Aulamolecular2 120606181016-phpapp01

592 visualizações

Publicada em

Molecular 3

Publicada em: Tecnologia
0 comentários
0 gostaram
Estatísticas
Notas
  • Seja o primeiro a comentar

  • Seja a primeira pessoa a gostar disto

Sem downloads
Visualizações
Visualizações totais
592
No SlideShare
0
A partir de incorporações
0
Número de incorporações
1
Ações
Compartilhamentos
0
Downloads
34
Comentários
0
Gostaram
0
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Aulamolecular2 120606181016-phpapp01

  1. 1. Aplicação de marcadores moleculares na agricultura Prof. Adjunta Adriana Dantas Engenharia de Bioprocessos e Biotecnologia UERGS, Bento Gonçalves, RS
  2. 2. DOGMA CENTRAL DNA armazena a informação RNA transfere a informação Proteína executa a função DNA armazena a informação RNA transfere a informação Proteína executa a função genes ambiente FENÓTIPO
  3. 3. MARCADORES ⇒ MARCAS ⇒ GENES? MARCADORES Morfológicos Bioquímicos Marcadores moleculares DNA RNA
  4. 4. Ferramentas da Biologia Molecular Enzima de restriçãoEnzima de restriçãoCAS COLAR CAS COLARCAS COLARCAS COLARCAS COLAR CAS COLAR CAS COLAR CAS COLAR DNA ligase CAS COLAR CAS COLARCAS COLARCAS COLARCAS COLAR CAS COLAR CAS COLAR CAS COLAR DNA ligase PCR Termociclador PCR TermocicladorEletroforese
  5. 5. Ferramentas da Biologia Molecular Enzima de restriçãoEnzima de restriçãoCAS COLAR CAS COLARCAS COLARCAS COLARCAS COLAR CAS COLAR CAS COLAR CAS COLAR DNA ligase CAS COLAR CAS COLARCAS COLARCAS COLARCAS COLAR CAS COLAR CAS COLAR CAS COLAR DNA ligase PCR Termociclador PCR TermocicladorEletroforese
  6. 6. GENOMA ENZIMA DE RESTRIÇÃO fragmentos do genoma Enzimas de restrição
  7. 7. M ic r o r g a n is m o E n z im a S e q u ê n c ia A l v o E c o R IE s c h e r i c h i a c o l i B a c i l lu s a m y l o l i q u e f a c i e n s H H a e m o p h i l u s a e g y p t i u s H a e m o p h i l u s a e g y p t i u s H a e m o p h i l u s a e g y p t i u s P r o v i d e n c i a s t u a r t i i S t r e p t o c o c c u s a l b u s G T h e r m u s a q u a t i c u s S e r r a t i a m a r c e s c e n s B r e v i b a c t e r i u m a l b i d i u m B a c i l lu s g l o b i g i i B a m H I B g l I I P s t I B a l I S m a I H a e I I I T a q I S a l I H i n d I I I H a e I I G A A T T C C T T A A G G G A T C C C C T A G G A G A T C T T C T A G A P G C G C P i P i C G C G P u y u A A G C T T T T C G A A C T G C A G G A C G T C G T C G A C C A G C T G T G G C C A A C C G G T A G G C C T T C C G G A C C C G G G G G G C C C T C G A A G C T Tabela 1. Algumas endonuclease de restrição: origem e sítios de clivagem. A seta indica o local de clivagem. Pu e Pi referem-se, respectivamente, a qualquer purina e pirimidina.
  8. 8. Clivam o DNA somente em determinadas seqüências de nucleotídeos, normalmente curtas, 4 – 8 pares de bases. Cada enzima reconhece um sítio de clivagem específico!!! A clivagem do DNA –cortam o DNA em sítios específicos DNA na célula - moléculas muito grandes Endonucleases de restrição ou enzimas de restrição
  9. 9. a ) C liv a g e m n o e ix o d e s im e t r ia M o lé c u la s c o m e x tr e m id a d e s a b r u p t a s M o lé c u la s c o m e x tr e m id a d e s c o e s iv a s b ) C liv a g e m s im é t r ic a m e n te s it u a d a a o r e d o r d o e ix o d e s im e tr ia . . . T C G A . . . . . . A G C T . . . 3 ’ 5 ’ 3 ’ 5 ’ + . . . G A A T T C . . . . . . C T T A A G . . . + 3 ’ 5 ’ 3 ’ 5 ’ Figura 1. Dois tipos de clivagem feitas por enzimas de restrição. As setas indicam os sítios de clivagem. As linhas pontilhadas representam o centro de simetria da sequência.
  10. 10. A separação dos fragmentos da molécula de DNA em gel de eletroforese Características do DNA Separação por tamanho
  11. 11. Ferramentas da Biologia Molecular Enzima de restriçãoEnzima de restriçãoCAS COLAR CAS COLARCAS COLARCAS COLARCAS COLAR CAS COLAR CAS COLAR CAS COLAR DNA ligase CAS COLAR CAS COLARCAS COLARCAS COLARCAS COLAR CAS COLAR CAS COLAR CAS COLAR DNA ligase PCR Termociclador PCR TermocicladorEletroforese
  12. 12. CAS COLAR CAS COLAR DNA ligase Liga o cDNA em vetores apropriados
  13. 13. DNA vetor Fragmento de DNA a ser clonado Ligação catalisada pela DNA ligase DNA recombinante Transformação DNA recombinante Cromossomo bacteriano
  14. 14. Plasmídeo de E.coli DNA DNA ligase Plasmídeo híbrido Enzima Enzima GCA T T ACG TGCA TGCA ACGT ACGT TGCA ACGT TG CA TG CA AC GT AC GT Construção de uma molécula de DNA híbrida a partir de fragmentos de diferentes organismos obtidos com o uso de enzima de restrição.
  15. 15. R e s i s t ê n c i a a a m p ic ilin a P s t l E c o R I C la I H in d I I I B a m H I S a lI R e s i s t ê n c i a a t e t r a c i c l in a O r ig e m d a r e p l ic a ç ã o d o p la s m í d e o A B R A m p R R R T c R T c R T c p B R 3 2 2 p B R 3 2 2 r e c i r c u la c iz a d o S í t io H IB a m B a m H I D N A lig a s e S í t io H IB a m D N A E x ó g e n o B a m H I T r a n s f o r m a ç ã o d e E . c o li P la s m í d e o h i b r i d o c o n t e n d o D N A E x ó g e n o T r a n s f o r m a n t e s r e s is t e n t e s a a m p ic il in a e t e t r a c ic lin a T r a n s f o r m a n t e s r e s is t e n t e s a a m p ic ilin a m a s s e n s í v e l a t e t r a c i c lin a p B R 3 2 2 A m p A m p Estrutura do plasmídeo pBR322, um típico vetor de clonagem. A seta indica a direção da replicação do DNA a partir da sua origem (A). Método da inativação insercional para isolar plasmídeos contendo DNA exógeno. A insersão do DNA exógeno no plasmídeo pBR322 causa inativação da resistência à tetraciclina, permitindo o isolamento de transformantes contendo o fragmento de DNA clonado (B).
  16. 16. CARTUCHO DE CLONAGEM - Polylinker Ligação com várias enzimas diferentes, vários sítios de clonagem
  17. 17. Ferramentas da Biologia Molecular Enzima de restriçãoEnzima de restriçãoCAS COLAR CAS COLARCAS COLARCAS COLARCAS COLAR CAS COLAR CAS COLAR CAS COLAR DNA ligase CAS COLAR CAS COLARCAS COLARCAS COLARCAS COLAR CAS COLAR CAS COLAR CAS COLAR DNA ligase PCR Termociclador PCR TermocicladorEletroforese
  18. 18. Eletroforese (Michaelis, 1909) + — Géis Amido Agarose Acrilamida Soluções-tampões O sentido e a velocidade de migração é determinado pelo tamanho e carga das moléculas
  19. 19. O princípio básico envolvido na obtenção e detecção de cada classe de marcador bioquímico ou de DNA reside no uso de eletroforese. O termo eletroforese foi criado por Michaelis em 1909, para descrever migração de colóides sob a influência de um campo elétrico. Seu princípio é simples: moléculas de carga negativa migram para o pólo positivo, e moléculas com carga positiva migram para o pólo negativo. A eletroforese visa à separação de moléculas em função de suas cargas elétricas, de seus pesos moleculares e de suas conformações, em suportes porosos (géis) e soluções- tampões (estabilizam o pH do meio e permitem o fluxo de corrente elétrica).
  20. 20. AGAROSE
  21. 21. Carregando o gel com as amostras
  22. 22. Revelando gel de agarose em U.V. – brometo de etídeo
  23. 23. Gel acrilamida
  24. 24. Exemplo, de caso resolvido pelo gel vertical de acrilamida corado com nitrato de prata Sangue retirado de chapéu e jeans S = suspeito V- vítima Análise DNA forense
  25. 25.  isoenzimas  RAPD  MICROSSATÉLITES - SSR  AFLP  RFLP-PCR  cDNA+AFLP  ESTs  SNPs  Marcadores específicos (SCARs, OGMs, etc. ) Tipos de marcadores genéticos
  26. 26. Eletroforese de isoenzimas * Isoenzimas - diferentes formas moleculares (variantes) de uma mesma enzima, apresentando função idêntica ou similar, presente num mesmo indivíduo (Markert & Moller, 1959). Gel de Araucaria angustifolia 6PGDH -CM MANTOVANI, 2003 Co-dominância
  27. 27. Isoenzimas Fosfoglucomutase (PGM) monomérica alelo 1 alelo 2 alelo 3 Fosfoglucomutase (PGM) monomérica alelo 1 alelo 2 alelo 3 Fosfoglucomutase (PGM) monomérica alelo 1 alelo 2 alelo 3 MANTOVANI, 2003 Resultado da presença de mais de um gene codificando cada uma das enzimas
  28. 28. Figura 1. Zimograma de PGM de couve. Início na parte inferior, ânodo no topo.1 = Ribeirão Pires 2620 com bandas na região A e B: B, E, G, H; 2 = 1811 C, G; 3 = Roxa B, C, G, H; 4 = São Roque A, C, E, G, H; 5 = Gigante 915 C, D, F, G, H; 6 = 916 C, G, H; 7 = Crespa Piracicaba A, E, G, H; 8 = Ribeirão Pires 2446 C, G, H; 9 = Crespa Capão Bonito C, E, G; 10 = Tupi B, G, H; 11 = Jundiaí C, F, I; 12 = Mococa C, E, I; 13 = São José C, G, H; 14 = Roxa Monte Alegre A, C, F, I; 15 = Verde-Escura A, C, E, F,
  29. 29. Figura 2. Zimograma de PRX de couve. Início na parte inferior, ânodo no topo. 1 = Ribeirão Pires 2620 com bandas na região A: B1 Região B com banda monomórfica; 2 = 1811 B1; 3 = Roxa B1; 4 = São Roque A1 e B1; 5 = Gigante 915 A1; 6 = 916 B1; 7 = Crespa Piracicaba B1; 8 = Ribeirão Pires 2446 B1; 9 = Crespa Capão Bonito A1 e B1; 10 = Tupi B1; 11 = Jundiaí B1; 12 = Mococa B1; 13 = São José B1; 14 = Roxa Monte Alegre B1; 15 = Verde-Escura A1.
  30. 30. Aplicações
  31. 31. Análise da variabilidade genética
  32. 32. Reação de polimerase em cadeia (PCR) – princípio e aplicação da técnica Replicação do DNA   Técnica usada para amplificar uma região específica de DNA em visando produzir quantidade de DNA suficiente
  33. 33. PCRDesnatura 94 o C Temperatura 100 0 50 Tempo 5’3’ 3’5’
  34. 34. PCRDesnatura 94 o C Temperatura 100 0 50 Tempo 3’5’ 5’3’ Calor
  35. 35. PCRDesnatura 94 o C Anela Primers 50 o C Extende 72 o CTemperatura 100 0 50 Tempo 3’5’ 5’3’ 5’ 5’ Desnatura 94 o C
  36. 36. PCRDesnatura 94 o C Desnatura 94 o C Anela Primers 50 o C Extende 72 o CTemperatura 100 0 50 Tempo 30x 3’5’ 5’3’ Calor Calor 5’ 5’ 5’
  37. 37. PCRDesnatura 94 o C Desnatura 94 o C Anela Primers 50 o C Extende 72 o CTemperatura 100 0 50 Tempo 30x 3’5’ 5’3’ 5’ 5’ 5’ 5’ 5’ 5’
  38. 38. PCR Temperatura 100 0 50 Tempo Desnatura 94 o C Desnatura 94 o C Anela Primers 50 o C Extende 72 o C 30x 3’5’ 5’3’ 5’ 5’ 5’ 5’ 5’ 5’ Calor Calor
  39. 39. PCRDesnatura 94 o C Desnatura 94 o C Anela Primers 50 o C Extende 72 o CTemperatura 100 0 50 Tempo 30x 3’5’ 5’3’ 5’ 5’ 5’ 5’ 5’ 5’ 5’ 5’ 5’ 5’
  40. 40. Fragmento de tamanho definido PCRDesnatura 94 o C Denatura 94 o C Anela Primers 50 o C Extenção 72 o CTemperatura 100 0 50 Tempo 30x 3’5’ 5’3’ 5’ 5’ 5’ 5’ 5’ 5’ 5’ 5’ 5’ 5’
  41. 41. DNA dobra a cada ciclo 0 Ciclos Número de ciclos 3 8 2 4 1 2 4 16 5 32 6 64
  42. 42. ATCTTGTATTCCGGCC CCTTACCGGTATACTA TAGAACATAAGGCCGG5´ 5´ 5´-TAGAACATAAGGCCTA-3´ GGAATGGCCATATGAT 3´- CCTTACCGGTATACTA -5´ ATCTTGTATTCCGGAT CCTTACCGGTATACTA TAGAACATAAGGCCTA GGAATGGCCATATGAT5´ 5´ 5´-TAGAACATAAGGCCTA-3 SIM NÃO ATCTTGTATTCCGGAT CCTTACCGGTATACTA TAGAACATAAGGCCTA GGAATGGCCATATGAT5´ 5´ ATCTTGTATTCCGGCC CCTTACCGGTATACTA TAGAACATAAGGCCGG GGAATGGCCATATGAT5´ 5´ 3´- CCTTACCGGTATACTA -5´
  43. 43. Como funciona MESMO?? Do que precisa??? O que imita???? Reação de PCR
  44. 44. Extração de DNA (Doyle e Doyle, 1987) Amostra Sol. extratora pellet 1.5 1.0 0.5 0.1 1.5 1.0 0.5 0.1 1.5 1.0 0.5 0.1 1.5 1.0 0.5 Adição de CIA 1.5 1.0 0.5 Adição de CIA 1.5 1.0 0.5 Adição de CIA 1.5 1.0 0.5 0.1 Adição de etanol 1.5 1.0 0.5 0.1 Adição de etanol Centrifugação RNAse
  45. 45. Quantificação de DNA 20 50 100 Quantificação DNA (gel agarose 0,8%)
  46. 46. • Logo após Kary Mullis ter descoberto a Polymerase Cadeia Reação (PCR) ele percebeu que primers curtos ligariam a vários locais em um genoma e assim poderiam produzir fragmentos múltiplos • Williams et al. (1990) desenvolveu Random Amplified Polymorphic DNA (RAPD) - uma técnica que utiliza 10 primers de base muito curto para gerar fragmentos de DNAs • Fragmentos de RAPD podem ser separados e usado como marcadores genéticos ou um tipo de impressão digital Constatações
  47. 47. RAPDs (Random Amplified Polymorphic DNA) A A B B
  48. 48. RAPD DNA Primer se liga a muitos locais no DNA Só quando primer locais que liga em direção oposta – amplificação
  49. 49. RAPD DNA Primers encontram-se na mesma direção, amplificação NÃO acontecerá
  50. 50. RAPD DNA > 2,000 bases
  51. 51. DNA Primers são separados em pouca distância, fragmento É AMPLIFICADO 100 - 1,500 bases RAPD Dominante
  52. 52. A1A1 A1A2 A2A2 Marcadores “dominantes”
  53. 53. Ind. L1 L2 L3 L4 L5 L6 L7 L8 01 02 03 04 05 06 07 08 09 10 0 1 0 0 1 0 0 0 1 0 1 0 0 1 1 0 1 1 0 1 0 0 1 1 0 1 1 0 1 0 1 0 1 1 0 0 0 1 0 1 1 1 1 0 1 1 1 0 0 1 0 1 0 1 1 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 0 1 1 1 01 02 03 04 05 06 07 08 09 10 L2 L1 L3 L5 L6 L4 L7 L8 Marcadores “dominantes”
  54. 54. A1A1 A1A2 A2A2 Marcadores “co-dominantes”
  55. 55. O problema da “dominância” 1 2 01 02 03 1/1 1/2 2/2 1 01 02 03 1/? 1/? 2/2 1 1 0 1 2 01 02 03 1/1 1/2 2/2 1 01 02 03 1/? 1/? 2/2 1 1 0
  56. 56. Ind. L1 01 02 03 04 05 06 07 08 09 10 1/3 3/4 2/3 3/3 1/3 1/1 1/3 1/4 3/3 1/2 1 2 3 4 01 02 03 04 05 06 07 08 09 10 Marcadores “co-dominantes”
  57. 57. OQUE É IMPORTANTE? QUAIS AS MONOMÓRFICAS? QUAIS AS POLIMÓRFICAS? QUAIS AS SEGREGANTES?
  58. 58.  deve ser capaz de diferenciar progenitores  deve ser reproduzido com precisão na progênie   Do ponto de vista molecular, um marcador genético (ou loco marcador) serve para identificar um local ou uma região de um cromossomo. Um marcador genético ideal deve apresentar uma série de atributos: alto nível de polimorfismo estabilidade em diferentes ambientes detectar grande número de locos não ligados herança simples Marcador genético é uma característica que é capaz de detectar diferenças entre dois ou mais indivíduos ou organismos.
  59. 59. RAPDs (Randomly Amplified Polymorphic DNA) Amplificação de um segmento de DNA delimitado por dois iniciadores (ou primers, ou oligonucleotídeos), comumente com 10 pares de bases, que são complementares a dois sítios de nucleotídeos, um em cada fita do DNA, posicionados inversamente a uma distância geralmente não superior a 4kb.
  60. 60. Marcador molecularMarcador molecular Todo e qualquer fenótipo molecular proveniente de um  gene expresso, (isoenzimas, proteinas, RNAm)  ou  de  um  segmento específico de DNA  (regiões  expressas ou não do genoma).
  61. 61. Transposons Sequências de inserçãoSatélites Microssatélites Minissatélites Genoma Repetições em tandem Repetições dispersas Onde moram os marcadores??? Introns Fragmentos de genes RAPDs AFLPs outros Genes e sequências relacionadas DNA extragênico DNA repetitivoDNA codificante DNA não codificante DNA repetitivo
  62. 62. GGCTATCAAAGACCTGAAGAAGCCCAGTATAACCTTAGGAAAAGCTCCTGATTTGAATAA GCATACAAATCAATTNTATCTGGCATGAATGCAGCCAAACTCGACCCTGATGATGTATGC CTTATCTGGCTGCCGCGATGCAGTTCTTTGAGGGATCATGTCCTGAGGACTGGACTAGCT GGAATCCTGATAGCTCGGAAGGGAGACAAGATCACTCCGGATTCTCTTGTGGACATAAG ACGTACTGATGTGGAAGGGAATTGGGCTCTAACAGGGGGCATGGAGTTGACAAGGGACC TACTGTTTCAGAGCATGCATCTCTCTCTCTTCCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCGACCCTACTGTTTC ATGTGCGCTAACTGGAGTACCATACCAAATTTCAGATTCCTGGCTGGGGCTATCAAAGAC GAAGAAGCCCAGTATAACCTTAGGAAAAGCTCCTGATTTGAATAAAGCATACAAATCAA NTATCTGGCATGAATGCAGCCAAACTCGACCCTGATGATGTATGCTCTTATCTGGCTGC GCGATGCAGTTCTTTGAGGGATCATGTCCTGAGGACTGGACTAGCTATGGAATCCTGATA GCTCGGAAGGGAGACAAGATCACTCCGGATTCTCTTGTGGACATAAGACGTACTGATGTG GAAGGGAATTGGGCTCTAACAGGGGGCATGGAGTTGACAAGGGACCCTACTGTTTCAGA CATGCATCTCTGGTTGGCCTTCTCTTGAGTTTATATAGGTTGAGCAAAATCTCCGGGCAG TACCGGCAATTACAAGACAAACATCGCGGATACGAATAGAGCAGATTTTTGAGACAGCC CTTTGCAAAAATCGTAGAACATCATACTTTGATGACGACCCACAAAATGTGCGCTAACT GAGTACCATACCAAATTTCAGATTCCTGGCTGGGGCTATCAAAGACCTGAAGAAGCCCAG TAACCTTAGGAAAAGCTCCTGATTTGAATAAAGCATACAAATCAATTNTATCTGGCATGA ATGCAGCCAAACTCGACCCTGATGATGTATGCTCTTATCTGGCTGCCGCGATGCAGTTCT GAGGGATCATGTC CTGAACTGTAGACTAGCTATGGAATCCTGATAGCTCGGAAGGGAG CAAGATCACTCCGGATTCTCTTGTGGACATAAGACGTACTGATGTGGAAGGGAATTGGGC CTAACAGGGGGCATGGAGTTGACAAGGGACCCTACTGTTTCAGAGCATGCATCTCTGGTT GGCCTTCTCTTGAGTTTATATAGGTTGAGCAAAATCTCCGGGCAGAATACCGGCAATTAC GACAAACATCGCGGATACGAATAGAGCAGATTTTTGAGACAGCCCCCTTTGCAAAAATC AGAACATCATACTTTGATGACGACCCACAAAATGTGCGCTAACTGGAGTACCATACCAAA ? ACTGTTTCAGAGCATGC CTCTCTCTCGACCCTACTGTTTC CTGAGGACTG CTGAGGACTG CTGAGGACTG
  63. 63. Microssatélites
  64. 64. Consistem de pequenas seqüências (“sequence motif”) com 1 a 4 nucleotídeos de comprimento, repetidas em tandem. Mononucleotídeos TGCATTGAAAAAAAAAAAAAAACTGGATC Dinucleotídeos TGCATTGTATATATATATATATACTGGATC Trinucleotídeos TGCATTGTGATGATGATGATGACTGGATC Tetranucleotídeos TGCATTGTGACTGACTGACTGACCTGGATC
  65. 65. Características M homozigoto heterozigoto M homozigoto heterozigoto Marcador co-dominante Marcador multialélico
  66. 66. Detecção de locos SSR CACACA GTGTGT CACACA GTGTGT (CA)3 (CA)3 CACACA GTGTGT CACACACACA GTGTGTGTGT (CA)3 (CA)5 CACACACACA GTGTGTGTGT CACACACACA GTGTGTGTGT (CA)5 (CA)5 Amostra 1 Amostra 3Amostra 2
  67. 67. 5´ 5´ 3´GTGTGTGTGT CACACACACA GTGT 3´ Taq iniciador reverse iniciador forward P2 GTGTGT5´ 3´ 3´ CACACA 5´ P2 P1 P1 GTGTGTGTGT5´ 3´ 3´ CACACACACA 5´ F1 F1 5´ 3´ 3´ GTGTGTGTGT CACACACACA 5´ 5´ 3´ 3´ GTGTGT CACACA 5´ Na recombinação dos alelos
  68. 68. Microsatélites • SSR – Simple Sequence Repeats – Pequenas sequências (“sequence motif”) com 1 a 4 nucleotídeos repetidos em tandem - Amplificados via PCR – Classe de marcadores moleculares mais polimórficos SinonimiasSinonimias SSR (Simple Sequence Repeats);SSR (Simple Sequence Repeats); STMS (Sequence Tagged Microsatellites);STMS (Sequence Tagged Microsatellites); SSLP (Single Sequence Length Polymorphisms);SSLP (Single Sequence Length Polymorphisms); Onde são encontrados ??? Mamíferos: (CA)n ( 50.000 a 100.000 vezes no genoma) Plantas: (AT)n Mitocôndrias MICROSSATÉLITES
  69. 69. Aplicações dos Microssatélites Genetic Characterization of Active Bank of Germoplasm of Pineapple Guava (Acca Sellowiana) by transfer of markers Microsatellites of Eucalyptus spp Karine Louise dos Santos1 , Leocir José Welter1 , Adriana Cibele de Mesquita Dantas1 , Jean Pierre Ducroquet2 , Rubens Onofre Nodari1 1Laboratório de Fisiologia do Desenvolvimento e Genética Vegetal, CCA/UFSC, Florianópolis, SC, Brasil 2 Estação Experimental de São Joaquim, Epagri, São Joaquim, SC, Brasil
  70. 70. Modelos para explicar os processos mutacionais envolvidos na formação das repetições •Escorregões da DNA polimerase •Crossing over desigual Como os microsatélites são formados ?
  71. 71. Fita nascente Fita molde Replicação +1 repeat -1 repeat Slippage Misalignment
  72. 72. Se você escolheu os microssatélites como marcador molecular para o seu estudo a primeira coisa a fazer é verificar se já existem microsatélites para a sua espécie no GenBank. Se não, existem você terá que desenvolve-los !
  73. 73. SEQUENCIAMENTO animação
  74. 74. Microsatélites em sequências
  75. 75. DNA cromossômico gene Restrição com endonuclease (1 ou mais) Separação por eletroforese PCR-RFLP animação
  76. 76. Alelo S-Rnases – marcador específico
  77. 77. Superfície estigmática Auto-incompatibilidade Gametofítica Estilete CELSO L.DE ALBUQUERQUE JUNIOR (2004)
  78. 78. Compatibilidade Gametofítica CELSO L.DE ALBUQUERQUE JUNIOR (2004)
  79. 79. Análise das marcas específicas
  80. 80. AFLP (Amplified Fragment Length Polymorphism) Zabeau (1993), Vos et al. (1995) O ensaio combina a especificidade, resolução e poder de amostragem da digestão de enzimas de restrição com a velocidade e praticidade de detecção do polimorfismo via PCR Co-amplificação específica de um grande número de fragmentos de restrição Tipicamente 40-100 fragmentos são amplificados e detectados em gel de poliacrilamida Esta característica também é chamada de “índice de multiplex do ensaio AFLP ”
  81. 81. AATTCA --------GTTA TTAAGT---------CAAT Pré-amplificaçãoPré-amplificação EcoREcoR II primerprimer E-E-A MseMse II primerprimer M -M - CC 5´------GAATTC --------TTAA-----3´ 3´------CTTAAG---------AATT-----5´ AATTC --------T G---------AAT AATTC --------TTA TTAAG---------AAT Ligação de adaptadoresLigação de adaptadores MseMse I adaptadorI adaptadorEcoREcoR II adaptadoradaptador TATTA A 5´------GAATTC --------TTAA-----3´ 3´------CTTAAG---------AATT-----5´ MseMse IIEcoREcoR II Digestão do DNADigestão do DNA MseMse II primerprimer M -M - CAC AATTCAACA -----------GTGGTTA TTAAGTTGT------------CACCAAT EcoREcoR II primerprimer E-E- ACA AmplificaçãoAmplificação
  82. 82. Vantagem é indiscutivel -Grande número de fragmentos -Número de marcadores simultâneos analisados -Facilidade e rapidez com que é realizado, -Alta resolução e repetitivo Desvantagem -Discriminar o heterozigoto dos homozigotos. AFLP
  83. 83. S C M Progênie F1 (Santa Rosa x Chatard) Marcas segregantes
  84. 84. Excelente = Saturar mapas genéticos 840 marcadores 475 AFLPs 235 RAPDs 129 SSRs
  85. 85. SCARs (Sequence characterized amplified RAPD) Desenvolvimento de um SCARDesenvolvimento de um SCAR 1) identificação de um iniciador que confere polimorfismo a dois bulks de DNA com fenótipos contrastantes, 2) o isolamento e a clonagem do fragmento amplificado em um vetor (plasmideo), 3) sequenciamento do fragmento isolado, 4) desenho dos iniciadores de tamanho maior que os decâmeros 5) teste final (Paran e Michelmore, 1993).
  86. 86. Bulk resistentes Bulk suscetíveis Padrão de banda dos Bulks 1 2 3 4 5 P1 (Resistente) P2 (Suscetível) Seleção de indivíduos F1 expressando o carater de resistência Seleção de indivíduos F1 expressando o carater de suscetibilidade Extração de DNA Extração de DNA Mistura equitativa de DNA Mistura equitativa de DNA Análise de RAPD dos indivíduos e confirmação entre o marcador detectado nos bulks e a expressão do carater 1 2 3 4 5 DNA de indivíduos da população que são resistentes (todos possuem a banda 3) DNA de indivíduos da população que são suscetíveis (nenhum possui a banda)
  87. 87. Atributos Isoenzimas Proteínas de sementes RFLPs RAPDs Microssatélites AFLPs Nível de Polimorfismo baixo alto baixo-alto baixo-alto muito alto muito alto Estabilidade ambiental moderada alta alta alta alta alta Número de locos moderado (<50) baixo (<10) alto alto alto alto Expressão genética co-dominate co-dominante co-dominante dominante co-dominante dominante Número de alelos por loco 2-5 multialélico multialélico 2 multialélico 2 Distribuição no genoma regiões de cópia única regiões de cópia única várias ao acaso ao acaso ao acaso Acessibilidade tecnológica muito alta muito alta média muito alta muito baixa média Aplicabilidade no melhoramento rápido, baixo custo rápido, baixo custo lento, custo médio rápido, baixo custo lento, custo alto rápido, custo baixo Identificação de genótipos baixa baixa alta muito alta muito alta muito alta Avaliação de germoplasma média baixa alta alta alta muito alta Mapeamento genético baixa muito baixa alta alta muito alta alta Mapeamento de regiões específicas baixa inadequado média muito alta média muito alta Mapeamento comparativo baixa inadequado muito alta baixa alta baixa Genética de Autógamas baixa baixa média alta muito alta muito alta Genética de Alógamas média baixa média alta muito alta muito alta Análise Filogenética média baixa muito alta média alta média Adaptado de Gepts (1993) e Ferreira & Grattapaglia (1995).
  88. 88. Abordagem Estratégias Diversidade genética Alozimas Filogenia Fluxo gênico Análise de paternidade RAPD AFLP SSR Limitações Financeira Biblioteca genômica Amostragem Mapeamento genético
  89. 89. RGAs (Resistance gene homologues) P-loop RNBS-A Não TIR RNBS-A TIR Kinase-2 W/D GLPL RNBS-D Não TIR RNBS-D TIR N-terminal C-terminal Motivos exclusivos TIR Motivos exclusivos não TIR Motivos TIR e não TIR Primers Sense Motivos Sequencia 5’- 3” 39F1 P-loop (n-terminal): TCATCAAGGACGAGCTGARWBNATGMA P1a P-Loop GGIATGCCIGGIIIIGGIAARACIAC P3a GLPL AIITYIRIIR YIAGIGGYAA ICC LM638 P-loop GGI GGI GTI GGI AAI ACI AC 1F P-loop-GKTT GGCGGGGTGGGCAARACNACNHT P1c P-loop-GKTT non TIR Arabidopsis GGICGICCIGGIIIIGGIAARACIAC 3F2 kinase GAGGTACTTCCTGGTGCTGGAYGAYRTBTG 2F nbs-2 AACGGCTGCAGGATCATGRTBACHACHMG OLE 1121 P-loop GGWATGGEGGWRTHGGWAARACHAC Primers antisense Motivos Sequencia 5’- 3” P1b P-loop GGIATGGGIGGIIIIGGIAARACIAC P3d GLPL AIITYIRIIR YYAAIGGIAG ICC RNBS-D GGR AAI ARI SHR CAR TAI VIR AAR C 1R1 P-loop CGTGCTGGGCCAGGGTNGTYTTNCC P3b GLPL – non TIR Arabidopsis AIITYIRIIRYIAGIGGIAGICC 13R1 GLPL – C-terminal CGGCCAAGTCGTGCAYVAKRTCRTGCA 11R1 GLPl – C-terminal TCAGCTTGCCGATCCACTYDGGSAGBYT OLE 122 GLPLAL ARNWYYTTVARDGCVARWGGVARWCC Primers Sense Motivos Sequencia 5’- 3” 39F1 P-loop (n-terminal): TCATCAAGGACGAGCTGARWBNATGMA P1a P-Loop GGIATGCCIGGIIIIGGIAARACIAC P3a GLPL AIITYIRIIR YIAGIGGYAA ICC LM638 P-loop GGI GGI GTI GGI AAI ACI AC 1F P-loop-GKTT GGCGGGGTGGGCAARACNACNHT P1c P-loop-GKTT non TIR Arabidopsis GGICGICCIGGIIIIGGIAARACIAC 3F2 kinase GAGGTACTTCCTGGTGCTGGAYGAYRTBTG 2F nbs-2 AACGGCTGCAGGATCATGRTBACHACHMG OLE 1121 P-loop GGWATGGEGGWRTHGGWAARACHAC Primers antisense Motivos Sequencia 5’- 3” P1b P-loop GGIATGGGIGGIIIIGGIAARACIAC P3d GLPL AIITYIRIIR YYAAIGGIAG ICC RNBS-D GGR AAI ARI SHR CAR TAI VIR AAR C 1R1 P-loop CGTGCTGGGCCAGGGTNGTYTTNCC P3b GLPL – non TIR Arabidopsis AIITYIRIIRYIAGIGGIAGICC 13R1 GLPL – C-terminal CGGCCAAGTCGTGCAYVAKRTCRTGCA 11R1 GLPl – C-terminal TCAGCTTGCCGATCCACTYDGGSAGBYT OLE 122 GLPLAL ARNWYYTTVARDGCVARWGGVARWCC
  90. 90. M 39F1/1R1 F G Br Bs A 2F/13R1 F G Br Bs A RGAs polimórficos
  91. 91. Sequenciamento e alinhamento dos motifs
  92. 92. Aplicações
  93. 93. Genes diferencialmente expressos Biblioteca de frruto suscetívelBiblioteca de fruto resistente Genes exclusivos de uma forma Genes comuns Determinando o perfil de expressão gênica e identificando genes diferencialmente expressos
  94. 94. • Determinação da função de um gene • Caracterização de um estádio de desenvolvimento ou fisiológico • Caracterização de elementos regulatórios Por que?
  95. 95. Técnicas disponíveis • Seleção diferencial e hibridização subtrativa (Sambrook et al., 1989) • cDNA-AFLP (Bachem et al.,1996) • Differential Display Reverse Transcription PCR - (DDRT-PCR) (Liang and Pardee., 1992) • RFLP-coupled differential display (RC4D) (Fischer et al., 1995) • Serial Analysis of Gene Expression (SAGE) (Velculescu et al., 1995) • Macroarrays (Chen et al., 1998) • Microarrays (Schena et al., 1995)
  96. 96. ESTs (Expression Sequences Tags) AAAAAAAAA TTTTTTTTT RT PCR Clonagem Seqüenciamento Extração RNAm + Oligo (dT) cDNA
  97. 97. cDNA“tester“com adaptador 1 R cDNA“tester“com adaptador 2 RcDNA“Driver” (em excesso) 1ª Hibridização a RNA mensageiro Subtração Ligação dos adaptadores cDNA Digestão comRsaI a, b, c, d + e 2ª Hibridização: mistura de amostras, adição de “Driver” desnaturado eanelamento Preenchimento dos terminais d b c a d b c e Adição de “primers” Amplificação por PCR a e d - nenhuma amplificação b- b’ - nenhuma amplificação c - amplificação linear e -amplificação exponenciale 5’ 5’ 3’ 3’ Construção de bibliotecas Subtrativas Tester RNA tecido A Driver RNA tecido B cDNA Digestão com Dpn II Ligação ao oligo A Ligação ao oligo B Hibridização com excesso de Driver PCR com a utilização de iniciadores complementares ao oligo A Amplificação seletiva dos cDNAs derivados do Tester Clonagem em vetores e montagem da biblioteca
  98. 98. (a) (b)(a) (b) Estacas enraizadas dos porta-enxertos: (a) Marubakaido (tolerante) e (b) M9 (sensível) em Al3+ I dentificaI dentificaçãção dos genes induzidos pelo alumo dos genes induzidos pelo alum íínio emnio em áápicepice radicular de portaradicular de porta--enxerto de macieiraenxerto de macieira DANTAS, ACM1; STOLF, EC1; GUI MARÃES, CT2; CARNEI RO, N2; PURCI NO, AA2 1 Recursos genéticos Vegetais, CCA, Universidade Federal de Santa Catarina – Florianópolis – SC. 2 Núcleo de Biologia Aplicada, Embrapa Milho e Sorgo – Sete Lagoas – MG acmdantas@cca.ufsc.br Clone Sequenciamento Sequences producing significant alignments: e value C5 A10 hypothetical protein [Erwinia amylovora]. 3e-13 C5 A10 putative reverse transcriptase [Cicer arietinum] 3e-13 F6 B10 formate dehydrogenase beta-subunit [Methanococcus voltae].. 1e-10 C8 C10 Catalase 8e-11 C9 D10 class III chitinase [Sphenostylis stenocarpa]. 7e-06 D8 E10 Catalase 3e-11 G8 F10 Structural Analysis Of The Spiroplasma Virus 3e-40 E10 H10 IntI [Citrobacter freundii] 2e-13 Clone Sequenciamento Sequences producing significant alignments: e value C5 A10 hypothetical protein [Erwinia amylovora]. 3e-13 C5 A10 putative reverse transcriptase [Cicer arietinum] 3e-13 F6 B10 formate dehydrogenase beta-subunit [Methanococcus voltae].. 1e-10 C8 C10 Catalase 8e-11 C9 D10 class III chitinase [Sphenostylis stenocarpa]. 7e-06 D8 E10 Catalase 3e-11 G8 F10 Structural Analysis Of The Spiroplasma Virus 3e-40 E10 H10 IntI [Citrobacter freundii] 2e-13
  99. 99. cDNA-AFLP
  100. 100. cDNA-AFLP Vantagens: • Alta reprodutibilidade; • Poucos falso positivos; • Necessita de pequenas quantidades iniciais de RNA. Desvantagens: • O cDNA precisa conter o sítio de restrição da enzima utilizada.
  101. 101. DDRT-PCR (Differential Display Reverse Transcription PCR)
  102. 102. SNPs (Single nucleotide polymorphisms) 5’ leader Coding sequence (exons) 3’ end Poly-A Seqüênciamento 5’Seqüênciamento 5’ Seqüênciamento 3’Seqüênciamento 3’ Polimorfismo de um único nucleotídeo I.G. Gut, Automation in genotyping single nucleotide polymorphisms. Hum. Mutat. 17 (2001) 475–492.
  103. 103. detectar a variação de seqüência na janela de um alinhamento de ESTs de um mesmo gene, parcialmente sobrepostas SNPs - Princípio Variações mais frequentes no genoma: 1 substituição a cada 31 pb não codificadora e a cada 124 pb em regiões codificadoras
  104. 104. Detecção e validação de SNPs
  105. 105. Princípio da genotipagem TTACGCATAACCTATCGAATTCCATCGCATCGA1. PCR amplificação 2. Restrição do produto PCR com a enzima adequada (ex: EcoRI, GAATTC) TAACCTATCGAATTCCATCG C SNP site TAACCTATCGACTTCCATCG Se ‘A’ está presente ocorre a restrição Se ‘C’ está presente, não ocorre a restrição - + N R - + N R
  106. 106. Análise Molecular de OGMs
  107. 107. Identificação Molecular Análise de DNA - PCR - Southern Blot - Real Time PCR - Arranjos Análise de Proteína Baseadas em imunologia - ELISA - Western blot - Proteoma
  108. 108. 4. Hibridização da membrana com a sonda específica Retirada da membrana com o DNA Hibridização da membrana com sonda radioativa Solução de transferência Esponja Gel Membrana de Nylon Papel para Absorção 3. Transferência do DNA para a membrana de nylon (Blotting) 2. Eletroforese DNA em Gel de Agarose 5. Revelação do autoradiograma Retirada das hibridizações não específicas 1. Digestão do DNA com enzimas de restrição Southern Blot
  109. 109. Análise Molecular Digestão com EcoRI e hibridação com sonda específica para sarcotoxin IA PCR Southern blot
  110. 110. Análise do fenótipo Sintoma aos 25 dias após inoculação (104 CFU/ml) stx-5Controle Western blot
  111. 111. Real Time PCR Resultados após amplificação Análise da Expressão de Genes
  112. 112. Arranjos de DNA Aumento do número de genes chips de DNA diferentes seqüências para detectar genes expressos ou introduzidos em plantas
  113. 113. Biblioteca Estoque de bactéria em glicerol (96 ou 384-well ) Amplificaç ão de PCR Diretamente do estoque Usando iniciadores SP6-T7 em placas 96-well Mantagem em placas 384-well Gotas em matrizes Sobre lâminas de vidro Impressão do chip DNA
  114. 114. Proteoma Levantamento quantitativo de proteínas/peptídeos em uma amostra para identificar mudanças de interesse Proteoma Genoma Proteínas e peptídeos Dinâmico Células e tecido específicos DNA Estático Orgão específico
  115. 115. Separação e preparo de amostraSeparação e preparo de amostra Digestão - tripsina Peptídeo Separação

×