Pcr 12

2.112 visualizações

Publicada em

Publicada em: Educação
0 comentários
1 gostou
Estatísticas
Notas
  • Seja o primeiro a comentar

Sem downloads
Visualizações
Visualizações totais
2.112
No SlideShare
0
A partir de incorporações
0
Número de incorporações
4
Ações
Compartilhamentos
0
Downloads
68
Comentários
0
Gostaram
1
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Pcr 12

  1. 1. REAÇÃO EM CADEIA DA POLIMERASE (PCR)
  2. 2. PCRPolymerase Chain Reaction Amplificação in vitro de uma seqüência específica de DNA * replicação in vitro
  3. 3. Aplicações da Técnica de PCR  Diagnóstico de doenças infecciosas e genéticas  Amplificação de genes para posterior clonagem e expressão  Determinação de variabilidade genética  Deteção de OGMs  Sexagem de embriões  Estudo da expressão gênica
  4. 4. História Kary Mullis (1983)  Prêmio Nobel Química (1993)  Revolucionou genética pesquisa genética medicina forense genética molecular
  5. 5. Componentes da reação DNA molde Oligonucleotídeos (primer) dNTP’s DNA Polimerase Magnésio Tampão Água
  6. 6. Equipamento TERMOCICLADOR
  7. 7. CICLOS Programa PCR94 0C por 5 min94 0C por 1 min55 0C por 1 min 35 ciclos72 0C por 1 min72 0C por 5 min4 0C
  8. 8. ETAPAS -Extração de DNA-Desenho dos Primers -Reação de PCR- Análise dos resultados
  9. 9. Obtenção do DNA genômico
  10. 10. DELINEAMENTO DE PRIMERS Os iniciadores (oligos / primers) são a chave do sucesso ou da falha de um experimento com PCR.- Tamanho dos primers;- Estabelecimento das temperaturas corretas a serem utilizadas;
  11. 11. DELINEAMENTO DE PRIMERSPrimer Forward 5’ TAGAAGCTTCCAGCCATGAACTCAG 3’Tm: 57.9Enzima: Hind IIIAnelamento: 16 ntTotal primer: 25 ntPrimer Reverse 5’ ACGGAATTCTCAGAGTGCAGTTTG 3’Tm: 56.4Enzima: Eco RIAnelamento: 15 ntTotal primer: 24 nt
  12. 12. ANELAMENTO E POLIMERIZAÇÃO
  13. 13. ETAPAS DA PCR 30-60C
  14. 14. ETAPAS DA PCRDESNATURAÇÃOANELAMENTOPOLIMERIZAÇÃO
  15. 15. Eletroforese
  16. 16. Eletroforese em Gel de Agarose
  17. 17. Eletroforese em gel de agarose
  18. 18. Visualização do DNA em luz ultravioleta
  19. 19. ResultadosEletroforese do DNA em gel de agarose 0.8%
  20. 20. Resultados
  21. 21. Limitações Extração do DNA da amostra é crítica Alguns compostos podem inibir a polimerase Condições específicas para cada reação Falsos resultados positivos devido a contaminação. Falsos resultados negativos.  Análises conduzidas em laboratórios especializados.
  22. 22. http://www.pcrlinks.com/http://www.ncbi.nlm.nih.gov/
  23. 23. Tipos de PCR·AFLP ·PCR-ELISA·Alu-PCR ·PCR-RFLP·Asymmetric PCR ·PCR-SSCP·Colony PCR ·QC-PCR·DD-PCR ·RACE·Degenerate PCR ·RAPD·Hot-start ·Real-Time PCR·In situ PCR ·Rep-PCR·Inverse PCR ·RT-PCR·Long-PCR ·TAIL-PCR·Multiplex PCR ·Touchdown PCR·Nested PCR ·Vectorette PCR
  24. 24. AditivosPCR Additivos DMSO (dimethyl sulfoxide) genomas ricos em GC Formamide Non-ionic detergents –Triton X 100 Tween 20 or NP-40 TMAC (tetramethylammonium chloride) BSA (bovine serum albumin)

×