Estrutura e Função

2.681 visualizações

Publicada em

0 comentários
0 gostaram
Estatísticas
Notas
  • Seja o primeiro a comentar

  • Seja a primeira pessoa a gostar disto

Sem downloads
Visualizações
Visualizações totais
2.681
No SlideShare
0
A partir de incorporações
0
Número de incorporações
318
Ações
Compartilhamentos
0
Downloads
19
Comentários
0
Gostaram
0
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Estrutura e Função

  1. 1. TTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAGAGCCCGGCCCGGGGGACGGGCGGCGGGATAGCGGGACCCCGGCGCGGCGGTGCGCTTCAGGGCGCAGCGGCGGCCGCAGACCGAGCCCCGGGCGCGGCAAGAGGCGGCGGGAGCCGGTGGCGGCTCGGCATCATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCTTTTAGCGTCCTACACGAGCCATGGGGCGGACGCCAATTTGGAGGCTGGGAACGTGAAGGAAACCAGAGCCAGTCGGGCCAAGAGAAGAGGCGGTGGAGGACACGACGCGCTTAAAGGACCCAATGTCTGTGGATCACGTTATAATGCTTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACT 3.200.000.000GTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTACACAGCTCTGACAAACGGGCGCTGCTCTAACCAGCTGCCACAGTCCATAACCAAAATGCAGTGCTGCTGTGATGCCGGCCGATGCTGGTCTCCAGGGGTCACTGTCGCCCCTGAGATGTGTCCCATCAGAGCAACCGAGGATTTCAACAAGCTGTGCTCTGTTCCTATGGTAATTCCTGGGAGACCAGAATATCCTCCCCCACCCCTTGGCCCCATTCCTCCAGTTCTCCCTGTTCCTCCTGGCTTTCCTCCTGGACCTCAAATTCCGGTCCCTCGACCACCAGTGGAATATCTGTATCCATCTCGGGAGCCACCAAGGGTGCTGCCAGTATTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAAACGTTACTGATTACTGCCAGTTGGTCCGCTATCTCTGTCAAAATGGACGCTGCATTCCAACTCCTGGGAGTTACCGGTGTGAGTGCAACAAAGGGTTCCAGCTGGACCTCCGTGGGGAGTGTATTGATGTTGATGAATGTGAGAAAAACCCCTGTGCTGGTGGTGAGTGTATTAACAACCAGGGTTCGTACACCTGTCAGTGCCGAGCTGGATATCAGAGCACACTCACGCGGACAGAATGCCGAGACATTGATGAGTGTTTGAATGAATGTGAGACTCCTGGAATCTGTGGTCCAGGGACATGTTACAACACCGTTGGCAACTACACCTGTATCTGTCCTCCAGACTACATGCAAGTGAATGGGGGAAATAATTGCATGGATATGAGAAGAAGTTTGTGCTACAGAAACTACTATGCTGACAACCAGACCTGTGATGGAGAATTGTTATTCAACATGACCAAGAAGATGTGCTGCTGTTCCTACAACATTGGCCGGGCGTGGAACAAGCCCTGTGAACAGTGTCCCATCCCAAGTACAGATGAGTTTGCTACACTCTGTGGAAGTCAAAGGCCAGGCT
  2. 2. “GENOMA”Bata as claras em neve, junte as gemas e o açúcar aos poucos, sempre batendo.Misture a farinha de trigo juntamente com o Chocolate em Pó e o fermento e despejesobre as claras, misturando delicadamente. Asse em fôrma redonda (25 cm dediâmetro), untada e enfarinhada e asse em forno médio (180º C) preaquecido porcerca de 40 minutos. Desenforme e deixe esfriar. Depois de frio, corte ao meio eumedeça com o rum. Recheie com parte do chantilly e as cerejas. Cubra com ochantilly restante e raspas de chocolate. Decore com as cerejas inteiras.
  3. 3. TTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAGAGCCCGGCCCGGGGGACGGGCGGCGGGATAGCGGGACCCCGGCGCGGCGGTGCGCTTCAGGGCGCAGCGGCGGCCGCAGACCGAGCCCCGGGCGCGGCAAGAGGCGGCGGGAGCCGGTGGCGGCTCGGCATCATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCTTTTAGCGTCCTACACGAGCCATGGGGCGGACGCCAATTTGGAGGCTGGGAACGTGAAGGAAACCAGAGCCAGTCGGGCCAAGAGAAGAGGCGGTGGAGGACACGACGCGCTTAAAGGACCCAATGTCTGTGGATCACGTTATAATGCTTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTACACAGCTCTGACAAACGGGCGCTGCTCTAACCAGCTGCCACAGTCCATAACCAAAATGCAGTGCTGCTGTGATGCCGGCCGATGCTGGTCTCCAGGGGTCACTGTCGCCCCTGAGATGTGTCCCATCAGAGCAACCGAGGATTTCAACAAGCTGTGCTCTGTTCCTATGGTAATTCCTGGGAGACCAGAATATCCTCCCCCACCCCTTGGCCCCATTCCTCCAGTTCTCCCTGTTCCTCCTGGCTTTCCTCCTGGACCTCAAATTCCGGTCCCTCGACCACCAGTGGAATATCTGTATCCATCTCGGGAGCCACCAAGGGTGCTGCCAGTATTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAAACGTTACTGATTACTGCCAGTTGGTCCGCTATCTCTGTCAAAATGGACGCTGCATTCCAACTCCTGGGAGTTACCGGTGTGAGTGCAACAAAGGGTTCCAGCTGGACCTCCGTGGGGAGTGTATTGATGTTGATGAATGTGAGAAAAACCCCTGTGCTGGTGGTGAGTGTATTAACAACCAGGGTTCGTACACCTGTCAGTGCCGAGCTGGATATCAGAGCACACTCACGCGGACAGAATGCCGAGACATTGATGAGTGTTTGAATGAATGTGAGACTCCTGGAATCTGTGGTCCAGGGACATGTTACAACACCGTTGGCAACTACACCTGTATCTGTCCTCCAGACTACATGCAAGTGAATGGGGGAAATAATTGCATGGATATGAGAAGAAGTTTGTGCTACAGAAACTACTATGCTGACAACCAGACCTGTGATGGAGAATTGTTATTCAACATGACCAAGAAGATGTGCTGCTGTTCCTACAACATTGGCCGGGCGTGGAACAAGCCCTGTGAACAGTGTCCCATCCCAAGTACAGATGAGTTTGCTACACTCTGTGGAAGTCAAAGGCCAGGCT
  4. 4. 8 “GENES”• Bata as claras em neve, junte as gemas e o açúcar aos poucos, sempre batendo.• Misture a farinha de trigo juntamente com o Chocolate em Pó e o fermento edespeje sobre as claras, misturando delicadamente.• Asse em fôrma redonda (25 cm de diâmetro), untada e enfarinhada e asse emforno médio (180º C) pré-aquecido por cerca de 40 minutos.• Desenforme e deixe esfriar.• Depois de frio, corte ao meio e umedeça com o rum.• Recheie com parte do chantilly e as cerejas.• Cubra com o chantilly restante e raspas de chocolate.• Decore com as cerejas inteiras.
  5. 5. TTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAGAGCCCGGCCCGGGGGACGGGCGGCGGGATAGCGGGACCCCGGCGCGGCGGTGCGCTTCAGGGCGCAGCGGCGGCCGCAGACCGAGCCCCGGGCGCGGCAAGAGGCGGCGGGAGCCGGTGGCGGCTCGGCATCATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCTTTTAGCGTCCTACACGAGCCATGGGGCGGACGCCAATTTGGAGGCTGGGAACGTGAAGGAAACCAGAGCCAGTCGGGCCAAGAGAAGAGGCGGTGGAGGACACGACGCGCTTAAAGGACCCAATGTCTGTGGATCACGTTATAATGCTTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACT ~ 20.000 genesGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTACACAGCTCTGACAAACGGGCGCTGCTCTAACCAGCTGCCACAGTCCATAACCAAAATGCAGTGCTGCTGTGATGCCGGCCGATGCTGGTCTCCAGGGGTCACTGTCGCCCCTGAGATGTGTCCCATCAGAGCAACCGAGGATTTCAACAAGCTGTGCTCTGTTCCTATGGTAATTCCTGGGAGACCAGAATATCCTCCCCCACCCCTTGGCCCCATTCCTCCAGTTCTCCCTGTTCCTCCTGGCTTTCCTCCTGGACCTCAAATTCCGGTCCCTCGACCACCAGTGGAATATCTGTATCCATCTCGGGAGCCACCAAGGGTGCTGCCAGTATTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAAACGTTACTGATTACTGCCAGTTGGTCCGCTATCTCTGTCAAAATGGACGCTGCATTCCAACTCCTGGGAGTTACCGGTGTGAGTGCAACAAAGGGTTCCAGCTGGACCTCCGTGGGGAGTGTATTGATGTTGATGAATGTGAGAAAAACCCCTGTGCTGGTGGTGAGTGTATTAACAACCAGGGTTCGTACACCTGTCAGTGCCGAGCTGGATATCAGAGCACACTCACGCGGACAGAATGCCGAGACATTGATGAGTGTTTGAATGAATGTGAGACTCCTGGAATCTGTGGTCCAGGGACATGTTACAACACCGTTGGCAACTACACCTGTATCTGTCCTCCAGACTACATGCAAGTGAATGGGGGAAATAATTGCATGGATATGAGAAGAAGTTTGTGCTACAGAAACTACTATGCTGACAACCAGACCTGTGATGGAGAATTGTTATTCAACATGACCAAGAAGATGTGCTGCTGTTCCTACAACATTGGCCGGGCGTGGAACAAGCCCTGTGAACAGTGTCCCATCCCAAGTACAGATGAGTTTGCTACACTCTGTGGAAGTCAAAGGCCAGGCT
  6. 6. BLIENTEEDBTGENEAICALLYENGINEEREDCROPTBEGINAOENAERAHEFOODCHAINEUROPERESOVOSIODEDACEOARALCADAMEOFPGAERAPESMAINTAHOLDOUAAGAINTAWHAAECOWARRIORTCALLFRANKENTAEINFOODTBYJBMETWBLTHBNDHEGAEEIAFORHITOPINIONAHAAWHOEEERÇOULDMAKEAWOEARTOFCORNORAWOBLADETOFGRATTAOGROWUPONATPOAOFGROUNDWHEREONLYONEGREADICIONETRÊSXICARASDEAÇÚCARENEIGTWHBEAAEROFMANKINDANDDOMOREETTENAIALTEREICEAOHITCOUNARYAHANAHEWHOLERLIAICIANTPUAAOGEAHERGULLIEERTARAEELTEOYAGEAOBROBDINGNAGHEHADBEHAYEARTUPONAPROJECAFOREXARACAINGTUNBEAMTOUADICIONEASDUASGEMASAMASSAAOFCICHWEREAOBEPUAINLTEEHIAOEIALTHERMEAICALLYTEALEDANDLEAOUAAOWARMAHEAIRINRAWINCLEMENATUMMERTGULLIEERTARAEELTEOYAGEANAIMETOMEUCUMBEROLAPUAAJONAAHANTWIFAWOULDHAEEBEENRIGHAAAHOMEINWAALINGAONONEREÇENATAAURDCOLOQUEDOISTABLETESDEMANTEIGAEMUMAVASILHAAYAHEGREBATBAIRITATBMBIEBLENCEBBOUAAHETCIENCEOFHITOWYEBRTBGOWBTEIEIDLYONDITPLBYBROUNDBPBACHOFOIDRBPEINAHEOXFORDTREAOWNBBOUARTKMWETAOFLONDONINFULLEIEWOFTOMEAWODOZENABATAAMANTEIGAJUNTOCOMOAÇUCARATÉFORMAREMUMAMASSAHBMETEBLLEYPOLICEOFFICERTBNUMBERBHDAORHEOFPOLICEEBNTBNDELICOPAERHOEERINGOEERHEBDFIEEWOMENECOWBRRIORTOUAFIAAEDTOMEWHBALIKEDBRAHEBDERTTAORMAROOPERTINEBDEDAHITENGLITHGREENERYBNEUPNEBRLYOFAPLBNATTAILLWEBRI
  7. 7. BLIENTEEDBTGENEAICALLYENGINEEREDCROPTBEGINAOENAERAHEFOODCHAINEUROPERESOVOSIODEDACEOARALCADAMEOFPGAERAPESMAINTAHOLDOUAAGAINTAWHAAECOWARRIORTCALLFRANKENTAEINFOODTBYJBMETWBLTHBNDHEGAEEIAFORHITOPINIONAHAAWHOEEERÇOULDMAKEAWOEARTOFCORNORAWOBLADETOFGRATTAOGROWUPONATPOAOFGROUNDWHEREONLYONEGREADICIONETRÊSXICARASDEAÇÚCARENEIGTWHBEAAEROFMANKINDANDDOMOREETTENAIALTEREICEAOHITCOUNARYAHANAHEWHOLERLIAICIANTPUAAOGEAHERGULLIEERTARAEELTEOYAGEAOBROBDINGNAGHEHADBEHAYEARTUPONAPROJECAFOREXARACAINGTUNBEAMTOUADICIONEASDUASGEMASAMASSAAOFCICHWEREAOBEPUAINLTEEHIAOEIALTHERMEAICALLYTEALEDANDLEAOUAAOWARMAHEAIRINRAWINCLEMENATUMMERTGULLIEERTARAEELTEOYAGEANAIMETOMEUCUMBEROLAPUAAJONAAHANTWIFAWOULDHAEEBEENRIGHAAAHOMEINWAALINGAONONEREÇENATAAURDCOLOQUEDOISTABLETESDEMANTEIGAEMUMAVASILHAAYAHEGREBATBAIRITATBMBIEBLENCEBBOUAAHETCIENCEOFHITOWYEBRTBGOWBTEIEIDLYONDITPLBYBROUNDBPBACHOFOIDRBPEINAHEOXFORDTREAOWNBBOUARTKMWETAOFLONDONINFULLEIEWOFTOMEAWODOZENABATAAMANTEIGAJUNTOCOMOAÇUCARATÉFORMAREMUMAMASSAHBMETEBLLEYPOLICEOFFICERTBNUMBERBHDAORHEOFPOLICEEBNTBNDELICOPAERHOEERINGOEERHEBDFIEEWOMENECOWBRRIORTOUAFIAAEDTOMEWHBALIKEDBRAHEBDERTTAORMAROOPERTINEBDEDAHITENGLITHGREENERYBNEUPNEBRLYOFAPLBNATTAILLWEBRI
  8. 8. BLIENTEEDBTGENEAICALLYENGINEEREDCROPTBEGINAOENAERAHEFOODCHAINEUROPERESOVOSIODEDACEOARALCADAMEOFPGAERAPESMAINTAHOLDOUAAGAINTAWHAAECOWARRIORTCALLFRANKENTAEINFOODTBYJBMETWBLTHBNDHEGAEEIAFORHITOPINIONAHAAWHOEEERÇOULDMAKEAWOEARTOFCORNORAWOBLADETOFGRATTAOGROWUPONATPOAOFGROUNDWHEREONLYONEGREADICIONETRÊSXICARASDEAÇÚCARENEIGTWHBEAAEROFMANKINDANDDOMOREETTENAIALTEREICEAOHITCOUNARYAHANAHEWHOLERLIAICIANTPUAAOGEAHERGULLIEERTARAEELTEOYAGEAOBROBDINGNAGHEHADBEHAYEARTUPONAPROJECAFOREXARACAINGTUNBEAMTOUADICIONEASDUASGEMASAMASSAAOFCICHWEREAOBEPUAINLTEEHIAOEIALTHERMEAICALLYTEALEDANDLEAOUAAOWARMAHEAIRINRAWINCLEMENATUMMERTGULLIEERTARAEELTEOYAGEANAIMETOMEUCUMBEROLAPUAAJONAAHANTWIFAWOULDHAEEBEENRIGHAAAHOMEINWAALINGAONONEREÇENATAAURDCOLOQUEDOISTABLETESDEMANTEIGAEMUMAVASILHAAYAHEGREBATBAIRITATBMBIEBLENCEBBOUAAHETCIENCEOFHITOWYEBRTBGOWBTEIEIDLYONDITPLBYBROUNDBPBACHOFOIDRBPEINAHEOXFORDTREAOWNBBOUARTKMWETAOFLONDONINFULLEIEWOFTOMEAWODOZENABATAAMANTEIGAJUNTOCOMOAÇUCARATÉFORMAREMUMAMASSAHBMETEBLLEYPOLICEOFFICERTBNUMBERBHDAORHEOFPOLICEEBNTBNDELICOPAERHOEERINGOEERHEBDFIEEWOMENECOWBRRIORTOUAFIAAEDTOMEWHBALIKEDBRAHEBDERTTAORMAROOPERTINEBDEDAHITENGLITHGREENERYBNEUPNEBRLYOFAPLBNATTAILLWEBRI
  9. 9. BLIENTEEDBTGENEAICALLYENGINEEREDCROPTBEGINAOENAERAHEFOODCHAINEUROPERESOVOSIODEDACEOARALCADAMEOFPGAERAPESMAINTAHOLDOUAAGAINTAWHAAECOWARRIORTCALLFRANKENTAEINFOODTBYJBMETWBLTHBNDHEGAEEIAFORHITOPINIONAHAAWHOEEERÇOULDMAKEAWOEARTOFCORNORAWOBLADETOFGRATTAOGROWUPONATPOAOFGRONEGREADICIHEREONONETRÊSLEMENATXICARASLDHAEEBEENRIGHAAAHDEAÇÚCARENEIGTWHBEAAEROFMANKINDANDDOMOREETTENAIALTEREICEAOHITCOUNARYAHANAHEWHOLERLIAICIANTPUAAOGEAHERGULLIEERTARAEELTEOYAGEAOBROBDINGADAPROJEICIOHEHADBEHANEASDUNDWLYOUASGRTUPONINGTUEMASACAFOREXMASSAANAGYEANBEAMTOUOFCICHWEREAOBEPUAINLTEEHIAARACAOEIALTHERMEAICALLYTEALEDANDLEAOUAAOWARMAHEAIRINRAWINCUMMERTGULLIEERTARAEELTEOYAGEANAIMETOMEUCUMBEROLAPUAAJONAAHANTWIFAWOUOMEINWAALINGAONONEREÇENATAAURDCOLOQUEDAHETCIENCEOISTABLBOUAOFHETESDEMANTEIGAEMUMABITOWVASILHAAYAHEGREBATBAIRITATBMBIEBLENCEYEBRTBGOWBTEIEIDLYONDITPLBYBROUNDBPBACHOFOIDRBPEINAHEOXFORDTREAOWNBBOUARTKMWETAOFLONDONINFULLEIEWOFTOMEAWODOZENABATAAMAENECOWBRRIORTNTEILICEOFFICERTBNUGAJUNTOCOMOAÇUCARATÉFORINEBDEMAREMUMAEYPOMBMASSAHBMETEBLLERBHDAORHEOFPOLICEEBNTBNDELICOPAERHOEERINGOEERHEBDFIEEWOMOUAFIAAEDTOMEWHBALIKEDBRAHEBDERTTAORMAROOPERTDAHITENGLITHGREENERYBNEUPNEBRLYOFAPLBNATTAILLWEBRI
  10. 10. ESTRUTURA DE UM GENE INÍCIO DA EXONS TRANSCRIÇÃO SEQUÊNCIAS CODIFICADORAS CODON FINALIZADOR5´ 3´ PROMOTOR CODON SINAL DE INICIADOR REGIÃO 3´ POLIADENILAÇÃO REGIÃO 5´ INTRONS NÃO NÃO SEQUÊNCIAS INTERCALARES TRADUZIDA TRADUZIDA
  11. 11. TRANSCRIÇÃO mRNA AAAAAA AAUAAA gt ag gt ag5´ 3´ UAG CAP UAA protege o RNA AUG UGA contra a degradação 5´ AAAAAA 3´ METIONINA PARADA
  12. 12. CONSEQÜÊNCIAS MOLECULARES DAS MUTAÇÕES
  13. 13. Gene “A” : A ou a “normal” ou “mutado”
  14. 14. Gene “A” : A ou a “normal” ou “mutado” A2 AGene “A” : A1 ALELOS do gene “A” A3 A5 a A4
  15. 15. FIGURA 4 - ALELOS e SNPs a2 a5 a1 ALELOS do gene “A” Gene “A” : a3 a6 a a4Gene “A” : ...ATTGGCACG...TGCATTAGCA.....ACTTGCATAGC..... a ...ATTGGCACG...TGCATTAGCA.....AGTTGCATAGC..... a5 ...ATCGGCACG...TGCATTAGCA.....ACTTGCATAGC..... a4 ...ATTGGCACG...TGCTTTAGCA.....ACTTGCATAGC..... a2 ...ATTGGCACG...TGCATTAGCA.....ACTTGAATAGC..... SNPs
  16. 16. Doença ou Saúde? Seqüência do DNA Proteína normal Variações no DNAIndivíduo 1 AAAT T T sem efeitos deletériosIndivíduo 2 AAT T T T Proteína não-funcional ou ausenteIndivíduo 3 AAC T T T Variações no DNA que levam a doenças ou a maior susceptibilidade a doenças
  17. 17. MUTAÇÕESNORMAL SUBSTITUIÇÃOC A T T C A C C T G C A T G C A C C T GG T A A G T G G A C G T A C G T G G A CDELEÇÃO INSERÇÃOC A T C A C C T G C A T A T C A C C TG T A G T G G A C G T A T A G T G G A
  18. 18. ANEMIA FALCIFORMENOS AFETADOS: Hb S fenótipo aparece nos primeiros anos de vida molécula de Hb: com 2 cadeias a e 2 cadeias b mutantes. Causa anemia hemoliticamutação Val 6 Ac.glutfreqüência: 1/650 popl. negra
  19. 19. SUBSTITUIÇÕES DE AMINOÁCIDOSDe sentido trocado - missense substituição de aa ANEMIA FALCIFORME HbA: HbA: CAG - GTG - AAT - TGG - GGC - CTC - CTT- TTC ... CTT- HbS: HbS: CAG - GTG - AAT - TGG - GGC - CAC - CTT- TTC ... CTT- HbA: HbA: GUC - CAC - UUA - ACC - CCG - GAG - GAA- AAG ... GAA- HbS: HbS: GUC - CAC - UUA - ACC - CCG - GUG - GAA- AAG ... GAA- HbA: Val-His-Leu-Thr-Pro-Glu-Glu- HbA: Val -His-Leu-Thr-Pro-Glu-Glu-Lys ... HbS: Val-His-Leu-Thr-Pro-Val- Glu- HbS: Val -His-Leu-Thr-Pro-Val- Glu-Lys ...
  20. 20. SUBSTITUIÇÕES DE AMINOÁCIDOSSem sentido - non sense ... ... CGG CUA GUA CAA GAG ... ... ... Arg Leu Val Gln Glu ... ... ... CGG CUA GUA UAA GAG ... ... ... Arg Leu Val StopEfeito: • Proteína truncada (viabilidade variável) • mRNA instável
  21. 21. NORMAL DMD DMB
  22. 22. DELEÇÕES e INSERÇÕES• efeito depende do quanto elas geram uma ruptura do quadro de leitura (nucleotídeos múltiplos de 3)• exemplo de DMD/BMD DNA: TTC CGG TCC TCG GCT CTT PROTEINA: Phe Arg Trp Ser Ala Leu DMD: TTC CGG TCC TCG GCT CTT PROTEINA: Phe ......Stop codon DMB: TTC CGG TCC TCG GCT CTT PROTEINA: Phe Ser Ala Leu
  23. 23. NORMAL DMD DMB
  24. 24. CLASSIFICAÇÃO DAS MUTAÇÕES •PERDA DE FUNÇÃO • GERALMENTE AR • EFEITO DE DOSAGEM • HAPLOINSUFICIÊNCIA • DOMINANTE NEGATIVO •GANHO DE FUNÇÃO • PRODUTO NOVO • HIPEREXPRESSÃO •TIPO DE ALTERAÇÕES • QUANTITATIVAS • QUALITATIVAS
  25. 25. •PERDA DE FUNÇÃO • GERALMENTE AR • EFEITO DE DOSAGEM • 50% do produto é suficiente para o heterozigoto AD•Haploinsuficiencia: 50% não é suficiente•Dominante negativo: molécula alterada atrapalha anormal
  26. 26. PERDA DE FUNÇÃO - POR FENÓTIPO DOMINANTE HAPLOINSUFICIÊNCIA• Redução para 50% do produto gênico não ésuficiente para a função.•Leva a alterações fenotípicas•em homozigose, geralmente muito maisgrave Hipercolestorolemia - gene receptor LDL
  27. 27. HIPERCOLESTEROLEMIA FAMILIAR CARACTERÍSTICAS CLÍNICAS:HETEROZIGOTOS: NÍVEL ELEVADO DE LIPOPROTEÍNA DE Associação BAIXA DENSIDADE (LDL) NO PLASMA, DEPÓSITO DE COLESTEROL NOS TENDÕES E PELE (XANTOMAS) E ARTÉRIAS NA IDADE ADULTA, DOENÇA DAS ARTÉRIAS síntese CORONÁRIAS NO INÍCIO DA MEIA-IDADE transporte acúmuloHOMOZIGOTOS: MANIFESTAÇÕES CLÍNICAS MAIS CEDO, DOENÇA DAS ARTÉRIAS CORONÁRIAS GERALMENTE FATAL NA INFÂNCIA.INCIDÊNCIA: HETEROZIGOTO: 1/500 HOMOZIGOTO: 1/1000000 reciclagemGENÉTICA:  LOCALIZAÇÃO DO GENE EM 19p13  AUTOSSÔMICA DOMINANTE MÚLTIPLOS ALELOS MUTANTES  MUTAÇÕES NO GENE QUE CODIFICA O RECEPTOR DA LDL IMPORTÂNCIA: UMA DAS DOENÇAS GENÉTICAS MAIS COMUNS E IMPORTANTE CAUSA DE DOENÇAS DAS ARTÉRIAS CORONÁRIAS.
  28. 28. EFEITO DOMINANTE NEGATIVO•O produto alterado não somenteperde a sua função, como tambémimpede o produto normal de funcionarno heterozigoto•Proteínas que formam dímeros oumultímeros
  29. 29. SINDROME DE MARFAN DOENÇA DO TECIDO CONJUNTIVO  CARACTERÍSTICAS CLÍNICAS ESTATURA ELEVADA, ESCOLIOSE, DOLICOSTGENOMALIA, ARACNODACTILIA E DEFORMIDADES TORÁCICAS, alterações cardiovasculares  Mutações no gene da FIBRILINA proteína importante na formação das microfibrilas tecido conjuntivo excessivamente elástico Efeito dominante negativo
  30. 30. PERDA DE FUNÇAO OSTEOGENESE IMPERFEITA TIPO III e IVMUTAÇÃO SEM SENTIDO EXPRESSÃO SEM EXPRESSÃO n cadeias a1 n cadeias a2 a1 a2 a1 n/2 moléculas de pró-colageno n/2 cadéias a2 (degradadas)
  31. 31. EFEITO DOMINANTE NEGATIVOMUTAÇÃO LEVE EXPRESSÃOEXPRESSÃO ANORMAL n cadeias a1 normais n cadeias a2 n cadeias a1 mutadas a1 a2 a1 n/4 moléculas de pró-colageno a1 a2 a1 a1 a2 a1 a1 a2 a1 3n/4 moléculas de pró-colageno alteradas
  32. 32. ESTRUTURA EFUNCIONAMENTO DOS GENES
  33. 33. DNA - BASES NITROGENADAS
  34. 34. ORGANIZAÇÃODO DNA
  35. 35. CROMATINA COMPLEXO FORMADO PELAORGANIZAÇÃO DO DNA E DAS PROTEÍNAS
  36. 36. DUPLICAÇÃO DO DNA SEMI-CONSERVATIVAT A T A T AA T A T A TG C G C G CC G C G C GT A T A T AA T A T A TC G C G C GG C G C G C
  37. 37. TRANSCRIÇÃO5’ 3’ C A T T C A C C T C G A T G C A C C T G G T A A G T G G A G C T A C G T G G A C 3’ 5’5’C A U U C A C C U C G mRNAG T A A G T G G A G C T A C G T G G A C3’ 5’
  38. 38. TRADUÇÃO tRNA Val Ser Gly Thr Trp AlaG T A A G T G G A G C T A C G T G G A CC A U U C A C C U C G A U G C A C C U G5’ 3’ Val Ser Gly Thr Trp Proteína Ala
  39. 39. CÓDIGO GENÉTICO
  40. 40. ESTUDO DIRIGIDO 5. Num eucarionte, o RNA, produto imediato da transcrição, tem a mesma seqüência de bases que o RNAm encontrado no citoplasma e que serve de molde para a síntese protéica? Explique. AAAAAA AAUAAA gt ag gt ag5´ 3´ 5´ AAAAAA 3´
  41. 41. ESTUDO DIRIGIDO 3. Qual o papel do RNAm, do RNAt e do RNAr na síntese de proteínas?Mensageiro (mRNA): Especifica a seqüência de aminoácidos da cadeia polipeptídica.Transportador Transporta os aminoácidos até o ribossomo, ligando se através dos anti-codons ao mRNA.Ribossômico Associado a proteínas, forma os ribossomos.
  42. 42. ESTUDO DIRIGIDO4. A hemoglobina A (normal) difere da hemoglobina S (siclêmica) em um único aminoácido dentre os 146 de suas cadeias beta: HbA: Val-His-Leu-Thr-Pro-Glu-Glu-Lys ... HbS: Val-His-Leu-Thr-Pro-Val-Glu-Lys ...a) Escreva uma seqüência de bases que corresponda a esses aminoácidos (a) no RNAm, no RNAt e (b) no DNA.b) Que alteração na seqüência de bases do DNA é responsável pela codificação da HbS?c) Se o sexto nucleotídio fosse eliminado na seqüência, que aminoácidos você teria na cadeia polipeptídica?
  43. 43. ESTUDO DIRIGIDO HbA: Val-His-Leu-Thr-Pro-Glu-Glu-Lys ... HbS: Val-His-Leu-Thr-Pro-Val-Glu-Lys ...RNAm HbA: GUC - CAC - UUA - ACC - CCG - GAG - GAA- AAG ... HbS: GUC - CAC - UUA - ACC - CCG - GUG - GAA- AAG ...RNAt CAG - GUG - AAU - UGG - GGC - CUC - CUU- UUC ... CAG - GUG - AAU - UGG - GGC - CAC - CUU- UUC ...DNA. HbA: CAG - GTG - AAT - TGG - GGC - CTC - CTT- TTC ... HbS: CAG - GTG - AAT - TGG - GGC - CAC - CTT- TTC ...
  44. 44. ESTUDO DIRIGIDO b) Que alteração na seqüência de bases do DNA é responsável pela codificação da HbS?HbA: CAG - GTG - AAT - TGG - GGC - CTC - CTT- TTC ...HbS: CAG - GTG - AAT - TGG - GGC - CAC - CTT- TTC ...
  45. 45. ESTUDO DIRIGIDOc) Se o sexto nucleotídio fosse eliminado na seqüência,que aminoácidos você teria na cadeia polipeptídica? Val His Leu Thr Pro Glu Glu Lys GUC - CAC - UUA - ACC - CCG - GAG - GAA- AAG ... HbA: CAG - GTG - AAT - TGG - GGC - CTC - CTT- TTC ...
  46. 46. ESTUDO DIRIGIDOc) Se o sexto nucleotídio fosse eliminado na seqüência,que aminoácidos você teria na cadeia polipeptídica? Val His Leu Thr Pro Glu Glu Lys HbA: CAG - GTG - AAT - TGG - GGC - CTC - CTT- TTC ... Hb?: CAG - GTX - AAT - TGG - GGC - CTC - CTT- TTC ...
  47. 47. ESTUDO DIRIGIDOc) Se o sexto nucleotídio fosse eliminado na seqüência,que aminoácidos você teria na cadeia polipeptídica? Val His Leu Thr Pro Glu Glu Lys HbA: CAG - GTG - AAT - TGG - GGC - CTC - CTT- TTC ... Hb?: CAG - GTX - AAT - TGG - GGC - CTC - CTT- TTC ... DNA CAG - GTA ATT GGG GCC TCC TTT TC ...
  48. 48. ESTUDO DIRIGIDOc) Se o sexto nucleotídio fosse eliminado na seqüência,que aminoácidos você teria na cadeia polipeptídica? Val His Leu Thr Pro Glu Glu Lys HbA: CAG - GTG - AAT - TGG - GGC - CTC - CTT- TTC ... Hb?: CAG - GTX - AAT - TGG - GGC - CTC - CTT- TTC ... DNA CAG - GTA ATT GGG GCC TCC TTT TC ... mRNA GUC CAU UAA CCC CGG AGG UUU
  49. 49. ESTUDO DIRIGIDOc) Se o sexto nucleotídio fosse eliminado na seqüência,que aminoácidos você teria na cadeia polipeptídica? Val His Leu Thr Pro Glu Glu Lys HbA: CAG - GTG - AAT - TGG - GGC - CTC - CTT- TTC ... Hb?: CAG - GTX - AAT - TGG - GGC - CTC - CTT- TTC ... DNA CAG - GTA ATT GGG GCC TCC TTT TC ... mRNA GUC CAU UAA CCC CGG AGG UUU Val His PARE
  50. 50. ESTUDO DIRIGIDO No nanismo causado por deficiência do hormônio de crescimento (IGDH), o gene responsável pela síntese de hormônio de crescimento (GH) está alterado:a-) Algumas mutações alteram a proteína (GH) de tal modo que ela não é secretada pela célula. O indivíduo heterozigoto quanto essas mutações tem estatura normal Perda de função Efeito de dose Autossômica recessiva
  51. 51. ESTUDO DIRIGIDO No nanismo causado por deficiência do hormônio de crescimento (IGDH), o gene responsável pela síntese de hormônio de crescimento (GH) está alterado:b-) Outras mutações alteram a proteína, mas ela ainda vai para os grânulos secretores da célula, onde se liga ao produto do gene normal, inativando a proteína normal. Os indivíduos heterozigotos quanto a essa mutação apresentam nanismo Efeito dominante negativo Autossômica dominante
  52. 52. ESTUDO DIRIGIDOB- A hipercolesterolemia familial (níveis elevados de colesterol que causam aterosclerose acelerada) decorre de mutação no gene que produz o receptor de LDL (lipoproteína de baixa densidade, responsável pelo transporte do colesterol para dentro da células). Os genes mutados não produzem o receptor ou produzem um receptor alterado que não se liga à LDL. O indivíduo heterozigoto tem o número de receptores efetivos reduzido à metade, mas apresenta a doença. Haploinsuficiência Perda de função Autossômica dominante
  53. 53. ESTUDO DIRIGIDO2. Qual a estrutura da hemoglobina normal do adulto? TETRÂMERO: a2b2Que genes são responsáveis por sua síntese? genes das cadeias tipoa 16p13.11-13.33 30.000 pb subunidades:  e a genes das cadeias tipo b 11p15.5 - 50.000 pb subunidades: , G, A, , b
  54. 54. ESTUDO DIRIGIDO3-) Qual a alteração do DNA que causa a anemiafalciforme? Causada por uma única mutação: de sentido trocado: acido glut 6 valina gene da b-globina em homozigose, altera a molécula de tal forma que os eritrócitos passam a ter forma de foice sob condições de baixa tensão de oxigênio
  55. 55. ESTUDO DIRIGIDO4-)a) O que são talassemias: Anemias causadas por mutações que levam a quantidades reduzidas das sub-unidades a ou b-globinasb) Diferencie molecularmente as a e b-talassemias a-talassemias - maioria : deleções b-talassemias - maioria : mutações sem sentido, de sentido trocado, sítios de splice

×