SlideShare a Scribd company logo
1 of 84
DNA analysis on your laptop:
Spot the differences
Tech Tuesday
11 October 2016
Barbera van Schaik
b.d.vanschaik@amc.uva.nl
Things I like
● During the day I'm a bioinformatician
● In my spare time I ...
– Go to concerts and festivals
– Cook (all cuisines)
– Read (fantasy, popular science/philosophy,
Dutch literature)
– Make things (sewing, electronics, laser
cutting, welding, 3d printing)
– Look into self-hosted cloud services
– Grow vegetables in my garden
Overview
What is bioinformatics
DNA basics
DNA sequencing
(Large) DNA projects
Public databases
DNA sequence analysis
Your own DNA
What is Bioinformatics?
Extraction of biological knowledge from complex data
How does molecule A interact with protein B?
A schematic visual model of oxygen-binding process, showing all four 
monomersand hemes, and protein chains only as diagramatic coils, to
facilitate visualization into the molecule. (
http://en.wikipedia.org/wiki/Hemoglobin)
What is bioinformatics?
Image: BII
Understand biological systems
Find interesting bits in
(heaps of) complex data
Computer simulations/models
to understand what happens
Bioinformatics tools
... one of the results *might* be a tool you can use
Image: CSI game
It never looks like this though
Image: Oblivion (Universal Pictures)
Or this
Image: Prometheus (Scott Free Productions)
Usually it looks more like this
DNA
https://en.wikipedia.org/wiki/DNA
DNA
ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC
Differences between species
Differences between people
https://www.broadinstitute.org/news/106
Less than 1 percent
Mutations as we age
https://en.wikipedia.org/wiki/Jeanne_Calment
Mutations caused by environment
How mutations occur
SNP/mutation/variant
ACATTTGCTTCT
ACATCTGCTTCT
Insertion
ACAT­TTGCTTCT
ACATATTGCTTCT
Deletion
ACATTTGCTTCT
ACAT­TGCTTCT
Labsession: Compare two DNA sequences
The game:
Place as many matching letters
as possible opposite each other
Introduce mutations, insertions
and deletions
Scoring scheme:
- Matching letters: +2
- Mismatching letters: -1
- Insertion or deletion: -1
Sum all matching letters,
mutations and indels
Get the maximum score
DNA sequencing
Examples
Detect viral DNA or RNA
Which gene(s) causes disease X?
Study migration
http://www.nature.com/nrg/journal/v16/n9/fig_tab/nrg3966_F5.html
Study ancient DNA
Metagenomics and microbial
diversity
Study genomic content in a
complex mixture of microorganisms
(bacteria or viruses in some
environment)
Identify new species
Plant genomes
DNA sequencing
Technique
https://en.wikipedia.org/wiki/DNA_sequencing
DNA structure
1953: Watson and Crick
Franklin
Wilkins
Manual DNA sequencing
1977: Sanger sequencing
Automated DNA sequencing
~400 sequences per run
Scale-up by using many
DNA sequencers in parallel
Sequence center at Whitehead institute
Next generation sequencing
Run: 24 hrs
Data: 0.7 GB
Run: 7-14 days
Data: 120 GB
Run: 3-10 days
Data: 600 GB
2005-now: Next generation sequencing
Millions to billions of sequences
DNA sequencing
Human genome projects
Human Genome Project
http://web.ornl.gov/sci/techresources/Human_Genome/index.shtml
Human Genome Project
http://web.ornl.gov/sci/techresources/Human_Genome/index.shtml
1000 genomes project
http://www.1000genomes.org/
Genome of the Netherlands
http://www.nlgenome.nl/
4000 genomes
6000 exomes
http://www.uk10.org/
The 100K genomes project
The project will focus on
patients with a rare disease and
their families and patients with
cancer. The first samples for
sequencing are being taken
from patients living in England
with discussions taking place
with Scotland, Wales and
Northern Ireland about
potential future involvement.
http://www.genomicsengland.co.uk/
Personal genomes
100,000 genomes plus medical records
http://www.personalgenomes.org/
Genome projectsGenome projects
• Human genome project (1 individual)
• Exome sequencing (~10 individuals)
• Genome of the Netherlands (770 individuals)
• 1000 genome project (1000 individuals)
• 10K UK project (10,000 individuals)
– Upgraded to 100,000 genomes
• Personal genomes project
… many centers have one or more high throughput
sequencers
http://omicsmaps.com/ Sign @ Wellcome-Sanger, Cambridge, UK
Data size challenges
COMPUTING
Sequencing rate is higher
than Moore's law
STORAGE
Sequencing costs lower
than data storage
Stein, Genome Biology, 2010Hayden, Nature, 2014
Analysis on PCs and small servers
Cluster and/or Cloud
Databases
Publicly available biological databases
Nucleotide sequence databases
● International
Nucleotide
Sequence
Database
Collaboration
● Daily exchange of
sequence data
https://www.ncbi.nlm.nih.gov/
https://www.ebi.ac.uk/
http://www.ddbj.nig.ac.jp/
Nucleotide sequence databases
Image: http://www.davelunt.net/
GenBank
Release 200.0 (12 Feb 2014)
has 171,123,749 non-WGS, non-CON records containing
157,943,793,171 base pairs of sequence data. In addition, there are
139,725,795 WGS records containing 591,378,698,544 base pairs of
sequence data.
For downloading purposes, please keep in mind that the GenBank
flatfiles are approximately 625 GB (sequence files only). The ASN.1 data
are approximately 522 GB. https://www.ncbi.nlm.nih.gov/genbank/statistics/
Labsession: databases
● Go to: https://www.ncbi.nlm.nih.gov/genbank/
● Search for: NM_000518
● Take the first link, click on “fasta”
● Copy/paste the record in notepad or word
– >blah and the sequence
– Store it on your desktop as HBB.txt
● Do the same for: M25113
– Store this as sickle.txt
DNA sequence analysis
DNA sequence comparison
Function prediction (similarity, sequence search)
Conservation (motifs, functional blocks)
Localisation (gene finding)
Grouping (genes, protein families)
SNPs and mutations (variations)
DNA sequence comparison
Pairwise alignment: in-exact matching of 2 sequences
Multiple sequence alignment: in-exact matching
of >2 sequences
Database search with DNA sequence
Blast output - alignments
Labsession: sequence alignment (1)
● Go to: https://blast.ncbi.nlm.nih.gov/
● Choose “Nucleotide Blast”
● Tick the box “Align two or more sequences”
● Copy/paste the HBB.txt sequence in the
first box, and the sickle.txt sequence in the
second box
● Scroll down and click “BLAST”
● Can you spot the differences between the
healthy and ill person?
Labsession: sequence alignment (2)
● Go to: https://blast.ncbi.nlm.nih.gov/
● Choose “Nucleotide Blast”
● Copy/paste the 'unknown' sequence in the box
– Sequence on meetup page
● Scroll down and click “BLAST”
Variation between people
Variation between people
Disease causing variants
Structural variation
● Not just mutations, insertions and deletions
● Larger 'blocks' of DNA differ
http://www.nature.com/nmeth/journal/v9/n2/full/nmeth.1858.html
How to determine variants
Extract DNA
& amplify to get enough
for measurement
Sequence the DNA
Map DNA fragments on human reference genome
Determine variants compared to reference genome
1
2
3
4
What could possibly
go wrong?
● Errors during the amplification step
● Errors during the DNA sequencing process
● Errors during mapping of the DNA
fragments to the reference genome
● Low genome coverage
● Reference genome not complete
● Etc, etc
Have your own DNA sequenced
● http://isogg.org/wiki/List_of_personal_genomics_
– Whole genome: $1799-$5000
– Whole exome (the protein coding part of
the genome): $850-$1000
– Mitochondrial DNA or Y-chromosome
– Only variants: ~$200
.. and then compare it with other data
● HapMap
● 1000 genomes and other genome projects
● Known (disease) variants
● Other animals
● Family members
Labsession: what do your variants
tell about you?
● 23andme dataset as example
● Geographic location
● Neanderthal DNA
● Disease risks
Before you continue...
Try everything with
a public dataset first!
Why?
1) First have an outsiders look on the data
2) Verify what will happen with your data
when you send it to some website
Explore public data
● https://my.pgp-hms.org/
– Public data > Whole genome sequences
and other data
– Data type: 23andme (dropdown menu)
– Download one of the datasets
– Unzip the file
More about this project:
http://personalgenomes.org/
Selection of DNA tools
● Interpretome
– http://esquilax.stanford.edu/
– Ancestry: PCA and Painting
● Promethease
– http://snpedia.com/index.php/Promethease
– Sample report: 23andme v4 (2014)
● Codegen
– https://codegen.eu/
– Try the demo
More tools
● http://www.23andyou.com/3rdparty
● http://isogg.org/wiki/Autosomal_DNA_tools
Your DNA
● What does 'risk' mean?
– It is a risk (most of the time), not (always) a
definitive destination
– Consult a doctor
● What is genetic, what is caused by environment?
● How accurate is the underlying data?
Your DNA
● Sequencing is affordable
● Please remember: it is identifiable data!
Overview
What is bioinformatics
DNA basics
DNA sequencing
(Large) DNA projects
Public databases
DNA sequence analysis
Your own DNA
TED talk tips
● Svante Paabo – DNA clues to our inner Neanderthal
– https://www.ted.com/talks/svante_paeaebo_dna_clues_to_our_inner_neanderthal
● Sebastian Kraves – The era of personal DNA testing is here
– https://www.ted.com/talks/sebastian_kraves_the_era_of_personal_dna_testing_is_here
● Jennifer Doudna – We can now edit our DNA, but let's do it wisely
– https://www.ted.com/talks/jennifer_doudna_we_can_now_edit_our_dna_but_let_s_do_
● Ellen Jorgensen – What you need to know about CRISPR
– https://www.ted.com/talks/ellen_jorgensen_what_you_need_to_know_about_crispr
● Juan Enriquez – We can reprogram life. How to do it wisely
– https://www.ted.com/talks/juan_enriquez_we_can_reprogram_life_how_to_do_it_wisely
Follow up questions
● Hoe gerelateerd zijn sequenties?
● Tree of life (voorbeeld: road-trip Boston)
● Kanker
● Immunologie
● Mutating viruses
Roadtrip USA
Kosakovsky Pond S, Wadhawan S, Chiaromonte F, Ananda G,
Chung WY, Taylor J, Nekrutenko A; Galaxy Team (2009)
Windshield splatter analysis with the Galaxy metagenomic
pipeline. Genome Research, 19(11), 2144-2153.
Dodge caravan
Ductape on bumper
Route
Route
Laboratory
DNA sequencing
Phylogenetic tree
Which insects and other
species did they
encounter and how much
are they alike?
Phylogenetische boom
Count species
Citrobacter 668 212 0.317
Cronobacter 43 22 0.512
Dickeya 4 1 0.25
Enterobacter 4142 5507 1.33
Enterovibrio 3 1 0.333
Erwinia 2 240 120
Escherichia 811 299 0.369
Francisella 1 1 1
Haemophilus 3 1 0.333
Halomonas 10 4 0.4
Klebsiella 15121 1695 0.112
Kluyvera 14 1 0.071
Marinobacter 3 4 1.333
Bacterie Route A Route B Ratio: B/A
Counted the
amount of
species on bumper
for route A and B
Determined
the ratio of
each species
on route A
compared to route B

More Related Content

What's hot

02.databases slides
02.databases slides02.databases slides
02.databases slidesItsme148
 
How to be a bioinformatician
How to be a bioinformaticianHow to be a bioinformatician
How to be a bioinformaticianChristian Frech
 
Cool Informatics Tools and Services for Biomedical Research
Cool Informatics Tools and Services for Biomedical ResearchCool Informatics Tools and Services for Biomedical Research
Cool Informatics Tools and Services for Biomedical ResearchDavid Ruau
 
Opening up pharmacological space, the OPEN PHACTs api
Opening up pharmacological space, the OPEN PHACTs apiOpening up pharmacological space, the OPEN PHACTs api
Opening up pharmacological space, the OPEN PHACTs apiChris Evelo
 
2013 pag-equine-workshop
2013 pag-equine-workshop2013 pag-equine-workshop
2013 pag-equine-workshopc.titus.brown
 
Aug2015 Giab nist integration methods
Aug2015 Giab nist integration methodsAug2015 Giab nist integration methods
Aug2015 Giab nist integration methodsGenomeInABottle
 
Aug2015 Ali Bashir and Jason Chin Pac bio giab_assembly_summary_ali3
Aug2015 Ali Bashir and Jason Chin Pac bio giab_assembly_summary_ali3Aug2015 Ali Bashir and Jason Chin Pac bio giab_assembly_summary_ali3
Aug2015 Ali Bashir and Jason Chin Pac bio giab_assembly_summary_ali3GenomeInABottle
 
GIAB-GRC workshop oct2015 giab introduction 151005
GIAB-GRC workshop oct2015 giab introduction 151005GIAB-GRC workshop oct2015 giab introduction 151005
GIAB-GRC workshop oct2015 giab introduction 151005GenomeInABottle
 
Caporaso sloan qiime_workshop_slides_18_oct2012
Caporaso sloan qiime_workshop_slides_18_oct2012Caporaso sloan qiime_workshop_slides_18_oct2012
Caporaso sloan qiime_workshop_slides_18_oct2012gregcaporaso
 
2015 balti-and-bioinformatics
2015 balti-and-bioinformatics2015 balti-and-bioinformatics
2015 balti-and-bioinformaticsc.titus.brown
 
Metagenomic Data Provenance and Management using the ISA infrastructure --- o...
Metagenomic Data Provenance and Management using the ISA infrastructure --- o...Metagenomic Data Provenance and Management using the ISA infrastructure --- o...
Metagenomic Data Provenance and Management using the ISA infrastructure --- o...Alejandra Gonzalez-Beltran
 
NCBI Boot Camp for Beginners Slides
NCBI Boot Camp for Beginners SlidesNCBI Boot Camp for Beginners Slides
NCBI Boot Camp for Beginners SlidesJackie Wirz, PhD
 
So you want to do a: RNAseq experiment, Differential Gene Expression Analysis
So you want to do a: RNAseq experiment, Differential Gene Expression AnalysisSo you want to do a: RNAseq experiment, Differential Gene Expression Analysis
So you want to do a: RNAseq experiment, Differential Gene Expression AnalysisUniversity of California, Davis
 
Giab aug2015 intro and update 150821.pptx
Giab aug2015 intro and update 150821.pptxGiab aug2015 intro and update 150821.pptx
Giab aug2015 intro and update 150821.pptxGenomeInABottle
 
NGx Sequencing 101-platforms
NGx Sequencing 101-platformsNGx Sequencing 101-platforms
NGx Sequencing 101-platformsAllSeq
 

What's hot (20)

RNA-Seq with R-Bioconductor
RNA-Seq with R-BioconductorRNA-Seq with R-Bioconductor
RNA-Seq with R-Bioconductor
 
02.databases slides
02.databases slides02.databases slides
02.databases slides
 
How to be a bioinformatician
How to be a bioinformaticianHow to be a bioinformatician
How to be a bioinformatician
 
Cool Informatics Tools and Services for Biomedical Research
Cool Informatics Tools and Services for Biomedical ResearchCool Informatics Tools and Services for Biomedical Research
Cool Informatics Tools and Services for Biomedical Research
 
Opening up pharmacological space, the OPEN PHACTs api
Opening up pharmacological space, the OPEN PHACTs apiOpening up pharmacological space, the OPEN PHACTs api
Opening up pharmacological space, the OPEN PHACTs api
 
2013 pag-equine-workshop
2013 pag-equine-workshop2013 pag-equine-workshop
2013 pag-equine-workshop
 
Aug2015 Giab nist integration methods
Aug2015 Giab nist integration methodsAug2015 Giab nist integration methods
Aug2015 Giab nist integration methods
 
Aug2015 Ali Bashir and Jason Chin Pac bio giab_assembly_summary_ali3
Aug2015 Ali Bashir and Jason Chin Pac bio giab_assembly_summary_ali3Aug2015 Ali Bashir and Jason Chin Pac bio giab_assembly_summary_ali3
Aug2015 Ali Bashir and Jason Chin Pac bio giab_assembly_summary_ali3
 
GIAB-GRC workshop oct2015 giab introduction 151005
GIAB-GRC workshop oct2015 giab introduction 151005GIAB-GRC workshop oct2015 giab introduction 151005
GIAB-GRC workshop oct2015 giab introduction 151005
 
NETTAB 2013
NETTAB 2013NETTAB 2013
NETTAB 2013
 
Caporaso sloan qiime_workshop_slides_18_oct2012
Caporaso sloan qiime_workshop_slides_18_oct2012Caporaso sloan qiime_workshop_slides_18_oct2012
Caporaso sloan qiime_workshop_slides_18_oct2012
 
2015 balti-and-bioinformatics
2015 balti-and-bioinformatics2015 balti-and-bioinformatics
2015 balti-and-bioinformatics
 
Metagenomic Data Provenance and Management using the ISA infrastructure --- o...
Metagenomic Data Provenance and Management using the ISA infrastructure --- o...Metagenomic Data Provenance and Management using the ISA infrastructure --- o...
Metagenomic Data Provenance and Management using the ISA infrastructure --- o...
 
NCBI Boot Camp for Beginners Slides
NCBI Boot Camp for Beginners SlidesNCBI Boot Camp for Beginners Slides
NCBI Boot Camp for Beginners Slides
 
OpenTox Europe 2013
OpenTox Europe 2013OpenTox Europe 2013
OpenTox Europe 2013
 
So you want to do a: RNAseq experiment, Differential Gene Expression Analysis
So you want to do a: RNAseq experiment, Differential Gene Expression AnalysisSo you want to do a: RNAseq experiment, Differential Gene Expression Analysis
So you want to do a: RNAseq experiment, Differential Gene Expression Analysis
 
Sequence assembly
Sequence assemblySequence assembly
Sequence assembly
 
Giab aug2015 intro and update 150821.pptx
Giab aug2015 intro and update 150821.pptxGiab aug2015 intro and update 150821.pptx
Giab aug2015 intro and update 150821.pptx
 
NGx Sequencing 101-platforms
NGx Sequencing 101-platformsNGx Sequencing 101-platforms
NGx Sequencing 101-platforms
 
RML NCBI Resources
RML NCBI ResourcesRML NCBI Resources
RML NCBI Resources
 

Similar to DNA analysis on your laptop: Spot the differences

Personal Genomes: what can I do with my data?
Personal Genomes: what can I do with my data?Personal Genomes: what can I do with my data?
Personal Genomes: what can I do with my data?Melanie Swan
 
Introduction to Bioinformatics.
 Introduction to Bioinformatics. Introduction to Bioinformatics.
Introduction to Bioinformatics.Elena Sügis
 
Introduction to Gene Mining Part A: BLASTn-off!
Introduction to Gene Mining Part A: BLASTn-off!Introduction to Gene Mining Part A: BLASTn-off!
Introduction to Gene Mining Part A: BLASTn-off!adcobb
 
Introduction to bioinformatics
Introduction to bioinformaticsIntroduction to bioinformatics
Introduction to bioinformaticsphilmaweb
 
Data analysis & integration challenges in genomics
Data analysis & integration challenges in genomicsData analysis & integration challenges in genomics
Data analysis & integration challenges in genomicsmikaelhuss
 
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015Torsten Seemann
 
Quantitative Medicine Feb 2009
Quantitative Medicine Feb 2009Quantitative Medicine Feb 2009
Quantitative Medicine Feb 2009Ian Foster
 
Bioinformatics_1_ChenS.pptx
Bioinformatics_1_ChenS.pptxBioinformatics_1_ChenS.pptx
Bioinformatics_1_ChenS.pptxxRowlet
 
Data analytics challenges in genomics
Data analytics challenges in genomicsData analytics challenges in genomics
Data analytics challenges in genomicsmikaelhuss
 
Role of bioinformatics in life sciences research
Role of bioinformatics in life sciences researchRole of bioinformatics in life sciences research
Role of bioinformatics in life sciences researchAnshika Bansal
 
Genome sequencing and the development of our current information library
Genome sequencing and the development of our current information libraryGenome sequencing and the development of our current information library
Genome sequencing and the development of our current information libraryZarlishAttique1
 
Sequencing Genomics: The New Big Data Driver
Sequencing Genomics:The New Big Data DriverSequencing Genomics:The New Big Data Driver
Sequencing Genomics: The New Big Data DriverLarry Smarr
 

Similar to DNA analysis on your laptop: Spot the differences (20)

Personal Genomes: what can I do with my data?
Personal Genomes: what can I do with my data?Personal Genomes: what can I do with my data?
Personal Genomes: what can I do with my data?
 
Introduction to Bioinformatics.
 Introduction to Bioinformatics. Introduction to Bioinformatics.
Introduction to Bioinformatics.
 
Open data genomics_palermo_2017_ver03
Open data genomics_palermo_2017_ver03Open data genomics_palermo_2017_ver03
Open data genomics_palermo_2017_ver03
 
Introduction to Gene Mining Part A: BLASTn-off!
Introduction to Gene Mining Part A: BLASTn-off!Introduction to Gene Mining Part A: BLASTn-off!
Introduction to Gene Mining Part A: BLASTn-off!
 
Introduction to bioinformatics
Introduction to bioinformaticsIntroduction to bioinformatics
Introduction to bioinformatics
 
Data analysis & integration challenges in genomics
Data analysis & integration challenges in genomicsData analysis & integration challenges in genomics
Data analysis & integration challenges in genomics
 
2014 naples
2014 naples2014 naples
2014 naples
 
2015 03 13_puurs_v_public
2015 03 13_puurs_v_public2015 03 13_puurs_v_public
2015 03 13_puurs_v_public
 
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015
 
2013 alumni-webinar
2013 alumni-webinar2013 alumni-webinar
2013 alumni-webinar
 
Quantitative Medicine Feb 2009
Quantitative Medicine Feb 2009Quantitative Medicine Feb 2009
Quantitative Medicine Feb 2009
 
Bioinformatics_1_ChenS.pptx
Bioinformatics_1_ChenS.pptxBioinformatics_1_ChenS.pptx
Bioinformatics_1_ChenS.pptx
 
2015 illinois-talk
2015 illinois-talk2015 illinois-talk
2015 illinois-talk
 
Brief introduction to Bioinformatics
Brief introduction to BioinformaticsBrief introduction to Bioinformatics
Brief introduction to Bioinformatics
 
Data analytics challenges in genomics
Data analytics challenges in genomicsData analytics challenges in genomics
Data analytics challenges in genomics
 
Cloud bioinformatics 2
Cloud bioinformatics 2Cloud bioinformatics 2
Cloud bioinformatics 2
 
Role of bioinformatics in life sciences research
Role of bioinformatics in life sciences researchRole of bioinformatics in life sciences research
Role of bioinformatics in life sciences research
 
Genome sequencing and the development of our current information library
Genome sequencing and the development of our current information libraryGenome sequencing and the development of our current information library
Genome sequencing and the development of our current information library
 
Sequencing Genomics: The New Big Data Driver
Sequencing Genomics:The New Big Data DriverSequencing Genomics:The New Big Data Driver
Sequencing Genomics: The New Big Data Driver
 
2014 villefranche
2014 villefranche2014 villefranche
2014 villefranche
 

Recently uploaded

Proteomics: types, protein profiling steps etc.
Proteomics: types, protein profiling steps etc.Proteomics: types, protein profiling steps etc.
Proteomics: types, protein profiling steps etc.Silpa
 
module for grade 9 for distance learning
module for grade 9 for distance learningmodule for grade 9 for distance learning
module for grade 9 for distance learninglevieagacer
 
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.Nitya salvi
 
Thyroid Physiology_Dr.E. Muralinath_ Associate Professor
Thyroid Physiology_Dr.E. Muralinath_ Associate ProfessorThyroid Physiology_Dr.E. Muralinath_ Associate Professor
Thyroid Physiology_Dr.E. Muralinath_ Associate Professormuralinath2
 
Forensic Biology & Its biological significance.pdf
Forensic Biology & Its biological significance.pdfForensic Biology & Its biological significance.pdf
Forensic Biology & Its biological significance.pdfrohankumarsinghrore1
 
FAIRSpectra - Enabling the FAIRification of Spectroscopy and Spectrometry
FAIRSpectra - Enabling the FAIRification of Spectroscopy and SpectrometryFAIRSpectra - Enabling the FAIRification of Spectroscopy and Spectrometry
FAIRSpectra - Enabling the FAIRification of Spectroscopy and SpectrometryAlex Henderson
 
FAIRSpectra - Enabling the FAIRification of Analytical Science
FAIRSpectra - Enabling the FAIRification of Analytical ScienceFAIRSpectra - Enabling the FAIRification of Analytical Science
FAIRSpectra - Enabling the FAIRification of Analytical ScienceAlex Henderson
 
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdfPests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdfPirithiRaju
 
GBSN - Microbiology (Unit 3)
GBSN - Microbiology (Unit 3)GBSN - Microbiology (Unit 3)
GBSN - Microbiology (Unit 3)Areesha Ahmad
 
Grade 7 - Lesson 1 - Microscope and Its Functions
Grade 7 - Lesson 1 - Microscope and Its FunctionsGrade 7 - Lesson 1 - Microscope and Its Functions
Grade 7 - Lesson 1 - Microscope and Its FunctionsOrtegaSyrineMay
 
Zoology 5th semester notes( Sumit_yadav).pdf
Zoology 5th semester notes( Sumit_yadav).pdfZoology 5th semester notes( Sumit_yadav).pdf
Zoology 5th semester notes( Sumit_yadav).pdfSumit Kumar yadav
 
300003-World Science Day For Peace And Development.pptx
300003-World Science Day For Peace And Development.pptx300003-World Science Day For Peace And Development.pptx
300003-World Science Day For Peace And Development.pptxryanrooker
 
Conjugation, transduction and transformation
Conjugation, transduction and transformationConjugation, transduction and transformation
Conjugation, transduction and transformationAreesha Ahmad
 
Justdial Call Girls In Indirapuram, Ghaziabad, 8800357707 Escorts Service
Justdial Call Girls In Indirapuram, Ghaziabad, 8800357707 Escorts ServiceJustdial Call Girls In Indirapuram, Ghaziabad, 8800357707 Escorts Service
Justdial Call Girls In Indirapuram, Ghaziabad, 8800357707 Escorts Servicemonikaservice1
 
Asymmetry in the atmosphere of the ultra-hot Jupiter WASP-76 b
Asymmetry in the atmosphere of the ultra-hot Jupiter WASP-76 bAsymmetry in the atmosphere of the ultra-hot Jupiter WASP-76 b
Asymmetry in the atmosphere of the ultra-hot Jupiter WASP-76 bSérgio Sacani
 
Vip profile Call Girls In Lonavala 9748763073 For Genuine Sex Service At Just...
Vip profile Call Girls In Lonavala 9748763073 For Genuine Sex Service At Just...Vip profile Call Girls In Lonavala 9748763073 For Genuine Sex Service At Just...
Vip profile Call Girls In Lonavala 9748763073 For Genuine Sex Service At Just...Monika Rani
 
development of diagnostic enzyme assay to detect leuser virus
development of diagnostic enzyme assay to detect leuser virusdevelopment of diagnostic enzyme assay to detect leuser virus
development of diagnostic enzyme assay to detect leuser virusNazaninKarimi6
 
GBSN - Biochemistry (Unit 1)
GBSN - Biochemistry (Unit 1)GBSN - Biochemistry (Unit 1)
GBSN - Biochemistry (Unit 1)Areesha Ahmad
 
Human & Veterinary Respiratory Physilogy_DR.E.Muralinath_Associate Professor....
Human & Veterinary Respiratory Physilogy_DR.E.Muralinath_Associate Professor....Human & Veterinary Respiratory Physilogy_DR.E.Muralinath_Associate Professor....
Human & Veterinary Respiratory Physilogy_DR.E.Muralinath_Associate Professor....muralinath2
 

Recently uploaded (20)

Proteomics: types, protein profiling steps etc.
Proteomics: types, protein profiling steps etc.Proteomics: types, protein profiling steps etc.
Proteomics: types, protein profiling steps etc.
 
module for grade 9 for distance learning
module for grade 9 for distance learningmodule for grade 9 for distance learning
module for grade 9 for distance learning
 
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
 
Thyroid Physiology_Dr.E. Muralinath_ Associate Professor
Thyroid Physiology_Dr.E. Muralinath_ Associate ProfessorThyroid Physiology_Dr.E. Muralinath_ Associate Professor
Thyroid Physiology_Dr.E. Muralinath_ Associate Professor
 
Forensic Biology & Its biological significance.pdf
Forensic Biology & Its biological significance.pdfForensic Biology & Its biological significance.pdf
Forensic Biology & Its biological significance.pdf
 
FAIRSpectra - Enabling the FAIRification of Spectroscopy and Spectrometry
FAIRSpectra - Enabling the FAIRification of Spectroscopy and SpectrometryFAIRSpectra - Enabling the FAIRification of Spectroscopy and Spectrometry
FAIRSpectra - Enabling the FAIRification of Spectroscopy and Spectrometry
 
Site Acceptance Test .
Site Acceptance Test                    .Site Acceptance Test                    .
Site Acceptance Test .
 
FAIRSpectra - Enabling the FAIRification of Analytical Science
FAIRSpectra - Enabling the FAIRification of Analytical ScienceFAIRSpectra - Enabling the FAIRification of Analytical Science
FAIRSpectra - Enabling the FAIRification of Analytical Science
 
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdfPests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
 
GBSN - Microbiology (Unit 3)
GBSN - Microbiology (Unit 3)GBSN - Microbiology (Unit 3)
GBSN - Microbiology (Unit 3)
 
Grade 7 - Lesson 1 - Microscope and Its Functions
Grade 7 - Lesson 1 - Microscope and Its FunctionsGrade 7 - Lesson 1 - Microscope and Its Functions
Grade 7 - Lesson 1 - Microscope and Its Functions
 
Zoology 5th semester notes( Sumit_yadav).pdf
Zoology 5th semester notes( Sumit_yadav).pdfZoology 5th semester notes( Sumit_yadav).pdf
Zoology 5th semester notes( Sumit_yadav).pdf
 
300003-World Science Day For Peace And Development.pptx
300003-World Science Day For Peace And Development.pptx300003-World Science Day For Peace And Development.pptx
300003-World Science Day For Peace And Development.pptx
 
Conjugation, transduction and transformation
Conjugation, transduction and transformationConjugation, transduction and transformation
Conjugation, transduction and transformation
 
Justdial Call Girls In Indirapuram, Ghaziabad, 8800357707 Escorts Service
Justdial Call Girls In Indirapuram, Ghaziabad, 8800357707 Escorts ServiceJustdial Call Girls In Indirapuram, Ghaziabad, 8800357707 Escorts Service
Justdial Call Girls In Indirapuram, Ghaziabad, 8800357707 Escorts Service
 
Asymmetry in the atmosphere of the ultra-hot Jupiter WASP-76 b
Asymmetry in the atmosphere of the ultra-hot Jupiter WASP-76 bAsymmetry in the atmosphere of the ultra-hot Jupiter WASP-76 b
Asymmetry in the atmosphere of the ultra-hot Jupiter WASP-76 b
 
Vip profile Call Girls In Lonavala 9748763073 For Genuine Sex Service At Just...
Vip profile Call Girls In Lonavala 9748763073 For Genuine Sex Service At Just...Vip profile Call Girls In Lonavala 9748763073 For Genuine Sex Service At Just...
Vip profile Call Girls In Lonavala 9748763073 For Genuine Sex Service At Just...
 
development of diagnostic enzyme assay to detect leuser virus
development of diagnostic enzyme assay to detect leuser virusdevelopment of diagnostic enzyme assay to detect leuser virus
development of diagnostic enzyme assay to detect leuser virus
 
GBSN - Biochemistry (Unit 1)
GBSN - Biochemistry (Unit 1)GBSN - Biochemistry (Unit 1)
GBSN - Biochemistry (Unit 1)
 
Human & Veterinary Respiratory Physilogy_DR.E.Muralinath_Associate Professor....
Human & Veterinary Respiratory Physilogy_DR.E.Muralinath_Associate Professor....Human & Veterinary Respiratory Physilogy_DR.E.Muralinath_Associate Professor....
Human & Veterinary Respiratory Physilogy_DR.E.Muralinath_Associate Professor....
 

DNA analysis on your laptop: Spot the differences

Editor's Notes

  1. https://ebbailey.wordpress.com/general-information/
  2. https://phet.colorado.edu/en/simulation/legacy/natural-selection
  3. "Eukaryote DNA-en" by Eukaryote_DNA.svg: *Difference_DNA_RNA-EN.svg: *Difference_DNA_RNA-DE.svg: Sponk (talk)translation: Sponk (talk)Chromosome.svg: *derivative work: Tryphon (talk)Chromosome-upright.png: Original version: Magnus Manske, this version with upright chromosome: User:Dietzel65Animal_cell_structure_en.svg: LadyofHats (Mariana Ruiz)derivative work: Radio89derivative work: Radio89 - This file was derived from Eukaryote DNA.svg:. Licensed under CC BY-SA 3.0 via Commons - https://commons.wikimedia.org/wiki/File:Eukaryote_DNA-en.svg#/media/File:Eukaryote_DNA-en.svg
  4. Image:http://jjshaver.deviantart.com/art/Smoking-makes-you-look-cool-146734265
  5. Image: https://www.quia.com/jg/1272861list.html
  6. http://www.accessexcellence.org/AE/AEPC/NIH/gene14.html Study of families with particular disease. Some people are affected (in grey) Search for mutations or genes which are involved (bioinformatics) About chances that a particular gene is important (biostatistics)
  7. https://www.nih.gov/news-events/news-releases/nih-human-microbiome-project-defines-normal-bacterial-makeup-body 10x more microorganism cells than human cells Only 1-3% of body mass
  8. 49
  9. 49
  10. 49
  11. 49
  12. 49 Score: how similar Expect: could this hit occur by chance Query: input sequence Sbjct: database sequence Numbers: from where to where are the sequences similar Vertical bars: matching nucleotides No vertical bar: indicates mismatches.
  13. http://www.nature.com/ng/journal/v43/n9/fig_tab/ng.894_F1.html http://what-when-how.com/genomics/haplotype-mapping-genomics/
  14. http://www.wikihow.com/Extract-Your-DNA
  15. Image from: http://newproductvisions.com/blog/?p=625