USO DE TECNOLOGIAS
MOLECULARESMOLECULARES
Conceitos básicosConceitos básicos
Aonde esta localizada a informação genética?
•Cromossomos: acido desoxirribonucléico
(DNA) + proteínas
•O DNA é uma grande...
•Os cromossomos são arranjos lineares de DNA:
ATTTGATCGCGCGTT
•Par de cromossomos homólogos (indivíduos diplóides)
–Bovino...
•Meiose (I e II): um tipo especial de divisão celular que ocorre no
processo de formação das gametas, através do qual uma ...
Que é crossing-over?
•Uma forte correlação entre a fração de recombinação e a
distância em pares de bases.
•O crossing-ove...
A variação genética é devido a diferenças na seqüência de DNA
Os genes são uma sequência de DNA (ex: AGTCTAGGGATTAGA)
•As ...
Algumas características são controladas por poucos
(um) genes
• – Cor da pelagem
• – Algumas doenças genéticas
• – Dupla m...
• A maioria das características produtivas são
controladas por vários genes e por efeitos ambientais
• - Muitos genes + ef...
Mensagem I
• A seleção depende da disponibilidade de registros
fenotípicos
• Dependendo da herdabilidade da característica...
Limitações da seleção tradicional
• Seleção tradicional depende fortemente
registros fenotípicos e resposta muito baixa
pa...
Resposta a seleção
• ΔG: Progresso genético anual
• i: intensidade de seleção
• r: acurácia de seleção
• σa: desvio padrão...
Detecção de genes de efeito maior (QTL)
•Se temos informação sobre a localização do QTL no genoma
podemos:
–Diminuir o int...
Podemos observar diretamente os genes que afetam as
características quantitativas?
Uso de
marcadores
moleculares
•Localiza...
Uso de marcadores no estudo de
características quantitativas
• Características quantitativas
– Controladas por vários gene...
QTL
• São regiões cromossômicas relacionadas com variação
fenotípicas das características quantitativas
• Limitações:
• Di...
Busca de QTL
•O que necessitamos?
–Uma população de animais com genótipos dos
marcadores e os fenótipos para característic...
Uso de marcadores moleculares
Duas alternativas 1- DIRETAMENTE identificaram o
gene de interesse
Marcadores diretosMarcado...
Aplicação: Análise de Genes Candidatos
•Genes de função conhecida relacionados com o desenvolvimento
de uma característica...
2- INDIRETAMENTE identificação de marcadores
que estão próximos ao gene ou QTL de interesse
IMPORTANTE:
Distância entre ma...
Porque é que a distância é importante?
Um marcador genético indireto (variantes A e B) ligado a um
gene principal (variant...
Mapeamento por ligação: LD e LE
• Marcadores em loci diferentes se encontram em
associação ao acaso (independentes) são di...
MARCADORES GENÉTICOS
• Identificar ou etiquetar alguma coisa
• 1923: feijão com ausência de cor escura no tegumento x
tama...
MARCADORES MORFOLOGICOS
• Fenótipo de fácil identificação
• Normalmente determinada por único alelo.
• Exemplo 1: planta d...
Marcadores moleculares
• O que seriam marcadores moleculares?
São alterações encontradas na sequência de
aminoácidos de um...
Marcadores moleculares
• Características de DNA que diferenciam dois
ou mais indivíduos e são herdadas
geneticamente.
• Os...
Marcadores moleculares
• Marcadores de proteínas ( Produtos direto dos
alelos);
• Marcadores que utilizam o próprio DNA (s...
Marcadores de proteínas -bioquímicos
• Mais comuns: isoenzimas ( esterases, fosfatases,
peroxidases...)
• Procedimento con...
Marcadores que utilizam o próprio DNA
• São os próprios genes ou seus vizinhos, isto é
seqüências de DNA situadas próxima ...
Marcadores moleculares
princípio de funcionamento
O princípio básico envolvido na obtenção e detecção dos
marcadores bioqu...
Técnica de PCR
Reação em Cadeia de Polimerase
• Técnica que replica milhões de vezes um
fragmento de DNA, possibilitando a...
Algumas classes de marcadores moleculares
RFLP (Restriction Fragmenth Lenght Polymorphism)
RAPD (Random Amplified Polymorp...
Os principais tipos de marcadores utilizados
atualmente em pecuária são:
• 1)Análise das variações no comprimento de
regiõ...
RFLP (“Restriction Fragment Length Polymorphism”)
Significa polimorfismo no comprimento de fragmentos de
restrição (obtido...
• Admitindo-se que o fragmento de DNA identificado
pela sonda esteja intimamante ligado a um alelo de
interesse, pode-se s...
Usos marcadores RFLP
• Diversidade genética e identificação de paternidade
• Construção de mapas de ligação e mapeamento d...
RAPD-”Fragmentos de DNA amplificados
ao acaso” ( Williams et al, 1990)
• Marcadores moleculares anônimos distribuídos pelo...
Microssatélites ou SSR
Comportamento Mendeliano e consistem de trechos de
DNA de unidades mono-, di-, tri-, tetra- ou pent...
Microssatélites
• Seqüências curtas (300 pb)
• Repetições em tandem (6 a 8 nucleotídeos =
mais comuns TG/AC)
• Mais utiliz...
MÉTODO
as sequencias que flanqueiam Regiões repetidas são
amplificadas por um par de primers específicos (20 a
30 bases) -...
AFLP- Polimorfismo de comprimento de
fragmentos amplificados (Vos et al., 1995).
Técnica:
• Clivagem do DNA genômico com d...
MARCADORES DERIVADOS DE
SEQÜENCIAS EXPRESSASSEQÜENCIAS EXPRESSAS
Marcador molecular – SNP
Polimorfismos de base única
Correspondem a posições onde existe uma alternância dos
nucleotídeos ...
SNP- Polimorfismo de um nucleotídeo
•Single Nucleotide Polymorphism ou Polimorfismos de
Nucleotídeos Únicos
• Polimorfismo...
Tipos mais comuns de SNPs:
•Transição: base púrica é
substituída por outra púrica
A G T C
• Transversão: púrica substituíd...
•Podem ocorrer em regiões expressas e não expressas
• São estáveis do ponto de vista evolutivo
•SNP se ocorrer em pelo men...
VANTAGENS
• Abundância no genoma
• Elevado grau de polimorfismo
• Detecção de diferentes alelos para genes de interesse
DE...
Marcadores moleculares - aplicabilidade
Caracterização de diversidade genética em populações
naturais e genótipos cultivad...
Conclusão
As aplicações da biotecnologia na área animal
são múltiplas e estão em diferentes etapas de
desenvolvimento, alg...
Obrigado pela a atenção de
vocês!!!vocês!!!
Aulamarcadoresgenéticos
Aulamarcadoresgenéticos
Aulamarcadoresgenéticos
Aulamarcadoresgenéticos
Aulamarcadoresgenéticos
Aulamarcadoresgenéticos
Aulamarcadoresgenéticos
Aulamarcadoresgenéticos
Aulamarcadoresgenéticos
Aulamarcadoresgenéticos
Aulamarcadoresgenéticos
Aulamarcadoresgenéticos
Aulamarcadoresgenéticos
Aulamarcadoresgenéticos
Aulamarcadoresgenéticos
Próximos SlideShares
Carregando em…5
×

Aulamarcadoresgenéticos

477 visualizações

Publicada em

Publicada em: Tecnologia
0 comentários
0 gostaram
Estatísticas
Notas
  • Seja o primeiro a comentar

  • Seja a primeira pessoa a gostar disto

Sem downloads
Visualizações
Visualizações totais
477
No SlideShare
0
A partir de incorporações
0
Número de incorporações
3
Ações
Compartilhamentos
0
Downloads
8
Comentários
0
Gostaram
0
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Aulamarcadoresgenéticos

  1. 1. USO DE TECNOLOGIAS MOLECULARESMOLECULARES
  2. 2. Conceitos básicosConceitos básicos
  3. 3. Aonde esta localizada a informação genética? •Cromossomos: acido desoxirribonucléico (DNA) + proteínas •O DNA é uma grande molécula de duas fitas •Cada fita é composta por: Açucares, radicais de fosfato e bases nitrogenadas - A informação genética é contida nos cromossomos. nitrogenadas –Adenina (A), Guanina (G), Citosina (C), Tiamina (T) –A com T (2 pontes de nitrogênio) –C com G (3 pontes de nitrogênio) •As fitas são conectadas através de pontes de hidrogênio.
  4. 4. •Os cromossomos são arranjos lineares de DNA: ATTTGATCGCGCGTT •Par de cromossomos homólogos (indivíduos diplóides) –Bovinos 2n:60; Suínos 2n:38; Ovinos 2n:54 •Loci (plural: locos): A posição de um gene ou de um marcador•Loci (plural: locos): A posição de um gene ou de um marcador genético em um cromossomo. •Alelos: formas alternativas de um gene •Haplótipos: Alelos em diferentes loci localizados de forma próxima em um cromossomo tendem a ser herdados conjuntamente (Ligação)
  5. 5. •Meiose (I e II): um tipo especial de divisão celular que ocorre no processo de formação das gametas, através do qual uma célula tem o seu número de cromossomos reduzido pela metade. • Os cromossomos segregam de forma aleatória (Meiose I) •“Crossing-over” ou recombinação: troca de segmentos cromossômicos entre homólogos durante a meiose (Meiose I)
  6. 6. Que é crossing-over? •Uma forte correlação entre a fração de recombinação e a distância em pares de bases. •O crossing-over ocorre quando existe troca de segmentos de cromossomos homólogos (ex, os cromossomos paternos e maternos)
  7. 7. A variação genética é devido a diferenças na seqüência de DNA Os genes são uma sequência de DNA (ex: AGTCTAGGGATTAGA) •As diferenças genéticas entre indivíduos são devidas às diferenças na sequência de DNA: Animal 1 AGTCTAG Animal 2 AGTGTAG •As diferenças genéticas são devido a variações naturais na seqüência do DNA (polimorfismos) Nem sempre as diferenças a nível genética (DNA) determinam diferenças no fenótipo –Depende se a variação estiver numa região codificante –Exon/Intron
  8. 8. Algumas características são controladas por poucos (um) genes • – Cor da pelagem • – Algumas doenças genéticas • – Dupla musculatura • – Presença de chifres
  9. 9. • A maioria das características produtivas são controladas por vários genes e por efeitos ambientais • - Muitos genes + efeito ambiental • - Modelo infinitesimal (Fischer, 1918)
  10. 10. Mensagem I • A seleção depende da disponibilidade de registros fenotípicos • Dependendo da herdabilidade da característica pode fornecer uma idéia ou não do valor genético aditivofornecer uma idéia ou não do valor genético aditivo do animal • As informações de parentesco genético aditivo são utilizadas para a estimação dos valores genéticos
  11. 11. Limitações da seleção tradicional • Seleção tradicional depende fortemente registros fenotípicos e resposta muito baixa para algumas características: – Características de difícil mensuração– Características de difícil mensuração – Características que são expressos tardiamente na vida do animal – Caracteres limitados ao sexo – Características de baixa herdabilidade
  12. 12. Resposta a seleção • ΔG: Progresso genético anual • i: intensidade de seleção • r: acurácia de seleção • σa: desvio padrão aditivo • IG: intervalo entre gerações
  13. 13. Detecção de genes de efeito maior (QTL) •Se temos informação sobre a localização do QTL no genoma podemos: –Diminuir o intervalo entre gerações –Aumentar a acurácia dos valores genéticos–Aumentar a acurácia dos valores genéticos –Incrementar a resposta à seleção •Como encontrar os QTL? 1.-Mapeamento por ligação 2.-Abordagem de genes candidatos
  14. 14. Podemos observar diretamente os genes que afetam as características quantitativas? Uso de marcadores moleculares •Localizar os genes que tem grande efeito sobre o fenótipo •Identificar diferentes alelos destes genes •Permitem seguir ou rastrear a herança dos genes (ao longo das gerações)
  15. 15. Uso de marcadores no estudo de características quantitativas • Características quantitativas – Controladas por vários genes de pequeno efeito – Sofrem maior influencia ambiental – Não se sabe quanto ele contribui para o fenótipo • QTL: Quantitative Trait Loci; Locos de um caráter quantitativo• QTL: Quantitative Trait Loci; Locos de um caráter quantitativo identificado por marcadores moleculares. • Finalidade: determinar quanto de uma característica quantitativa é explicada por um ou mais marcadores
  16. 16. QTL • São regiões cromossômicas relacionadas com variação fenotípicas das características quantitativas • Limitações: • Dificuldade de avaliação dos caracteres quantitativos aliados a necessidade de ligação dos marcadores com os QTLnecessidade de ligação dos marcadores com os QTL • Dificuldade de obtenção dos próprios marcadores • Estudo difícil e trabalhoso • Obs: Há necessidade de mais pesquisas para tornar mais eficientes o emprego dos marcadores moleculares no estudo das características quantitativas
  17. 17. Busca de QTL •O que necessitamos? –Uma população de animais com genótipos dos marcadores e os fenótipos para características relevantes •Princípios chaves na busca –Encontrar marcadores associados com diferenças nos fenótipos –O marcador está ligado com um QTL que determina as diferenças de fenótipo
  18. 18. Uso de marcadores moleculares Duas alternativas 1- DIRETAMENTE identificaram o gene de interesse Marcadores diretosMarcadores diretos
  19. 19. Aplicação: Análise de Genes Candidatos •Genes de função conhecida relacionados com o desenvolvimento de uma característica •Principal vantagem prática: não há necessidade de construção de famílias segregantes, podendo o efeito do gene candidato ser avaliado em qualquer população (marcador direto) •Outras Vantagens: –Alto poder estatístico –Ampla aplicabilidade –Baixo custo e simplicidade •Desvantagem: Difícil de encontrar regiões candidatas Dekkers and van der Werf, 2007
  20. 20. 2- INDIRETAMENTE identificação de marcadores que estão próximos ao gene ou QTL de interesse IMPORTANTE: Distância entre marcador e a mutação Marcadores indiretos
  21. 21. Porque é que a distância é importante? Um marcador genético indireto (variantes A e B) ligado a um gene principal (variantes círculo e triângulo): Se organizamos o sêmen deste touro obtemos: Gametas não recombinantes Gametas recombinantes A distância é proporcional ao número de recombinantes
  22. 22. Mapeamento por ligação: LD e LE • Marcadores em loci diferentes se encontram em associação ao acaso (independentes) são ditos em estado de equilíbrio de ligação (LE) na população. • Marcadores em loci diferentes não estão em associação ao acaso (não independentes) são ditos em estado de desequilíbrio de ligação (LD) na população.
  23. 23. MARCADORES GENÉTICOS • Identificar ou etiquetar alguma coisa • 1923: feijão com ausência de cor escura no tegumento x tamanho do semente : seleção de forma indireta (tegumento claro = marcador • Qualidade de um bom marcadorQualidade de um bom marcador » Herdável » Fácil observação » Herdabilidade alta » Intimamente relacionado ao alelo que desejamos selecionar • OBS: Essas qualidades tornam mas eficientes a seleção indireta • Os marcadores genéticos podem ser morfológicos e moleculares.
  24. 24. MARCADORES MORFOLOGICOS • Fenótipo de fácil identificação • Normalmente determinada por único alelo. • Exemplo 1: planta de milho jovem verde clara x esterilidade masculina ( fenótipo importante na produção de híbrido mas de difícil identificação = estão em lócus bastante próximos e tem altadifícil identificação = estão em lócus bastante próximos e tem alta probabilidade de serem herdados juntos) • Exemplo 2: cor amarela do milho x teor de vitamina (o mesmo alelo para ambas características: mais fácil selecionar pela cor) • Limitação dos marcadores morfológicos: • Ocorrência em número reduzido • Muitas características de interesse econômico não tem marcador morfológico • Muitos marcadores que apresentam baixa herdabilidade
  25. 25. Marcadores moleculares • O que seriam marcadores moleculares? São alterações encontradas na sequência de aminoácidos de uma proteína ou do próprio DNA,aminoácidos de uma proteína ou do próprio DNA, que podem alterar uma determinada característica em alguns indivíduos de uma população
  26. 26. Marcadores moleculares • Características de DNA que diferenciam dois ou mais indivíduos e são herdadas geneticamente. • Os tipos de marcadores diferenciam-se pela tecnologia utilizada para revelar variabilidade do DNA.
  27. 27. Marcadores moleculares • Marcadores de proteínas ( Produtos direto dos alelos); • Marcadores que utilizam o próprio DNA (são os• Marcadores que utilizam o próprio DNA (são os próprios genes ou seqüências de DNA situadas próxima ao gene de interesse): » RFLP » PCR » AFLP » Microssatélites
  28. 28. Marcadores de proteínas -bioquímicos • Mais comuns: isoenzimas ( esterases, fosfatases, peroxidases...) • Procedimento consiste na extração e identificação da proteína. • Exemplo: Cevada izoenzima esterase x resistência um• Exemplo: Cevada izoenzima esterase x resistência um virus ( seleção indireta) • Vantagem: – menor custo – Codominância: identifica homozigotos e heterozigotos • Limitações: – Reduzida variabilidade – Marcadores em número reduzido
  29. 29. Marcadores que utilizam o próprio DNA • São os próprios genes ou seus vizinhos, isto é seqüências de DNA situadas próxima ao gene que se deseja marcar • Vantagens;Vantagens; • Grande variabilidade entre indivíduos • Numero de marcadores suficientes para marcar todos os alelos de todos os genes que se deseja marcar. • Desvantagens: • Técnicas laboratoriais mais caras, que os bioquimicos e os morfológicos
  30. 30. Marcadores moleculares princípio de funcionamento O princípio básico envolvido na obtenção e detecção dos marcadores bioquímico e molecular reside na utilização da ELETROFORESE Seu princípio é simples: moléculas de carga negativa migram para o pólo positivo, e moléculas com carga positiva migram para oo pólo positivo, e moléculas com carga positiva migram para o pólo negativo A técnica de PCR (Polimerase Chain Reaction ou Reação em Cadeia de Polimerase), a qual muito marcadores moleculares são derivados e consiste na amplificação enzimática direcionada por “primers” (iniciadores) de um DNA (PCR), é um método in vitro que sintetiza milhões de cópias de uma seqüência nucleotídica em poucas horas
  31. 31. Técnica de PCR Reação em Cadeia de Polimerase • Técnica que replica milhões de vezes um fragmento de DNA, possibilitando a sua detecção e análise. • Extração do DNA • Vários protocolos • Kits prontos
  32. 32. Algumas classes de marcadores moleculares RFLP (Restriction Fragmenth Lenght Polymorphism) RAPD (Random Amplified Polymorphism DNA) Microssatélites ou SSR (Sequence Simple Repeats)Microssatélites ou SSR (Sequence Simple Repeats) AFLP (Amplified Frangment Lenght Polymorphism) SNP (Single-nucleotide polymorphism)
  33. 33. Os principais tipos de marcadores utilizados atualmente em pecuária são: • 1)Análise das variações no comprimento de regiões de DNA tipo Microssatélite (testes de paternidade e registro)paternidade e registro) • 2)Painéis contendo diversos polimorfismos de sítio único (SNP) (seleção e melhoramento)
  34. 34. RFLP (“Restriction Fragment Length Polymorphism”) Significa polimorfismo no comprimento de fragmentos de restrição (obtidos por corte de fita dupla de DNA). Tome-se dois indivíduos distintos que têm o DNA extraído e submetido a clivagem por enzima de restrição. O uso da técnica de RFLP visa detectar diferenças na seqüência de DNA dos dois indivíduos. Uma maneira de se fazer isto é sequenciar o DNA dos dois indivíduos e comparar as seqüências obtidas.
  35. 35. • Admitindo-se que o fragmento de DNA identificado pela sonda esteja intimamante ligado a um alelo de interesse, pode-se selecionar esse alelo por meio desse fragmento. Assim o fragmento RFLP funciona como um marcador ou etiqueta do alelo de interesse.
  36. 36. Usos marcadores RFLP • Diversidade genética e identificação de paternidade • Construção de mapas de ligação e mapeamento de QTLs • Seleção assistida por marcadores (SAM)
  37. 37. RAPD-”Fragmentos de DNA amplificados ao acaso” ( Williams et al, 1990) • Marcadores moleculares anônimos distribuídos pelo genoma; • Utiliza “primers” curtos e de seqüências arbitrárias, com seqüências alvo desconhecida;seqüências alvo desconhecida; • Utiliza um “primer” único; • Detecta polimorfismo em apenas um par de bases; • Baseia-se na amplificação de DNA; • Não Permite distinguir heterozigotos.
  38. 38. Microssatélites ou SSR Comportamento Mendeliano e consistem de trechos de DNA de unidades mono-, di-, tri-, tetra- ou penta- nucleotídica repetidas ao acaso, dispersas por todo o genoma eucarioto Os produtos da reação são separados em gel deOs produtos da reação são separados em gel de poliacrilamida Vantagens (natureza multialélica, herança codominante; fácil detecção por PCR; quantidades mínimas de DNA) Desvantagens (custo final “primers informativos”)
  39. 39. Microssatélites • Seqüências curtas (300 pb) • Repetições em tandem (6 a 8 nucleotídeos = mais comuns TG/AC) • Mais utilizada em mapeamento genético,• Mais utilizada em mapeamento genético, devido a sua grande varredura no genoma.
  40. 40. MÉTODO as sequencias que flanqueiam Regiões repetidas são amplificadas por um par de primers específicos (20 a 30 bases) - complementares as seqüências microssatélites. Cada microssatélite –é um loco genético altamente variável, multialélico. Separação por eletroforese (cada banda representa um alelo diferente do mesmo loco)
  41. 41. AFLP- Polimorfismo de comprimento de fragmentos amplificados (Vos et al., 1995). Técnica: • Clivagem do DNA genômico com duas enzimas de restrição • Ligação de adaptadores específicos aos terminais dos• Ligação de adaptadores específicos aos terminais dos fragmentos clivados •Pré-amplificação dos fragmentos,utiliza primers especificos para cada adaptador mais uma base seletiva (Eco + A, M+C) • Amplificação seletiva utiliza primers específicos para o adaptador, sitio de restrição mais três bases seletivas • Eletroforese em gel de alta resolução
  42. 42. MARCADORES DERIVADOS DE SEQÜENCIAS EXPRESSASSEQÜENCIAS EXPRESSAS
  43. 43. Marcador molecular – SNP Polimorfismos de base única Correspondem a posições onde existe uma alternância dos nucleotídeos A, C, G e T, em uma freqüência alélica mínima de 1% em uma dada população São polimorfismos estáveis A grande maioria é neutra Duas pessoas não relacionadas diferem em aproximadamente 1 base a cada 1000. Do total de 3 bilhões de bases em seu genoma um indivíduo carregaria 3 milhões de SNPs.
  44. 44. SNP- Polimorfismo de um nucleotídeo •Single Nucleotide Polymorphism ou Polimorfismos de Nucleotídeos Únicos • Polimorfismo baseados na alteração de uma única base no genomano genoma •Exemplo: AAGGTTA muda para ATGGTTA
  45. 45. Tipos mais comuns de SNPs: •Transição: base púrica é substituída por outra púrica A G T C • Transversão: púrica substituída por pirimídica ou vice-versa :por pirimídica ou vice-versa : A C A T G C G T
  46. 46. •Podem ocorrer em regiões expressas e não expressas • São estáveis do ponto de vista evolutivo •SNP se ocorrer em pelo menos 1% da população • Alta freqüência e distribuição no genoma: Genoma humano: 90% polimorfismo – SNPs 1,42 milhão Milho: 1SNP – 48pb (Regiões não-codificadoras) Total – 21.502 SNPsTotal – 21.502 SNPs São encontrados no genoma em : •Haplogrupos: mutações que ocorrem próximas e são herdadas juntas Indivíduo Seqüência encontrada Haplogrupo 1 GATATTCGTACGGATGTATC AG 2 GATGTTCGTACTGATGTATC GT •Individuais:
  47. 47. VANTAGENS • Abundância no genoma • Elevado grau de polimorfismo • Detecção de diferentes alelos para genes de interesse DESVANTAGEM Sequenciamento de DNA em grande escala
  48. 48. Marcadores moleculares - aplicabilidade Caracterização de diversidade genética em populações naturais e genótipos cultivados Sistemática e evolução (taxonomia molecular) Identificação de genes de interesse zootécnico Confecção de mapas genéticos Clonagem de genes e mapeamento Seleção assistida em melhoramento Diversidade genética e seleção de genitores Fingerprinting e proteção de cultivos Análise de pureza genética Mapeamento comparativo
  49. 49. Conclusão As aplicações da biotecnologia na área animal são múltiplas e estão em diferentes etapas de desenvolvimento, algumas com problemas técnicos a serem solucionados e outras que já geraram produtos que podem entrar no mercadogeraram produtos que podem entrar no mercado ou que já estão sendo comercializados. O ambiente é efervecente e fascinante e, certamente, contribuirá para a melhor qualidade de vida do homem.
  50. 50. Obrigado pela a atenção de vocês!!!vocês!!!

×