Día 19 - Noel Chen - Introducción a Novogene
•
1 like•4,534 views
Empresa líder en secuenciación genómica comercial.
Recommended
Recommended
More Related Content
What's hot
What's hot (20)
Viewers also liked
Viewers also liked (15)
Similar to Día 19 - Noel Chen - Introducción a Novogene
Similar to Día 19 - Noel Chen - Introducción a Novogene (20)
More from Alejandro Borges
More from Alejandro Borges (19)
Recently uploaded
Recently uploaded (20)
Día 19 - Noel Chen - Introducción a Novogene
- 1. Leading Edge Genomic Services & Solu5ons Introduction of Novogene Bioinformatics Corporation Noel Chen, Ph.D. VP of Business Development noel.chen@novogene.com
- 2. Novogene Overview 2 • Founded in 2011 • Rapid growth each year, now 1000 employees • Providing high-quality, next-gen sequencing and bioinforma5cs services in research and clinical markets • Currently the largest Illumina customer and the only Illumina IGN partner in China • The largest sequencing center in China in capacity • Preparing for IPO • Revenue has surpassed BGI in research market in China recently Headquarters in Beijing
- 3. Worldwide Branches of Novogene 3 Beijing Tianjin HK UK US Est. 2011 Est. 2014
- 4. Founder and Chief Executive 4 Dr. Ruiqiang Li • One of the world’s leading experts in genomics and bioinformatics • Best known for developing the software SOAP for ultra-fast sequence mapping, variation detection, and de novo genome assembly. • Prior experience • Vice President of BGI • Principle Investigator at Peking University & Peking/Tsinghua Center for Life Sciences • 70 publications (30 in Nature and Science series) that are cited over 12,000 times • PhD in Biology from University of Copenhagen
- 5. The Development of Novogene 5 28 86 198 506 0 100 200 300 400 500 600 2011 2012 2013 2014 Employees 2011 2012 2013 2014 Revenue Both revenue and number of employees more than doubled each year since our founding.
- 6. 1,000 Professional Employees 6 Administration 8% Sequencing 15% Service & Support 25% R & D 12% Bioinformatics 40% Doctorates 14% Masters 61% Bachelors 23% Others 2% Our focus: High quality service and customer satisfaction 75% of our employees have advanced degrees.
- 7. The Largest Sequencing Center in China 7 Platform Read Length Q30 (Data Quality Guarantee) HiSeq X 2×150 bp ≥80% HiSeq 2500/2000 2×250 bp 2×125 bp ≥85% 1×50 bp ≥90% HiSeq 4000 2×150 bp ≥80% MiSeq 2×300 bp 2×250 bp NextSeq 500 2×75 bp 1×75 bp Total Output/Month 234 Tb
- 8. Illumina’s Official Quality Guarantee 8 Our data quality guarantee exceeds Illumina’s official guarantee. We are the only company providing this guarantee.
- 9. The Largest Sequencing Center in China 9 Platform Read Length Novogene Q30 Guarantee Average Q30 Delivered Illumina Q30 Guarantee 10 HiSeq X 2×150 bp ≥80% 88.11% ≥75% 10 HiSeq 2500/2000 2×250 bp ≥80% 91.22% ≥80% 2×125 bp ≥85% 88.29% ≥80% 1×50 bp ≥90% 96.57% ≥80% 1 HiSeq 4000 2×150 bp ≥80% 90.10% ≥75% 4 MiSeq 2×300 bp - 75.20% ≥70% - ≥75%2×250 bp ≥80% 1 NextSeq 500 2×75 bp ≥80% 90.37% ≥80% 1×75 bp ≥80% 85.58% ≥80% Total Output/Month 234 Tb
- 10. Our Human Whole Genome Sequencing Service 10 Platform HiSeq X Ten Read length 2×150 bp Turnaround time 15 working days Standard analysis Additional 8 working days Advanced analysis upon request Different Batch Flow Cell 1 Flow Cell 2 Output 972.0 G 943.2 G Q30 90.30% 88.90% Different Sample Sample 1 Sample 2 Raw Data 105.5 G 105.8 G Mapping Ratio 99.90% 99.90% Effective Coverage 31.7 31.8 Service Parameter Data Output and Quality “I am extremely satisfied with the quality of the WGS results Novogene delivered.” From customer Justin Loe, CEO of Full Genomes Corporation, Maryland, USA
- 11. Human Whole Genome Sequencing (WGS) 11 Standard Bioinformatics Pipeline of WGS Raw data Clean data Alignment Annotation CNV Case Control Yes SNP, InDel SV Somatic SNV Somatic InDel
- 12. Extensive Quality Controls 12 DNA/RNA Preparation Sequencing Bioinformatics Analysis Sample Received Libraries Preparation Data Delivery Sample QC Report Data Delivery ~5 days ~4 days ~3-12 days ~15 days Library QC Report Raw data QC Report Data Report Delivery Records To ensure the accuracy and reliability of the sequencing data, Novogene strictly controls the quality of every step. Workflow
- 13. Data Analysis on HPC (High Performance Computing) Platform 13 DELL Computing Nodes Memory Size: 17 TB Computing Power: 73 T flops Storage: 3.2 PB Data Type Data Analysis Capacity / Month Human Genome 360 Tb / 4000 samples Exome 40 Tb / 8000 samples Transcriptome
- 14. Products and Services Overview 14 Life Science Research Services p Human whole genome & exome sequencing p Transcriptome sequencing p Plant and animal sequencing p Microbial sequencing p Bioinformatics analysis Clinical Genetic Testing (China) p Cancer generic testing & risk assessment p Cancer drug panel p ctDNA detection p NIPT
- 15. Service Portfolio for Global Researchers 15 Whole Genome Sequencing • Whole genome re-sequencing • Whole exome sequencing • Single-cell DNA sequencing • Target region sequencing Transcriptome Sequencing • mRNA sequencing • Single-cell RNA sequencing • lncRNA sequencing • Whole genome bisulfite sequencing Microbial Genome Sequencing • Microbial genome re-sequencing • Microbial de novo sequencing • Metagenomic sequencing • 16S/18S/ITS amplicon sequencing Animal & Plant Genome Sequencing • Animal & Plant re-sequencing • Animal & Plant de novo sequencing • Pan-genome re-sequencing • Genotyping by Sequencing
- 16. Solutions for Human Disease Research 16 TechnologyFocus DNA Level RNA Level Epigenetics Single cell • WGS • WES • Target-seq • Cancer panel • RNA-seq • DGE • Small RNA-seq • LncRNA－seq • WGBS • WGS • WES • RNA-seq • LncRNA-seq • SNP／InDel ／SV／CNV • Somatic mutations • Driver gene • Clonal evolution • Differentially expressed genes • Alternative splicing • Fusion gene • LncRNA • Methylation analysis • Differential methylation region（DMR） • SNP／InDel ／SV／CNV • Differentially expressed genes • Heterogeneity
- 17. Whole Exome Sequencing (WES) 17 Platform HiSeq 4000 Exome Capture Agilent SureSelect V6 (58M) / V5 Read length 2×150 bp (longer reads with 20% more data than PE125) Turnaround time 15 working days Standard anaylsis Additional 5 working days Service Parameter (State-of-the-Art Platform) Raw data Clean data Alignment Annotation InDel Case Control Yes SNP Somatic SNP Somatic InDel Standard Bioinformatics Pipeline ExAC database--including 17 international exome databases for free
- 18. 18 Inherit Susceptibility Gene Screening NovoCRTM Individual cancer panels Multi-cancer testing Personalized Cancer Therapy NovoPMTM Tissue samples Standard 47 genes Professional 483 genes ctDNA Standard 40 genes Professional 483 genes • NovoPM detects SNVs, indels, CNVs, fusions, and their relationships with cancer drugs to guide personalized cancer therapy. • NovoCR assesses an individual’s risk in developing cancer. • We also offer custom panel service based on Agilent capture and HiSeq 4000. Cancer Panel Solutions
- 19. RNA Sequencing 19 Platform HiSeq 4000 Read length 2×150 bp Turnaround time 15 working days Standard anaylsis additional 15 working days Service Parameters Novogene Advantages • HiSeq paired-end 150 bp (longer reads) Sequencing strategy • Over 3,000 customer projects successfully completed Rich experience • Self-developed software (NovoFinder)--aim to find the genes you need Bioinformatics analysis
- 20. RNA Sequencing Data Analysis 20 Sequencing Data QC Total RNA mRNA Library Genome Available Genome Unavailable Genome Mapping Gene Structure Gene Expression Alternative Splicing Antisense Transcripts SNP & InDel Differential exon usage Gene Expression Level Sample Correlation Differential Expressed Genes GO/KEGG Enrichment Transcriptome Assembly Transcripts Sequence Length Distribution Function Annotation SNP & InDel
- 21. Long Non-coding RNA Sequencing 21 Platform HiSeq 4000 Read length Paired-end 150 bp Turnaround time 40 working days Service Parameter Standard Bioinformatics Analysis (by an all PhD team) Long non-coding RNA plays important regulatory functions. Our service enables researchers to simultaneously obtain information on mRNAs and lncRNAs.
- 22. Microbial Genome Sequencing 22 Microbial Genome- sequencing Bacterial genomesequen cing Draft map Fine map Complete map Re-sequencing Draft map Fine map Re-sequencing 16S 18S ITS Fosmid, plasmid Mitochondria Chloroplast Virus Meta-genomic sequencing Meta-survey Fungal genome sequencing Small genome sequencing Amplicon sequencing Meta sequencing Platform: HiSeq PE 150 1000+ samples sequenced per month
- 23. Single Cell Sequencing 23 —— • heterogeneity ≈ Why? Germ cell • heterogeneity Neurons Stem cell Immune cell Tumor cell(CTC)
- 24. Single Cell Sequencing 24 • MALBAC for DNA, SMARTER for RNA Amplification technology • 2 papers published (Nature & Science)Rich experience • HiSeq X for human, HiSeq2500/4000 for other species Sequencing strategy Novogene Advantages
- 25. Customer Projects Completed in 2014 25 Transcriptome Sequencing Human Resequencing Microbial Sequencing Plant & Animal resequencing Plant & Animal de novo sequencing 3122 3181 813 243 32
- 26. We Understand Science 26 • >100 published ar=cles with a total impact fact of 649 in just 4 years • 34 patents in NGS and bioinforma=cs • Numerous ar=cles in submission
- 27. 27 Human preimplantation embryos and embryonic stem cells Methods: Single Cell lncRNA+mRNA Seq 22,687 maternally expressed genes detected, including 8,701 lncRNAs, 9,735 increased than microarray 2,733 novel lncRNAs discovered and many are expressed in specific developme ntal stages EPI cells and primary hESC outgrowth have dramatically different transcriptome, 1,498 genes showing differential expression. Grope samples: Ø Metaphase II oocyte, zygote, 2-cell, 4-cell, 8-cell, morula and late blastocyst at hatching stage; Ø 3-30 biology repeats per group; Ø 124 cells totally Method: lncRNA+mRNA HiSeq2000, PE100 20M-60M clean reads; 438 Gb data totally n Novogene Case 1
- 28. 28 Human Single Sperm Cells Methods: Single Cell Whole Genome Sequencing One Healthy Asian Male in late 40s 93 sperm:~1x 70x 99 sperm MALBAC 23% coverage 2.8 million SNP 2368 autosomal crossover events in the sperm cells; 26 .6 crossovers per cell on average Constructed a genetic map of recombination of the individual 5% sperm were deteced having autosomal aneuploidy 6 sperm:~5x 43% coverage 1.4 million hetSNPs n Novogene Case 2
- 29. 29 allotetraploid cotton Genome DNA Methods: de novo and Transcriptome Sequencing n Novogene Case 3 allotetraploid cotton ~96% of the estimated allotetraploid genome (total scaffold length 2.4/2.5 Gb) 265,279 contigs (N50=34.0 kb) and 40,407 scaffolds (N50=1.6 Mb) RNA-seq 245x 97 samples(from different organ, developmental Stages and adverse conditions) contig N50 34Kb scaffold N50 1.6M total length 2.43G allotetraploid cotton evolutionary mechanism and function of A- subgenome and D- subgenome. A branch of MYB genes family takes an important role in the fiber development. Many CESA genes got significant positive selection function in domestication De novo
- 30. De novo Sequencing Publications 30
- 31. l Brief Introduction Applying next-generation sequencing and state-of-the-art assembly algorithms make the construction of pan-genome map feasible. Constructing genome maps for several individuals provides unprecedented opportunities to investigate the detailed genetic diversity at population level. Pan-genome Sequencing ATGCTACGGTAACCCTGATTGCAATG ? ? ? ? ? ? ? ? ? ? ? ? 。。。 。。。 ATGCTACGGTAACCCTGATTGCAATG ATGCTACGGTAACCCTGATTGCAATG 。。。 。。。
- 32. Ø Key Points The pan-genome is a superset of all the genes in all the strains of a species. ： ü Core Genome: Containing genes present in all strains; ü Dispensable Genome: Containing genes present in two or more strains; ü Specific Gene: Specific to single strain. Core genome dispensable genome specific genome
- 33. l Pan-Genome Sequencing Material selection and QC Library Construction Genome preliminarily assembly Pan-genome Construction Customized bioinformatics analysis Gene Annotation comparative genomics analysis SNP/InDel/SV/CNV / novel sequence Gene family analysis Phylogenetic analysis Co-linear analysis Sample genome : 60X Complex genome: 100X 230bp/500bp/2K /5K
- 34. Pan-genome analysis of soybean wild relatives（IF：39.08）
- 35. Leading Edge Genomic Services & Solu5ons Organizations Collaborated with Novogene in 2014
- 36. 36 Look forward to your sincere cooperation ! Website: www.novogene.com Muchas gracias por su atención! Preguntas???