Introdução a Tecnologia dorDNA e Produção de Plantas        TransgênicasCaracterização do Transgene     e Estrutura do loc...
Agrobacterium tumefaciens      TRANSFORMAÇÃO DE PLANTASplasmídeo “Ti”(tumor inducer)        célula transformada         TR...
Transformação Genética de Plantas                Agrobacterium tumefaciens                             Agrobacterium 4.Tra...
Transformação por                            Agrobacterium spp.                             Casa de                       ...
Transformação Genética de Plantas        Transferência Direta de DNA• Microinjeção• Transformação de protoplastos via  pol...
Transformação Genética de Plantas        Transferência Direta de DNA     Bombardeamento de PartículasMicrocarreador  Mater...
BIOBALÍSTICA (“gene gun”)                   Tubo de                 aceleração                     de gás                 ...
Transformação Genética de Plantas             CONSTRUÇÃO GÊNICA• Genes – Uma região de DNA que  codifica para a produção d...
Transformação Genética de Plantas              CONSTRUÇÃO GÊNICA• Transgenes – genes manipulados através das técnicas  de ...
Evento                              CaracterísticasT25         Tolerância ao herbicida glufosinato de amônioMON 810     Re...
Transformação Genética de Plantas                 CONSTRUÇÃO GÊNICA          PROMOTOR       REGIÃO CODIFICADORA      TERMI...
Transformação Genética de Plantas   CONSTRUÇÃO GÊNICA - Promotor         Promotor   uidA (GUS)   NOS
NcoI                          BamH                            1.893 kb                                                 I  ...
Transformação Genética de Plantas        CONSTRUÇÃO GÊNICA
Transformação Genética de Plantas        CONSTRUÇÃO GÊNICA
Transformação Genética de Plantas        CONSTRUÇÃO GÊNICA
Transformação Genética de Plantas        CONSTRUÇÃO GÊNICA
Transformação Genética de Plantas Biossegurança – Análises Moleculares
Biossegurança – Análise Moleculares            Transgene e vetores Qual o método de transformação foi utilizado?   – Foi ...
Biossegurança – Análise Moleculares            Transgene e vetores Quais os organismos foram os doadores de genes?    Or...
Biossegurança – Análise Moleculares              Transgene e vetores Os genes foram manipulados criando fusões entre dife...
Biossegurança – Análise Moleculares            Transgene e vetores Quais os genes foram utilizados para a seleção das  cé...
Biossegurança – Análise Moleculares            Transgene e vetores A sequência do transgene e o mapa de restrição são  eq...
Biossegurança – Análise Moleculares            Transgene e vetores Foi verificado rearranjamentos nos cromossomos? Qual ...
Transformação Genética de Plantas Biossegurança – Análises Moleculares         EcoRI              AluI EcoRI   GAATTCCGTAA...
Biossegurança – Análise Moleculares          Southern Blot
Biossegurança – Análise Moleculares  Polymerase chain reaction- PCR
Biossegurança – Análise Moleculares         Sequenciamento
Mapa de Restrição
BiossegurançaGenomaTranscriptoma, Proteoma e MetabolomaSaúde humana e animalMeio ambiente         Biosafety Assessment...
OBRIGADA!    Andréa A.
Andrea a. carneiro introdução da tecnologia do dna recombinante e producao de plantas transgênicas, caracterização do tran...
Próximos SlideShares
Carregando em…5

Andrea a. carneiro introdução da tecnologia do dna recombinante e producao de plantas transgênicas, caracterização do transgene e estrutrura do locus

1.535 visualizações

Publicada em

Publicada em: Tecnologia
0 comentários
2 gostaram
  • Seja o primeiro a comentar

Sem downloads
Visualizações totais
No SlideShare
A partir de incorporações
Número de incorporações
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Andrea a. carneiro introdução da tecnologia do dna recombinante e producao de plantas transgênicas, caracterização do transgene e estrutrura do locus

  1. 1. Introdução a Tecnologia dorDNA e Produção de Plantas TransgênicasCaracterização do Transgene e Estrutura do locus Andréa A. Carneiro
  2. 2. PRODUÇÃO DE PLANTAS TRANSGÊNICASAgrobacterium Biobalística
  3. 3. PRODUÇÃO DE PLANTAS TRANSGÊNICASAgrobacteriaBiobalística
  4. 4. PRODUÇÃO DE PLANTAS TRANSGÊNICASAgrobacteriaBiobalística
  5. 5. PRODUÇÃO DE PLANTAS TRANSGÊNICASAgrobacteriaBiobalística
  6. 6. PRODUÇÃO DE PLANTAS TRANSGÊNICASAgrobacteriaBiobalística
  7. 7. Agrobacterium tumefaciens TRANSFORMAÇÃO DE PLANTASplasmídeo “Ti”(tumor inducer) célula transformada TRANSGÊNICA ! célula da planta crescimento acelerado e TUMORIZAÇÃO desordenado do tecido “GALHA DA COROA”
  8. 8. Transformação Genética de Plantas Agrobacterium tumefaciens Agrobacterium 4.Transferência do T-DNA para a célula vegetal Plasmídeo Ti 2.Ativação dos genes vir EE ED Ti Genes vir 3.Cópia e T-DNA excisãoGenes Vir do T-DNA att, chvA, B, E, pscA CROMOSSOMA BACTERIANO
  9. 9. Transformação por Agrobacterium spp. Casa de vegetaçãoco-cultivo caloplaqueamento (eliminação Agrobacterium) indução e regeneração seleção
  10. 10. Transformação Genética de Plantas Transferência Direta de DNA• Microinjeção• Transformação de protoplastos via polietileno glicol• Eletroporação• Fibrilas de carboneto de silício• Bombardeamento de PartículasPonto comum: Fatores físicos ou químicosfacilitam a entrada do DNA na célula vegetal
  11. 11. Transformação Genética de Plantas Transferência Direta de DNA Bombardeamento de PartículasMicrocarreador Material Genético Célula
  12. 12. BIOBALÍSTICA (“gene gun”) Tubo de aceleração de gás Disco de ruptura Aparato para Macrocarreador disparo dos microcarreadores Tela de Microcarreadores anteparo cobertos com DNATecido alvo
  13. 13. Transformação Genética de Plantas CONSTRUÇÃO GÊNICA• Genes – Uma região de DNA que codifica para a produção de uma proteína ou característica• Rede interativa - DNA, RNA e proteínas
  14. 14. Transformação Genética de Plantas CONSTRUÇÃO GÊNICA• Transgenes – genes manipulados através das técnicas de DNA recombinante (rDNA) – Obtidos de organismos doadores (vírus, bactérias, fungos, vegetais e animais) – Sintetizados “in vitro” – Genes provenientes do mesmo organismo (cisgênico) ou de organismos diferentes (transgênico) – Transgênico pode ser produzido pela adição, deleção, iRNA.
  15. 15. Evento CaracterísticasT25 Tolerância ao herbicida glufosinato de amônioMON 810 Resistência a insetos da ordem LepidópteraBT11 Resistência a insetos da ordem Lepidóptera e tolerância ao herbicida glufosinato de amônioNK 603 Tolerância ao herbicida glifosatoGA21 Tolerância ao herbicida glufosinato de amônioHERCULEX Resistência a insetos da ordem Lepidóptera e tolerância ao herbicida glufosinato de amônioMIR162 Resistência a insetos da ordem LepidópteraMON 810 x Resistência a insetos da ordem Lepidóptera e tolerância aoNK603 herbicida glifosatoBT11 x Resistência a insetos da ordem Lepidóptera, tolerância aosGA21 herbicidas glifosato e glufosinato de amônioMON89034 Resistência a insetos da ordem LepidópteraTC1507 x Resistência a insetos da ordem Lepidóptera, tolerância aosNK603 herbicidas glifosato e glufosinato de amônio
  16. 16. Transformação Genética de Plantas CONSTRUÇÃO GÊNICA PROMOTOR REGIÃO CODIFICADORA TERMINADORLocalização: Célula, tecido, órgãoEstágio de Desenvolvimento Final do ProcessoQuantidade produzida 35S; Ubiquitina; Actina NOS; polyA 35S Proteína cry; vip; epsps
  17. 17. Transformação Genética de Plantas CONSTRUÇÃO GÊNICA - Promotor Promotor uidA (GUS) NOS
  18. 18. NcoI BamH 1.893 kb I cry1C (codon optimized)HindIII BglII EcoRI d35S AMV NOS-Ter promoter
  19. 19. Transformação Genética de Plantas CONSTRUÇÃO GÊNICA
  20. 20. Transformação Genética de Plantas CONSTRUÇÃO GÊNICA
  21. 21. Transformação Genética de Plantas CONSTRUÇÃO GÊNICA
  22. 22. Transformação Genética de Plantas CONSTRUÇÃO GÊNICA
  23. 23. Transformação Genética de Plantas Biossegurança – Análises Moleculares
  24. 24. Biossegurança – Análise Moleculares Transgene e vetores Qual o método de transformação foi utilizado? – Foi considerado os riscos de cada método? – Foi utilizado todo o vetor ou apenas partes? Quais são os principais transgenes presentes no evento?  Resistência a insetos / Genes cry  Tolerância a herbicidas / Genes epsps
  25. 25. Biossegurança – Análise Moleculares Transgene e vetores Quais os organismos foram os doadores de genes?  Organismo diferente?  Mesmo organismo?  Removido do seu contexto fisiológico, o gene se torna um rDNA com todos os riscos associados de qualquer rDNA.
  26. 26. Biossegurança – Análise Moleculares Transgene e vetores Os genes foram manipulados criando fusões entre diferentes genes ou tiveram alguma parte sintetizadas in vitro?  Transgene pode ter sido modificado para ser expresso de maneira mais eficiente (codon usage)  Recodificados ao nível dos nucleotídeos para ter um codon preferido pelo organismo recipiente.  Ex: genes cry de Bacillus foram recodificados resultando em um aumento de 100X de expressão (Trends Biotechnol. 2004. 22, 346-353) Milho AGG – Arginina (14,8%) Milho CGA - Arginina (4,3%)
  27. 27. Biossegurança – Análise Moleculares Transgene e vetores Quais os genes foram utilizados para a seleção das células modificadas?  Resistência a antibióticos – nptII –kan; bla - amp  Tolerância a Herbicida epsps –glifosato; pat e bar - glifosinato O gene de seleção foi retirado? Como?  Seleção de progênie  Recombinase Como foi confirmado a remoção?  Southern blot, PCR
  28. 28. Biossegurança – Análise Moleculares Transgene e vetores A sequência do transgene e o mapa de restrição são equivalentes? Dados de sequenciamento mostrando:  O sítio de inserção do transgene no cromossomo  A sequência que foi inserida  As sequências flanqueando o transgene Foi verificado a ausência de outras integrações, completa ou parcial?
  29. 29. Biossegurança – Análise Moleculares Transgene e vetores Foi verificado rearranjamentos nos cromossomos? Qual o número de cópias do transgene presente no evento gerado? Houve integração de sequências estruturais do vetor?
  30. 30. Transformação Genética de Plantas Biossegurança – Análises Moleculares EcoRI AluI EcoRI GAATTCCGTAATCGCCATGGTAGCTGGCGAATTCGGGAATG
  31. 31. Biossegurança – Análise Moleculares Southern Blot
  32. 32. Biossegurança – Análise Moleculares Polymerase chain reaction- PCR
  33. 33. Biossegurança – Análise Moleculares Sequenciamento
  34. 34. Mapa de Restrição
  35. 35. BiossegurançaGenomaTranscriptoma, Proteoma e MetabolomaSaúde humana e animalMeio ambiente Biosafety Assessment Tool https://bat.genok.or/bat/
  36. 36. OBRIGADA! Andréa A.
