bath
for 5 minutes and filtered through 0.45 µ filter
under vacuum. The mixture of 800 mL of water
and 200 mL of acetonitrile was used as diluent.
Preparation of standard solution: 10 mg of
Altretamine was accurately weighed, transferred
to 10 mL volumetric flask and is dissolved in 7
mL of the diluent. Sonicated the solution for few
minutes to dissolve the drug completely. Then it
is filtered through 0.45 μ filter and the volume is
made up to 10 mL with diluent to get a
concentration of 1 mg/mL stock solution. Further
pipetted 1.0 mL of the above stock solution into a
10 mL volumetric flask and diluted up to the
mark with diluent to obtain required
concentrations.
Preparation of sample solution: Twenty
commercial capsules were emptied and
powdered. A quantity of the powder equivalent to
10 mg of Altretamine was accurately weighed,
transferred to 10 mL volumetric flask and is
dissolved in 7 mL of the diluent. Sonicated the
solution for few minutes to dissolve the drug
completely. Then it is filtered through 0.45 μ
filter and the volume is made up to 10 mL with
diluent to get a concentration of 1 mg/mL stock
solution. Further pipetted 1.0 mL of the above
stock solution into a 10 mL volumetric flask and
diluted up to the mark with diluent to obtain
required concentrations of Altretamine in
pharmaceutical dosage forms. Inject 10 µL of the
above solution into the HPLC system. All
experiments were conducted in triplicate.

IJRPB 1(6)

www.ijrpb.com


Linearity: Several aliquots of standard solution
of Altretamine was taken in different 10 mL
volumetric flasks and diluted up to the mark with
diluent such that the final concentrations of
Altretamine were in the linearity range of 25-150
µg/mL. Evaluation of the drug was performed
with UV detector at 227 nm, peak area was
recorded for all the peaks. The response for the
drug was linear and the regression equation was
found to be y=19094x-10685 and correlation
coefficient value of Altretamine was found to be
0.999. The results show that an excellent
correlation exists between peak area and
concentration of drug within the concentration
range indicated.
Limit of detection and limit of quantification:
The limit of detection (LOD) and limit of
quantification (LOQ) of the developed method
were determined by injecting progressively low
concentrations of the standard solution using the
developed HPLC method. The LOD and LOQ for
Altretamine were found to be 0.46 μg/mL and
1.39 μg/mL respectively.
System suitability: System suitability parameters
like retention time, theoretical plates and tailing
factor were calculated and compared with
standard values.
Accuracy: The accuracy of the method was
assessed by recovery study of Altretamine in the
dosage form at three concentration levels. A fixed
amount of preanalyzed sample was taken and
standard drug was added at 50%, 100% and 150%
levels. The standard concentration was fixed as
100 μg/mL and three concentration levels of 50
μg/mL, 100 μg/mL and 150 μg/mL were added to
the standard concentration. Each level was
repeated three times. The content of Altretamine
per capsule was calculated. The percentage
recovery ranges from 99.62-100.27% and the
mean recovery of Altretamine was 99.92% and
the recovery values of Altretamine indicate the
method is accurate.
Precision: The precision was determined for
Altretamine in terms of system and method
precision. For system precision evaluation,
%RSD for Altretamine was 0.32% (limit %RSD
< 2.0%). In addition, the method precision was

Page 779

Lakshmana Rao et.al


studied and the %RSD for Altretamine was
0.77% (limit %RSD < 2.0%).
Ruggedness and robustness: The ruggedness of
the method was determined by carrying out the
experiment on different instruments by different
operators using different columns of similar
types. Robustness of the method was determined
by making slight changes in the chromatographic
conditions like changes in flow rate and mobile
phase composition. It was observed that there
were no marked changes in the chromatograms,
which demonstrated that the HPLC method so
developed is rugged and robust.
Solution stability: The stability of solution under
study was established by keeping the solution at
room temperature for 24 hrs. The result showed
no significant change in concentration and thus
confirms the stability of the drug in the mobile
phase used for the analysis.
Analysis of the marketed formulations: The
proposed method was applied for the
determination of Altretamine in pharmaceutical
formulatons of Altretamine capsules. 10 µL of
each standard and sample solution were injected
and from the peak area of Altretamine, amount of
drug present in samples were computed. The
result of assay undertaken yielded 99.98% of
label claim of Altretamine. The assay obtained is
more than 99% and no interference of impurity
peak observed in Altretamine peak.
Acidic d egradation s tudies: To 1 mL of stock
solution of Altretamine, 1 mL of 2N hydrochloric
acid was added and refluxed for 30 mins at 600 C.
The resultant solution was diluted to obtain 100
µg/mL solution and 10 µL solution were injected
into the system and the chromatograms were
recorded to assess the stability of sample.
Alkaline d egradation s tudies: To 1 mL of
stock solution of Altretamine, 1 mL of 2N
sodium hydroxide was added and refluxed for
30 mins at 60 0 C. The resultant solution was
diluted to obtain 100 µg/mL solution and 10 µL
solution were injected into the system and the
chromatograms were recorded to assess the
stability of sample.
Oxidative degradation studies: To 1 mL of
IJRPB 1(6)

www.ijrpb.com


stock solution of Altretamine, 1 mL of 20%
hydrogen peroxide (H2O2) was added separately.
The solutions were kept for 30 mins at 60 0 C.
The resultant solution was diluted to obtain
100 µg/mL solution and 10 µL solution were
injected into the system and the chromatograms
were recorded to assess the stability of sample.
Thermal degradation s tudies: The standard
A l t r e t a m i n e solution w a s placed in oven at
1050 C for 6 hrs to study thermal degradation.
The resultant solution was diluted to obtain 100
µg/mL solution and 10 µL solution were
injected into the system and the chromatograms
were recorded to assess the stability of the
sample.
Hydrolytic d egradation s tudies: Stress testing
under hydrolytic conditions was studied by
refluxing the
standard
Altretamine
s o l u t i o n in water for 6 h r s at a temperature
of 60ºC. The resultant solution was diluted to
obtain 100 µg/mL solution and 10 µL solution
were injected into the system and the
stability of the sample.
Photolytic degradation studies: The photolytic
stability of the drug Altretamine was studied by
exposing the standard Altretamine solution to UV
light by keeping the beaker in UV chamber for 7
days or 200 Watt hours/m2 in photo stability
chamber. The resultant solution was diluted to
obtain 100 µg/mL solution and 10 µL solution
were injected into the system and the
stability of sample.
RESULTS AND DISCUSSION
In the present work, a simple, accurate
and precise stability indicating HPLC method has
been optimized, developed and validated for the
determination of Altretamine in pharmaceutical
formulations with UV detector by using Hypersil
BDS C18 column (100 mm x 4.6 mm I.D.,
particle size 5 µm) in isocratic mode with mobile
phase composition of phosphate buffer pH 3.1:
acetonitrile (90:10, v/v) and pH adjusted to 3.1
with orthophosphoric acid. The use of phosphate
buffer and acetonitrile in the ratio of 90:10, v/v
resulted in peak with good shape and resolution.

Page 780

Lakshmana Rao et.al


The flow rate was 1.0 mL/min and the drug
component was measured with UV detector at
227 nm. The results of optimized HPLC
conditions were shown in Table 1.
The method was linear in the range of 25150 µg/mL for Altretamine with correlation
coefficient of 0.999. The linearity results were
shown in Table 2 and the linearity curve of
Altretamine was shown in Figure 2. The %
recoveries of Altretamine were found in the range
of 99.62-100.27% and the % mean recovery was
found to be 99.92% for Altretamine, which
indicate the method is accurate. The results of
recovery studies were shown in Table 3. The
%RSD for system precision and method precision
for Altretamine were found to be 0.32 and 0.77,
which indicate the method is precise. The results
of precision studies were shown in Table 4 and
Table 5. The retention time of Altretamine was
2.533 min, cuts down on overall time of sample
analysis and the method was more cost effective
as it utilizes very less quantity of mobile phase.
The number of theoretical plates was 4253 and
tailing factor was 1.49 for Altretamine, which
indicates efficient performance of the column.
Typical chromatogram of drug Altretamine was
shown in Figure 3.
Selectivity of the method was
demonstrated by the absence of any interfering
peaks at the retention time of the drug. The
limit of detection and limit of quantification for
Altretamine were found to be 0.46 μg/mL and
1.39 μg/mL, which indicate the sensitivity of
the method. A system suitability test was


performed to evaluate the chromatographic
parameters and the summary of system
suitability parameters were shown in Table 6.
Validated method was applied for the
determination of Altretamine in commercial
formulations. The % assay was found to be
99.98% for Altretamine and the assay results
were shown in Table 7.
HPLC studies of Altretamine under
different stress conditions indicated the following
degradation behavior. In acidic degradation, the
degradation product of Altretamine was appeared
at retention time of 2.522 min and the %
degradation is 9.08%. In alkaline degradation, the
degradation is 6.96%. In oxidative degradation,
the degradation product of Altretamine was
appeared at retention time of 2.504 min and the %
degradation is 7.40%. In thermal degradation, the
degradation is 5.27%. In hydrolytic degradation,
degradation is 0.21%. In photolytic degradation,
degradation is 1.05%. The results of analysis are
given in Table 8. The typical chromatograms of
degradation behavior of Altretamine in different
stress conditions are shown in Figure 4 to Figure
9.

Figure.1. Molecular structure of Altretamine

IJRPB 1(6)

www.ijrpb.com


Page 781

Lakshmana Rao et.al



Figure.2. Calibration curve of Altretamine

Figure.3. Typical chromatogram of Altretamine

Figure.4. Acidic degradation chromatogram of Altretamine

Figure.5. Alkaline degradation chromatogram of Altretamine

IJRPB 1(6)

www.ijrpb.com


Page 782

Lakshmana Rao et.al



Figure.6. Oxidative degradation chromatogram of Altretamine

Figure.7. Thermal degradation chromatogram of Altretamine

Figure.8. Hydrolytic degradation chromatogram of Altretamine

Figure.9. Photolytic degradation chromatogram of Altretamine

IJRPB 1(6)

www.ijrpb.com


Page 783

Lakshmana Rao et.al



Table.1. Optimized chromatographic conditions of Altretamine
Parameter
Condition
Mobile phase
Phosphate buffer:acetonitrile (90:10, v/v)
pH
3.1±0.5
Diluent
Water:acetonitrile (80:20, v/v)
Column
Hypersil BDS C18 column (100 mm x 4.6 mm, 5 μm)
Column temperature
300C
Wave length
227 nm
Injection volume
10 µL
Flow rate
1.0 mL/min
Run time
6 min
Table.2. Linearity results of Altretamine
Concentration (μg/mL)
Area
25
450417
50
968416
75
1393682
100
1884563
125
2406916
150
2845543

Level
50%
100%
150%

Table.3. Recovery results of Altretamine
Concentration
Concentration
% Recovery
added (μg/mL)
found (μg/mL)
50
49.81
99.62%
100
99.88
99.88%
150
150.42
100.27%

Table.4. System precision data of Altretamine
S. No.
Area of Altretamine
1
1889572
2
1891733
3
1888707
4
1883428
5
1894047
Average
1891566
SD
6188.9
%RSD
0.32

Mean recovery
99.92%

Table.5. Method precision data of Altretamine
S. No.
Area of Altretamine
1
1903347
2
1883489
3
1880659
4
1911086
5
1879578
6
1907331
Average
1894248
SD
14512.7
%RSD
0.77

Table.6. System suitability parameters of Altretamine
Parameter
Results
Linearity range (μg/mL)
25-150
Correlation coefficient
0.999
Theoretical plates (N)
4253
Tailing factor
1.49
LOD (μg/mL)
0.46
LOQ (μg/mL)
1.39
Retention time (min)
2.533

IJRPB 1(6)

www.ijrpb.com


Page 784

Lakshmana Rao et.al


Formulation
CANTRET

Stress conditions

Standard Drug
Acidic
Alkaline
Oxidative
Thermal
Hydrolytic
Photolytic


Table.7. Assay results of Altretamine
Label claim
Amount found
50 mg
49.99 mg

%Assay
99.98%

Table.8. Degradation studies of Altretamine
Degradation
Area of
%
% of active drug present
time
peak
Degradation
after degradation
30 mins
30 mins
30 mins
6 hours
6 hours
7 days

1891733
1720141
1760088
1751783
1792116
1887905
1872031

CONCLUSION
The present study represents the first report
that deals with the development of a stability
indicating HPLC method for determination of
Altretamine. This study is a typical example for
development of a stability indicating assay established
by following the recommendations of ICH guidelines.
The proposed method showed acceptable accuracy,
precision, selectivity and wide linear concentration
range. The results of analysis proved that the method
is suitable for the determination of Altretamine in bulk
and capsule dosage forms without any interference
from the degradation products and it is recommended
for routine quality control analysis of the Altretamine
in pharmaceutical formulations.
REFERENCES

9.08%
6.96%
7.40%
5.27%
0.21%
1.05%

90.92%
93.04%
92.60%
94.73%
99.79%
98.95%

ICH Harmonised Tripartite Guideline, Stability
Testing of New Drug Substances and Products,
Q1A(R2),
International
Conference
on
Harmonization, 2003, 1-18.
ICH Harmonised Tripartite Guideline, Validation of
analytical procedures: Text and methodology, Q2(R1),
International Conference on Harmonization, 2005, 113.
Neil OJM, The Merck Index, An Encyclopedia of
Chemicals Drug and Biologicals, 14th Ed., Merck
Research Laboratories, Division of Merck and Co.
Inc., White House Station, NJ, 2006, 57.
Rhoda LC and Diana F, Altretamine: A review of its
pharmacodynamic and pharmacokinetic properties
and therapeutic potential in cancer chemotherapy,
Drugs, 49(6), 1995, 932-953.

Barker IK, Crawford SM and Fell AF, Determination
of Altretamine in human plasma with highperformance liquid chromatography, Journal of Liquid
Chromatography B, 660(1), 1994, 121-126.

Snyder LR, Kirkland JJ and Glajch JL, Practical
HPLC Method Development, 2nd Ed., New York, John
Wiley and Sons, 1997, 184-185.

Ghiorghis A and Talebian AH, High-pressure liquid
chromatography separation of potential impurities of
Altretamine, Journal of Liquid Chromatography,
14(12), 1991, 2331-2349.

Wiernik PH, Hexamethylmelamine and low or
moderate dose cisplatin with or without pyridoxine for
treatment of advanced ovarian carcinoma: a study of
the eastern cooperative oncology group, Cancer
Investigation, 10(1), 1992, 1-9.

IJRPB 1(6)


www.ijrpb.com

Page 785

Delhi Raj et.al



A review of various analytical methods on Atrovastatin
N.Delhiraj*, P.Ashok,U.Ravikiran,P.Abhinandhana
Department of pharmaceutical analysis, A.S.N Pharmacy College, Tenali, Andhra Pradesh
*Corresponding author E.Mail:pharmaraj1981@gmail.com
ABSTRACT
There is a review of analytical methods for atorvastatin, such as spectrophotometry, derivative
spectrophotometry and various chromatographic procedures such as, high-performance liquid
chromatography (HPLC), high-performance thin-layer chromatography (HPTLC), and liquid
chromatography tandem mass spectrometry (LC-MS). This review is based on representative publications
that were published between 2000 and 2013.
Key Words: hypolipideamic drugs, HMG-COA analysis, review, spectrophotometry, chromatography
INTRODUCTION
Atorvastatin is the most efficacious and best
tolerated hypolipideamic drugs introduced in
1980.They competitively inhibit conversion of 3hydroxy 3-methyl glutaryl coenzyme and (HMGCOA) to mevalonate Atorvastatin is the most
efficacious and best tolerated hypolipideamic drugs.
They competitively inhibit conversion of 3-hydroxy 3methyl glutaryl coenzyme and (HMG-COA) to
mevalonate (rate limiting step in cholesterol (CH)
synthesis) by the HMG-COA reductase. Therapeutic
doses reduce cholesterol synthesis by 20-50%. This
results in compensatory increases in Low density
lipoprotein (LDL) receptor expression on liver cell
leads to increased receptor mediated uptake and
catabolism of Intermediate density lipoprotein (IDL)
and LDL. Over long term feedback induction of
HMG-COA reductase tends to increase CH synthesis
but a steady is finally attained with a dose dependent
lowering of LDL-CH levels. The daily dose of
Atorvastatin for lowering LDL-CH levels by 30-35%
is 10 mg. Morever at their maximum recommended
doses atorvastatin can reduce CH up to 45-55%.5. The
more efficacious atrovastatin given at their higher
doses effectively reduce Triglycerides (TGs) (by 2535%) when they are moderately raised but not when
they are markedly raised. Because HMG-COA
reductase activity is maximum at midnight, statins are
administered at bed time to obtain maximum
effectiveness. All statins except rosuvastatin are
metabolized primarily by CYP3A4. Inhibitors and
inducers of this isoenzyme respectively increase and
decrease statin blood levels. (Tripathi,KD 2008)

and atorvastatin in human serum using naproxen
sodium as an internal standard. Effect of different
experimental parameters and various particulate
columns on the analysis of these analytes was
evaluated. The method showed adequate
separation for rosuvastatin and atorvastatin and
best resolution was achieved with Brownlee
analytical C18 column (150×4.6 mm, 5 μm) using
methanol-water (68:32, v/v; pH adjusted to 3.0
with trifluoroacetic acid) as a mobile phase at a
flow rate of 1.5 ml/min and wavelength of 241
nm. The calibration curves were linear over the
concentration ranges of 2.0-256 ng/ml for
rosuvastatin and 3.0-384 ng/ml for atorvastatin.
The lower limit of detection (LLOD) and lower
limit of quantification (LLOQ) for rosuvastatin
were 0.6 and 2.0 ng/ml while for atorvastatin
were 1.0 and 3.0ng/ml, respectively. All the
analytes were separated in less than 7.0 min. The
proposed method could be applied for routine
laboratory analysis of rosuvastatin and
atorvastatin
in
human
serum
samples,
pharmaceutical
formulations,
drug-drug
interaction studies and pharmacokinetics studies.
(Shah Y, 2011)

Chromatographic and spectrophotometric
methods: A novel, precise, accurate and rapid
isocratic reversed-phase high performance liquid
chromatographic/ultraviolet
(RP-HPLC/UV)
method was developed, optimized and validated
for simultaneous determination of rosuvastatin

Two simple and accurate methods to
determine atorvastatin calcium and ramipril in
capsule dosage forms were developed and
validated using HPLC and HPTLC. The HPLC
separation was achieved on a Phenomenex Luna
C18 column (250 x 4.6 mm id, 5 microm) in the
isocratic mode using 0.1% phosphoric acidacetonitrile (38 + 62, v/v), pH 3.5 +/- 0.05,
mobile phase at a flow rate of 1 ml/min. The
retention times were 6.42 and 2.86 min for
atorvastatin calcium and ramipril, respectively.
Quantification was achieved with a photodiode

IJRPB 1(6)


www.ijrpb.com

Page 786

Delhi Raj et.al


array detector set at 210 nm over the
concentration range of 0.5-5 µg/ml for each, with
mean recoveries (at three concentration levels) of
100.06 +/- 0.49% and 99.95 +/- 0.63% RSD for
atorvastatin calcium and ramipril, respectively.
The HPTLC separation was achieved on silica gel
60 F254 HPTLC plates using methanol-benzeneglacial acetic acid (19.6 + 80.0 + 0.4, v/v/v) as the
mobile phase. The Rf values were 0.40 and 0.20
for
atorvastatin
calcium
and
ramipril,
respectively. Quantification was achieved with
UV densitometry at 210 nm over the
concentration range of 50-500 ng/spot for each,
with mean recoveries (at three concentration
levels) of 99.98 +/- 0.75% and 99.87 +/- 0.83%
RSD for atorvastatin calcium and ramipril,
respectively. Both methods were validated
according to International Conference on
Harmonization guidelines and found to be simple,
specific, accurate, precise, and robust. The mean
assay percentages for atorvastatin calcium and
ramipril were 99.90 and 99.55% for HPLC and
99.91 and 99.47% for HPTLC, respectively. The
methods were successfully applied for the
determination of atorvastatin calcium and
ramipril in capsule dosage forms without any
interference from common excipients. (Panchal
HJ, 2010)
Charged aerosol detector (CAD) detection
approach was applied in a new HPLC method for
the determination of three of the major statins
used in clinical treatment-simvastatin, lovastain
and atorvastatin. The method was optimized and
the influence of individual parameters on CAD
response and sensitivity was carefully studied.
Chromatography was performed on a Zorbax
Eclipse XDB C18 (4.6 mm x 75 mm, 3.5
microm), using acetonitrile and formic acid 0.1%
as mobile phase. The detection was performed
using both charged aerosol detector (CAD) (20
pA range) and
diode array detector-238
nm(DAD) simultaneously connected in series. In
terms of linearity, precision and accuracy, the
method was validated using tablets containing
atorvastatin and simvastatin. The CAD is
designated to be a non-linear detector in a wide
dynamic range, however, in this application and
in the tested concentration range its response was
found to be perfectly linear. The limits of
IJRPB 1(6)

www.ijrpb.com


quantitation (0.1 µg/ml) were found to be two
times lower than those of UV detection. (Patil
UP, 2010)
A simple, specific, accurate and precise
high-performance thin-layer chromatographic
method for analysis of Telmisartan and
Atorvastatin calcium in fixed dose combination
has been developed. The method uses aluminium
plates coated with silica gel 60 F as stationary
phase and toluene: methanol (7: 3, v/v) as mobile
phase. Densitometric evaluation of the separated
bands was performed at 280 nm. The two drugs
were satisfactorily resolved with RF values 0.50
± 0.01 and 0.29 ± 0.00 for Telmisartan and
Atorvastatin calcium, respectively. The respective
calibration plots were found to be linear over the
range 200–1000 and 200–700 ng/band for
Telmisartan
and
Atorvastatin
calcium,
respectively. This method has been successfully
validated and applied for the analysis of drugs in
pharmaceutical formulation. (Novakova, 2009)
254

A number of analytical methods were
reported for the estimation of atorvastatin and
ramipril from their individual dosage forms or in
combination with other drugs (Valiyare, 2004;
Vachareau and Neirinck, 2000). Here successful
reverse
phase-high
performance
liquid
chromatographic method and spectroscopic
methods were developed then validated for the
analysis of combined dosage form of atorvastatin
and ramipril. Individual lambda-max for
atorvastatin is 247 nm and that of ramipril is 208
nm. They intersect at 215 nm which is fixed as
wavelength for reverse phase-high performance
liquid chromatographic method. (Joseph, 2008)
A simple, accurate and precise highperformance thin-layer chromatographic method
has been developed for the estimation of
Atorvastatin Calcium and Metoprolol Tartarate
simultaneously from a capsule dosage form. The
method employed Silica gel 60F254 precoated
plates as stationary phase and a mixture of
Chloroform: Methanol: Glacial acetic acid (dil.)
(9:1.5:0.2 ml %v/v) as mobile phase.
Densitometric scanning was performed at 220 nm
using Camag TLC scanner 3. The method was
linear in the drug concentrations' range of 500 to
2500 ng/spot for Atorvastatin Calcium, also for

Page 787

Delhi Raj et.al



Metoprolol Tartarate with correlation coefficient
of 0.984 for Atorvastatin Calcium and 0.995 for
Metoprolol Tartarate respectively. The retention
factor for Atorvastatin Calcium was 0.45 ± 0.04
and for Metoprolol Tartarate was 0.25 ± 0.02.
The method was validated as per ICH
(International Conference on Harmonization)
Guidelines, proving its utility in estimation of
Atorvastatin Calcium and Metoprolol Tartarate in
combined dosage form. (Patole SM, 2011)

wavelength 254 nm. The retention time of
atorvastatin calcium and telmisartan was found to
be 4.6 and 6.1 minutes respectively. The
validation of the proposed method was carried out
for its specificity, linearity, accuracy, precision,
limit of detection and quantification for both
atorvastatin calcium and telmisartan. The
developed method can be used for routine quality
analysis of titled drugs in combination in tablet
formulation (Suresh Kumar GV, 2010).

A rapid high performance liquid
chromatographic method was developed and
validated for determination of atorvastatin in
pharmaceutical dosage forms, and for evaluation
of its stability in the solid phase. Separation of
atorvastatin was successfully achieved on a C-18
column utilizing water--acetonitrile at the
volumetric ratio of 48:52, adjusted to pH 2.0 with
80% ortho-phosphoric acid. The detection
wavelength was 245 nm. The method was
validated and the response was found to be linear
in the drug concentration range of 0.04 mg/mol 0.4 mg/mol. The mean values percentage relative
standard deviation+/- (RSD) of the slope and the
correlation coefficient were 8.192 +/- 0.260 and
0.999, respectively. The RSD values for intraand interday precision were < 1.00% and 0.90%,
respectively. The degradation kinetic of
atorvastatin at 363 K in a relative humidity of
76.4% was observed to be autocatalytic first order
reaction. The kinetic parameters were as follows:
k (where k represents the velocity constant; s (-1)
= (1.42 +/- 0.19) 10(-6); t (0.5) (where t (0.5)
represents the time needed for a 50% decay of
atorvastatin; days) = 32.82 +/- 0.9; t (0.1) (where
t (0.1) represents the time needed for a 10%
decay of atorvastatin; days) = 13.86 +/- 0.8.
(Stains B, 2006)

A simple, specific, accurate and stability
indicating reversed phase high performance liquid
chromatographic method was developed for the
simultaneous determination of atorvastatin
calcium and amlodipine besylate in tablet dosage
forms. A Phenomenex Gemini C-18, 5 mm
column having 250´4.6 mm i.d. in isocratic mode,
with mobile phase containing 0.02 M potassium
dihydrogen
phosphate:acetonitrile:methanol
(30:10:60, v/v/v) adjusted to pH 4 using ortho
phosphoric acid was used. The flow rate was 1.0
ml/min and effluents were monitored at 240 nm.
The retention times of atorvastatin calcium and
amlodipine besylate were 11.6 min and 4.5 min,
respectively. The calibration curves were linear in
the concentration range of 0.08-20 µg/ml for
atorvastatin calcium and 0.1-20 µg/ml for
amlodipine besylate. Atorvastatin calcium and
amlodipine besylate stock solutions were
subjected to acid and alkali hydrolysis, chemical
oxidation and dry heat degradation. The degraded
product peaks were well resolved from the pure
drug peak with significant difference in their
retention time values. The proposed method was
validated and successfully applied to the
estimation of atorvastatin calcium and amlodipine
besylate in combined tablet dosage forms (Shah
D.A, 2008)

A simple, precise and accurate reversedphase liquid chromatographic method has been
developed for the simultaneous estimation of
atorvastatin calcium and telmisartan in tablet
formulations .The chromatographic separation
was achieved on (Waters symmetry C18, 250mm
x 4.6mm, 5μ) analytical column. A mixture of
ammonium acetate (0.02M, pH 4.0 adjusted with
glacial acetic acid) and acetonitrile in ratio (40:60
v/v) at flow rate of 1.0ml/min and detector

A reverse phase high performance liquid
chromatographic method was developed for the
simultaneous estimation of atorvastatin calcium
and fenofibrate in tablet formulation. The
separation was achieved by Luna C18 column
and methanol: acetate buffer pH 3.7 (82:18 v/v)
as mobile phase, at a flow rate of 1.5 ml/min.
Detection was carried out at 248 nm. Retention
time of atorvastatin calcium and fenofibrate was
found to be 3.02+0.1 and 9.05+0.2 min,

IJRPB 1(6)


www.ijrpb.com

Page 788

Delhi Raj et.al


respectively. The method has been validated for
linearity, accuracy and precision. Linearity for
atorvastatin calcium and Fenofibrate were in the
range of 1-5 μg/ml and 16-80 μg/ml, respectively.
The mean recoveries obtained for Atorvastatin
calcium and fenofibrate were 101.76% and
100.06%, respectively. Developed method was
found to be accurate, precise, selective and rapid
for simultaneous estimation of atorvastatin
calcium and fenofibrate in tablets. (Jain N, 2008)
An isocratic RP-HPLC method was
developed and validated for the quantitation of
Atorvastatincalcium and Amlodipine besylate in
combined tablet dosage forms. Quantitation was
achieved using a reversed-phase Hypersil silica
BDS (250x4.6mm with 5+ particle size) column
at ambient temperature with mobile phase
consisting of 0.05M ammonium acetate buffer
(pH-4) and acetonitrilein the ratio (40 + 60, v/v).
The flow rate was 1.0 ml/min. Measurements
were made at a wavelength of 240.0nm. The
proposed method was validated for selectivity,
precision, linearity and accuracy. The assay
method was found to be linear from 30.070.0µg/ml for Amlodipine besylate and 60.0140.0 µg/ml for Atorvastatin calcium. All
validation parameters were within the acceptable
range. The developed method was successfully
applied to estimate the amount of Atorvastatin
calcium and Amlodipine besylate in combined
dosage forms. (Mishra P, 2007)
A stability indicating UPLC method was
developed and validated for the simultaneous
determination of atorvastatin, fenofibrate and
their impurities in tablets. The chromatographic
separation was performed on acquity UPLC BEH
C18 column (1.7 microm, 2.1 mmx100 mm)
using gradient elution of acetonitrile and
ammonium acetate buffer (pH 4.7; 0.01 M) at
flow rate of 0.5 ml/min. UV detection was
performed at 247 nm. Total run time was 3 min
within which main compounds and six other
known and major unknown impurities were
separated. Stability indicating capability was
established by forced degradation experiments
and separation of known degradation products.
The method was validated for accuracy,
repeatability, reproducibility and robustness.
IJRPB 1(6)

www.ijrpb.com


Linearity, loss of drying (LOD) and loss of
quality (LOQ) was established. (Kadav AA,
2008)
A simple, accurate, rapid and precise
isocratic reversed-phase high-performance liquid
chromatographic method has been developed and
validated for simultaneous determination of
aspirin, atorvastatin calcium and clopidogrel
bisulphate in capsules. The chromatographic
separation was carried out on an Inertsil ODS
analytical column (150×4.6 mm; 5 μm) with a
mixture of acetonitrile: phosphate buffer pH 3.0
adjusted with o-phosphoric acid (50:50, v/v) as
mobile phase; at a flow rate of 1.2 ml/min. UV
detection was performed at 235 nm. The retention
times were 1.89, 6.6 and 19.8 min. for aspirin,
atorvastatin calcium and clopidogrel bisulphate,
respectively. Calibration plots were linear (r 2
>0.998) over the concentration range 5-30 μg/ml
for atorvastatin calcium and 30-105 μg/ml for
aspirin and clopidogrel bisulphate. The method
was validated for accuracy, precision, specificity,
linearity, and sensitivity. The proposed method
was successfully used for quantitative analysis of
capsules. No interference from any component of
pharmaceutical dosage form was observed.
Validation studies revealed that method is
specific, rapid, reliable, and reproducible. The
high recovery and low relative standard deviation
confirm the suitability of the method for routine
determination of aspirin, atorvastatin calcium and
clopidogrel bisulphate in bulk drug and capsule
dosage form. (Londhe SV, 2011)
A UV spectrophotometric method was
developed for the estimation of atorvastatin
calcium & fenofibrate in table dosage form by
using simultaneous equation method. The drug
obeyed Beer’s law & showed good correlation
near to 0.999. Absorption maxima of atorvastatin
calcium & fenofibrate were found to be at 246
and 286nm respectively. Beer’s law was obeyed
in concentration rang of 1-10 μg/ml for
atorvastatin calcium & 2-20μg/ml for fenofibrate.
The method has been validated for linearity,
accuracy & precision. The recovery was more
than 99%. The developed method was found to be
accurate, simple, precise, economical, and
selective for simultaneous estimation of

Page 789

Delhi Raj et.al


atorvastatin calcium &fenofibrate in tablet dosage
form. &fenofibrate in tablet dosage form. (Rupali
Hiravr, 2010)
A UV spectrophotometric method using
simultaneous equation was developed for the
simultaneous determination of Telmisartan and
Atorvastatin calcium in a binary mixture. In the
proposed method, the signals were measured at
296.0 nm and 247.0 nm corresponding to
absorbance maxima of Telmisartan and
Atorvastatin Calcium in methanol respectively.
Linearity range was observed in the concentration
range of 5-30 µg/ml for both the drugs.
Concentration of each drug was obtained by using
the absorptivity values calculated for both drugs
at two wavelengths, 296.0 nm and 247.0 nm and
solving the simultaneous equation. Developed
method was applied to laboratory mixture and its
pharmaceutical formulation. The method was
validated statistically and recovery study was
performed to confirm the accuracy of the method.
(Chaudhari KU, 2010)
Atorvastatin calcium(ATC) is the active
pharmaceutical ingredient (API) of the best
selling lipid-lowering formulation Lipitor.
Twelve ATC crystal forms are known and several
pharmaceutical companies are developing or have
developed generic drug formulations based on
different ATC polymorphs. The strong overlap of
the X-ray diffraction patterns (XRD) of the
polymorphs with the respective patterns of the
excipients, the presence of small API quantities in
the tablet and the similarity of the crystal phase
VIII XRD pattern used in the tablet examined in
this work to that of phases IV and IX made
identification difficult. Quantitative determination
of Atorvastatin was attempted using Raman
spectroscopy (RS), IR spectroscopy and X-ray
powder diffraction. It was found that RS
exhibited lower detection limit and a calibration
model was constructed. Its application on
commercial ATC tablets with 40mg strength
yielded an error of 1.25%. (Skoda D, 2008)


liquid
chromatography
tandem
mass
spectrometry. All six analytes and corresponding
deuterium (d5)-labeled internal standards were
extracted from 50 μL of human plasma by protein
precipitation. The chromatographic separation of
analytes was achieved using a Zorbax-SB Phenyl
column (2.1 mm×100 mm, 3.5 μm). The mobile
phase consisted of a gradient mixture of 0.1% v/v
glacial acetic acid in10% v/v methanol in water
(solvent A) and 40% v/v methanol in acetonitrile
(solvent B). All analytes including ortho- and
Para-hydroxy metabolites were baseline separated
within 7.0 min using a flow rate of 0.35 ml/min.
Mass spectrometry detection was carried out in
positive electro spray ionization mode, with
multiple reactions monitoring scan. The
calibration curves for all analytes were linear
(R2≥0.9975, n=3) over the concentration range of
0.05–100 ng/ml and with lower limit of
quantitation of 0.05 ng/ml Mean extraction
recoveries ranged between 88.6–111%. Intra- and
inter-run mean percent accuracy was between 85–
115% and percent imprecision was≤15%.
Stability studies revealed that ATV acid and
lactone forms were stable in plasma during bench
top (6 h on ice-water slurry), at the end of three
successive freeze and thaw cycles and at −80 °C
for 3 months. The method was successfully
applied in a clinical study to determine
concentrations of ATV and its metabolites over12
h post-dose in patients receiving atorvastatin.
(Macwan JS, 2011)

The aim of the proposed work was to
develop and validate a simple and sensitive assay
for the analysis of atorvastatin, ortho- and Parahydroxy-ATC, ATC lactone, and ortho- and Parahydroxy-ATC lactone in human plasma using

A rapid, simple, sensitive and specific
LC-MS/MS method has been developed and
validated for the simultaneous estimation of
atorvastatin, amlodipine, ramipril and benazepril
using nevirapine as an internal standard. The
API-4000 LC-MS/MS was operated under the
multiple-reaction monitoring mode using electro
spray ionization. Analytes and IS were extracted
from plasma by simple liquid-liquid extraction
technique using ethyl acetate. The reconstituted
samples were chromatographed on C 18 column
by pumping 0.1% formic acid-acetonitrile (15:85,
v/v) at a flow rate of 1 ml/min. A detailed
validation of the method was performed as per
the FDA guidelines and the standard curves were
found to be linear in the range of 0.26-210 ng/ml
for ATO; 0.05-20.5 ng/ml for amlodipine( AML);

IJRPB 1(6)


www.ijrpb.com

Page 790

Indian journal of research in pharmacy and biotechnology vol 1-issue-6-nove-dec 2013

Indian journal of research in pharmacy and biotechnology vol 1-issue-6-nove-dec 2013

Recomendados

Recomendados

Mais conteúdo relacionado

Mais procurados

Mais procurados (7)

Semelhante a Indian journal of research in pharmacy and biotechnology vol 1-issue-6-nove-dec 2013

Semelhante a Indian journal of research in pharmacy and biotechnology vol 1-issue-6-nove-dec 2013 (20)

Último

Último (20)

Indian journal of research in pharmacy and biotechnology vol 1-issue-6-nove-dec 2013