Aulauergs 120606185224-phpapp02

417 visualizações

Publicada em

MOLECULAR

Publicada em: Tecnologia
  • Seja o primeiro a comentar

  • Seja a primeira pessoa a gostar disto

Aulauergs 120606185224-phpapp02

  1. 1. Aplicação dos marcadores moleculares em plantas Profa. Adriana Cibele de Mesquita Dantas
  2. 2. Biotecnologias em plantas • Biologia Celular •Micropropagação •Embriogenese somática •Resgate de embriões •Semente sintética •Fusão de protoplasto •Haplodiploidização •Variação somaclonal • Biologia Molecular • Marcadores moleculares • Análise da diversidade genética • Mapeamento genético de ligação •Seleção assistida •Genômica funcional • Transformação genética •Proteoma
  3. 3. Marcadores genéticos Melhoramento tradicional Genética mendeliana Genética de populações Genética molecular Organização do genoma Sequenciamento Transferência gênica
  4. 4. Métodos de melhoramento Germoplasma Seleção e avaliação agronômica Seleção Indução à mutação Variação somaclonal Hibridação convencional Transformação genética Hibridação somática (Fusão de protoplastos) Variedade comercial Métodos aplicados ao melhoramento genético de plantas
  5. 5. Melhoramento tradicional • Seleção de genótipos em plantas são necessários vários ciclos de seleções e recombinações; • Características de interesse são geralmente poligênicas, • Herança complexa, difícil identificação; • Grande número de cruzamentos; • Muito esforço e planejamento; • Polimorfismo limitado para ligação gênica
  6. 6. Melhoramento Tradicional Receptividade do estigma estádio balão Emasculação Estoque de pólen -20C Polinização manual
  7. 7. Até 1960 – Marcadores morfológicos 1.Primeira versões dos mapas genéticos; 2.Associação das marcas com características fenotípicas; 3.Restrito a poucas plantas (tomate, ervilha, milho); 4.Número reduzido de marcadores para um enorme espectro de espécies vegetais; 5.Influência do ambiente e ação gênica; 6.Identificados a nivel de planta inteira ou adulta.
  8. 8. DETECÇÃO DO DOGMA CENTRAL DNA armazena a informação RNA transfere a informação Proteína executa a função DNA armazena a informação RNA transfere a informação Proteína executa a função genes ambiente FENÓTIPO
  9. 9. Ampliação dos marcadores moleculares MARCADORES Morfológicos Bioquímicos Marcadores moleculares DNA RNA
  10. 10.  deve ser capaz de diferenciar progenitores  deve ser reproduzido com precisão na progênie Do ponto de vista molecular, um marcador genético (ou loco marcador) serve para identificar um local ou uma região de um cromossomo. Um marcador genético ideal deve apresentar uma série de atributos: alto nível de polimorfismo estabilidade em diferentes ambientes detectar grande número de locos não ligado Marcador genético é uma característica que é capaz de detectar diferenças entre dois ou mais indivíduos ou organismos.
  11. 11. CCTGATGGATCGCGTACGTTGTACGCACAGTGTCGAAAAAG CATACGGGGACTGCACGTACACGTAGCACGGCGTCGATTTT GACGTGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTG CAGCGTGTGTACCCATGCGCGAAGTATGT C T G G A C T
  12. 12. Marcadores moleculares • São neutros em relação a efeitos epistáticos ou pleitrópicos; • Identificação de genótipos em estádios iniciais da planta; • Acelera o processo de seleção e de recombinações desejáveis. • Todo e qualquer fenótipo molecular proveniente de um gene expresso (isoenzimas, proteínas, RNAm); • ou de um segmento específico de DNA (regiões expressas ou não do genoma).
  13. 13. Três grandes aplicações • Análise da diversidade genética entre indivíduos • Construção de mapas genéticos de ligação • Seleção assistida por marcadores moleculares (SAM)
  14. 14. Classes dos marcadores Isoenzimas Proteinas de sementes RFLP, minissatélites (VNTR) RAPD, SSR, rDNA - ITS AFLP; cDNA+AFLP bioquímicos restrição e hibridação de sequências de dna reação polimerase em cadeia (PCR) PCR + restrição + DNA recombinante PCR específicos em organelas MitDNA, cpSSR
  15. 15. Ferramentas PCR Termociclador PCR TermocicladorEletroforese
  16. 16. •O termo eletroforese foi criado por Michaelis em 1909, descreve migração de moléculas sob a influência de um campo elétrico; •Separação dos fragmentos da molécula de DNA, RNA e proteínas em gel •Separação em função de suas cargas elétricas, de seus pesos moleculares e de suas conformações. Eletroforese
  17. 17. Carregando o gel com as amostras
  18. 18. Revelando gel de agarose em U.V. – brometo de etídeo
  19. 19. Eletroforese de isoenzimas * Isoenzimas - diferentes formas moleculares (variantes) de uma mesma enzima, apresentando função idêntica ou similar, presente num mesmo indivíduo (Markert & Moller, 1959). Gel de Araucaria angustifolia 6PGDH -CM MANTOVANI, 2003 Co-dominância
  20. 20. Isoenzimas • Distintas formas de uma mesma enzima, as isoenzimas, codificadas por diferentes alelos, podem ser detectadas em diferentes regiões do gel, caso apresentem diferentes mobilidades eletroforéticas • Cada banda revelada no gel se constitui num marcador genético, pois entende-se por marcador genético a constituição genotípica de um loco num determinado indivíduo
  21. 21. Aplicações das isoenzimas • Kessel e Milchemore (1986) e Falcão e Contel (1991) - abordam que as variações isoenzimáticas são de grande importância nos estudos genéticos: • Indicadores dos níveis de polimorfismo • Relacionamento filogenético • Identificação de raças, espécies e populações • Valiosa ferramenta para estudos evolutivos e taxonômicos.
  22. 22. Fosfoglucomutase (PGM) monomérica alelo 1 alelo 2 alelo 3 Fosfoglucomutase (PGM) monomérica alelo 1 alelo 2 alelo 3 Fosfoglucomutase (PGM) monomérica alelo 1 alelo 2 alelo 3 MANTOVANI, 2003 Resultado da presença de mais de um gene codificando cada uma das enzimas Fosfoglucomutase (PGM) monomérica alelo 1 alelo 2 alelo 3 Fosfoglucomutase (PGM) monomérica alelo 1 alelo 2 alelo 3 Fosfoglucomutase (PGM) monomérica alelo 1 alelo 2 alelo 3 Fosfoglucomutase (PGM) monomérica alelo 1 alelo 2 alelo 3 Fosfoglucomutase (PGM) monomérica alelo 1 alelo 2 alelo 3 Fosfoglucomutase (PGM) monomérica alelo 1 alelo 2 alelo 3 MANTOVANI, 2003 Resultado da presença de mais de um gene codificando cada uma das enzimas
  23. 23. Estrutura genética de populações
  24. 24. Genética de Populações Teorema de Hardy-Weinberg Em populações infinitamente grandes, com cruzamentos ao acaso (panmítica), que não estiverem sofrendo influência dos fatores evolutivos (mutações, seleção natural, migrações), não haverá alteração do pool gênico, isto é, as freqüências gênicas e genotípicas se manterão constantes.
  25. 25. ORGANIZAÇÃO DA VARIABILIDADE GENÉTICA • Base para um programa pré-melhoramento • Caracterização morfológica e molecular • Caracterização de bancos de germoplasma • Coleções e seleções disponíveis em programas de melhoramento • Cultivares comerciais
  26. 26. Análise da variabilidade genética
  27. 27. Reação de polimerase em cadeia (PCR) Amplificação do DNA Técnica usada para amplificar uma região específica de DNA visando produzir quantidade de DNA suficiente
  28. 28. Extração de DNA (Doyle e Doyle, 1987) Amostra Sol. extratora pellet 1.5 1.0 0.5 Adição de CIA 1.5 1.0 0.5 Adição de CIA 1.5 1.0 0.5 Adição de CIA Centrifugação RNAse
  29. 29. Constatações • Logo após Kary Mullis ter descoberto a Polymerase Cadeia Reação (PCR) ele percebeu que primers curtos ligariam a vários locais em um genoma e assim poderiam produzir fragmentos múltiplos. • Welsh & McClelland (1990) e Williams et al. (1990) desenvolveram Random Amplified Polymorphic DNA (RAPD) - técnica que utiliza primer com 10 bases, • O uso da reação da polimerização em cadeia (PCR) proporciona a amplificação de um segmento de DNA, delimitado por dois iniciadores (primers) com 10 pares de bases, que são complementares a dois sítios, um em cada fita do DNA, posicionados inversamente a uma distância geralmente não superior a 4kb.
  30. 30. DNA Primers encontram-se na mesma direção, amplificação NÃO acontecerá  Primer se anela a muitos locais no DNA  Quando primer se anela em direção oposta – amplificação
  31. 31. DNA Primers são separados em pouca distância, fragmento É AMPLIFICADO 100 - 1,500 bases RAPD Dominante
  32. 32. RAPD (Random Amplified Polymorphic DNA) A A B B
  33. 33. A1A1 A1A2 A2A2 Marcadores “dominantes”
  34. 34. Ind. L1 L2 L3 L4 L5 L6 L7 L8 01 02 03 04 05 06 07 08 09 10 0 1 0 0 1 0 0 0 1 0 1 0 0 1 1 0 1 1 0 1 0 0 1 1 0 1 1 0 1 0 1 0 1 1 0 0 0 1 0 1 1 1 1 0 1 1 1 0 0 1 0 1 0 1 1 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 0 1 1 1 01 02 03 04 05 06 07 08 09 10 L2 L1 L3 L5 L6 L4 L7 L8 Marcadores “dominantes”
  35. 35. QUAIS AS POLIMÓRFICAS? QUAIS AS (CO)SEGREGANTES? Análise em gel de RAPD
  36. 36. Transposons Sequências de inserçãoSatélites Microssatélites Minissatélites Genoma Repetições em tandem Repetições dispersas Onde estão localizados no genoma os marcadores? Introns Fragmentos de genes RAPDs AFLPs outros Genes e sequências relacionadas DNA extragênico DNA repetitivoDNA codificante DNA não codificante DNA repetitivo
  37. 37. Microsatélites • SSR – Simple Sequence Repeats – Pequenas sequências (“sequence motif”) com 1 a 4 nucleotídeos repetidos em tandem - Amplificados via PCR – Classe de marcadores moleculares mais polimórficos Sinonímias SSR (Simple Sequence Repeats); STMS (Sequence Tagged Microsatellites); SSLP (Single Sequence Length Polymorphisms); Onde são encontrados ??? Mamíferos: (CA)n ( 50.000 a 100.000 vezes no genoma) Plantas: (AT)n Mitocôndrias Cloroplastos
  38. 38. M homozigoto heterozigoto M homozigoto heterozigoto Marcador co-dominante Marcador multialélico
  39. 39. A1A1 A1A2 A2A2 Marcadores “co-dominantes”
  40. 40. Ind. L1 01 02 03 04 05 06 07 08 09 10 1/3 3/4 2/3 3/3 1/3 1/1 1/3 1/4 3/3 1/2 1 2 3 4 01 02 03 04 05 06 07 08 09 10 Marcadores “co-dominantes”
  41. 41. Sequenciamento de regiões microssatélites
  42. 42. Mapeamento genético de ligação • Identificar marcadores genéticos ligados aos genes de interesse, nos respectivos cromossomos; •Disponibilizados para as principais espécies de importância agronômica; •QTLs e/ou QRLs rastreados e etiquetados, visando uma melhoria na eficiência da seleção. Xu & Korban, 2000 Gene Vf (Sarna) AFLP
  43. 43. CARACTERIZAÇÃO BIOLÓGICA Fenotipagem (Locos de resistência) A) Melrose x Gala – 86 plantas B) M13/91 x Gala - 129 plantas C) M13/91 x M46/94 -185 plantas
  44. 44. M9 x Marubakaido - 85 F1 (QTLs - loci quantitativos) A BA B pulgão espinhos Perfilhos uniformes tipo spur Perfilhos uniformes
  45. 45. S C M Progênie F1 (Santa Rosa x Chatard) Marcas segregantes
  46. 46. 840 marcadores: 475 AFLPs 235 RAPDs 129 SSRs
  47. 47. Caracterização molecular Identificação de marcas candidatas
  48. 48. Desenvolvimento de um SCAR (Sequence characterized amplified RAPD) 1) identificação de um iniciador que confere polimorfismo a dois bulks de DNA com fenótipos contrastantes, 2) o isolamento e a clonagem do fragmento amplificado em um vetor (plasmideo), 3) sequenciamento do fragmento isolado, 4) desenho dos iniciadores de tamanho maior que os decâmeros, 5) teste final em plantas.
  49. 49. Validação das Marcas – Desenvolvimentos de marcadores específicos (Clonagem por mapeamento)
  50. 50. Seleção assistida por marcadores (SAM)
  51. 51. Atributos Isoenzimas Proteínas de sementes RFLPs RAPDs Microssatélites AFLPs Nível de Polimorfismo baixo alto baixo-alto baixo-alto muito alto muito alto Estabilidade ambiental moderada alta alta alta alta alta Número de locos moderado (<50) baixo (<10) alto alto alto alto Expressão genética co-dominate co-dominante co-dominante dominante co-dominante dominante Número de alelos por loco 2-5 multialélico multialélico 2 multialélico 2 Distribuição no genoma regiões de cópia única regiões de cópia única várias ao acaso ao acaso ao acaso Acessibilidade tecnológica muito alta muito alta média muito alta muito baixa média Aplicabilidade no melhoramento rápido, baixo custo rápido, baixo custo lento, custo médio rápido, baixo custo lento, custo alto rápido, custo baixo Identificação de genótipos baixa baixa alta muito alta muito alta muito alta Avaliação de germoplasma média baixa alta alta alta muito alta Mapeamento genético baixa muito baixa alta alta muito alta alta Mapeamento de regiões específicas baixa inadequado média muito alta média muito alta Mapeamento comparativo baixa inadequado muito alta baixa alta baixa Genética de Autógamas baixa baixa média alta muito alta muito alta Genética de Alógamas média baixa média alta muito alta muito alta Análise Filogenética média baixa muito alta média alta média Adaptado de Gepts (1993) e Ferreira & Grattapaglia (1995).
  52. 52. Marcador molecular Populações segregantes Mapeamento de QRL/ QTL Polimorfismo SeleSeleçção assistidaão assistida Marcador molecular Populações segregantes Mapeamento de QRL/ QTL Polimorfismo SeleSeleçção assistidaão assistida Melhoramento molecular (molecular breeding) Bibliotecas cDNA Expressão gênica - RNAm Bibliotecas cDNA Expressão gênica - RNAm Proteôma Banco de dados

×