1. The Immunogenicity of
Recombinant Bacillus Subtilis
Spore Surface Expressing
CTB-AraH1, 2 and 3 (Mixed)
Jingzhi Yang
PI: Dr. Xiu-Min Li
Mentor: Dr. Zhen Wen Zhou
Lab: Pediatric Department of Allergy and Immunology

2. Abstract
The goal of this experiment is to use the constructed recombinant Bacillus Subtilis spores
with surface expressing CTB-AraH1, 2 and 3 and test its immunogenicity by using animal mice
model. First, peanut allergens are combined with CTB and expressed on the spore of B. Subtilis.
Next, the spore coat protein will be extracted using sonication. Then SDS-PAGE and Western
Blot are used to identify the success of fusion proteins expressed on the surface of spores. Mice
will be treated first and then sensitized repeatedly for three weeks. Treatment will be FAHF2 and
the recombinant spores (mixed treatment) administered to different groups of mice. The total
experiment lasted for 4 weeks with first week receiving no treatment. The results were that
through ELISA, IgE levels of the mice decreased for both peanut specific and egg white specific.
Thus in conclusion CTB-AraH1, 2 and 3 B. Subtilis Spore may be a possible treatment for peanut
allergy.
Introduction
Food allergy is a common disease, affecting up to 8% of children and 4% of adults in
western countries. Approximately 15 million Americans have food allergies. Every 3 minutes, a
food allergy reaction sends someone to the emergency department –that is more than 200,000
emergency department visits per year. Peanut allergy, especially, is one of the most common
food allergies. Peanuts can cause a severe, potentially fatal, allergic reaction. To prevent a
reaction, strict avoidance of peanut and peanut products is essential. However, since peanuts are
widely used in the food industry, patients with peanut allergy risk consuming food products that
are unintentionally cross-contaminated with peanut during the food-manufacturing procedure.
Therefore the avoidance of food allergens is difficult to achieve to some extent. Thus for patients
who are at risk for anaphylaxis, safe and affordable therapeutic approaches are needed.
FAHF-2 stands for Food Allergy Herbal Formula 2. It is proven to prevent anaphylaxis in
a murine model of peanut allergy. For this experiment, it will be used to compare with the
effectiveness of the CTB-AraH1,2,3.
There are many types of peanut allergens: AraH1, AraH2, AraH3, AraH6, AraH8, and
more. For this experiment, allergens AraH1, 2, and 3 are focused on because they are the three
main peanut allergens. The presence of those allergens, with the in take of peanuts, can increase
the level of which IgE is produced. IgE stands for immunoglobulin E, it is the antibody produced
when the immune system detects allergens. IgE antibodies are found in the lungs, skin, and

3. mucous membranes. While IgE are fighting the allergens, special cells called mast cells are
injured during this process. When a mast cell is injured, it releases a variety of chemicals into the
tissues and blood, for example histamine. These chemicals frequently cause allergic reactions
because they are very irritating and cause itching, swelling, and fluid leaking from cells.
AraH 1, 2 and 3 itself can be a treatment for peanut allergy. The gradual increase amount
of this allergen can increase the tolerance of patients of the allergen. Therefore the next time the
patients come in contact with food containing the allergen, there will not be an allergic reaction
because the patients’ bodies can already tolerate this allergen that cause allergic reactions.
In this experiment, allergens are combined with Cholera Toxin B. CTB is a non-toxic
protein complex that functions as a mucosal adjuvant. CTB induces the production of IgA. The
recombinant protein will be expressed on Bacillus Subtilis.
Bacillus Subtilis is a gram-positive bacterium. It is rod-shaped, and has the ability to form
a tough, protective endospore, allowing the organism to tolerate extreme environmental
conditions. Both humans and animals currently consume B. Subtilis as a probiotic. Many
beneficial effects have been attributed to probiotics, including the ability to produce adhesins,
inhibitory substances like bacteriocins, antibacterial substances and siderophores, compete with
harmful bacteria for chemicals and nutrients, improve the microbial balance and stimulate
mucosal and systemic host immunity. B. Subtilis is very unique in that the endospore is formed at
times of nutritional stress, allowing the organism to persist in the environment until conditions
become favorable. Under stressful conditions, such as nutrient deprivation, Bacillus Subtilis
undergoes the process of sporulation to ensure the survival of the species. Using this special
property, we can express the recombinant protein on the surface of the spore.
After collecting the protein from the spore, SDS-PAGE and Western Blot are performed
to ensure the presence and size of the protein. With the certainty that the recombinant protein is
made, it will be tested on mice orally. IgE levels will be tested at the end of every week using
ELISA. ELISA stands for Enzyme-Linked Immunosorbent Assay. It is a rapid immmochemical
test that involves an enzyme (protein that catalyzes a biochemical reaction) and two antibodies
that are the immunological molecules. One of the antibodies is specific to the antigen while the
other reacts to the antigen-antibody complex and is also combined with the enzyme. This second
antibody, different from the first one, accounts for the “enzyme-linked” in the name and
therefore helps us determine the presence of antigen. ELISA is a biological technique used

4. mainly in immunology to detect the presence of an antibody or an antigen in a sample. The test is
affordable and sensitive to tiny amounts of material which can be used to diagnose diseases:
HIV/AIDS, SARS, Bird flu, detect pathogenic agents: water, air, food, trace molecular markers
of cancer, pregnancy, and to trace food allergens such as milk, peanuts, eggs.
My hypothesis for this experiment is: If mixed spore treatment CTB-AraH1,2 and 3 is
orally administrated to mice, then this recombinant protein would cause the IgE level of treated
mice to overall decrease in comparison to the sham group.
Methods
Construction of gene fusion
CTB DNA was amplified by PCR using the synthesized CTB DNA
(GenScript,Piscataway,NJ) as template and the following designed primers. The designed
primers include: forward primer: 5’CGGGCTAGCACACCTCAAAATATTACTGAT3’ with a
NheI site (underlined), reverse primer: 5’GGCGAATTCATTTGCCATACTAATTGCG3’ with
an EcoRI site. The PCR conditions were as follows: 94°C for 4 m followed by 35 cycles of 94°C
for 30 s, 55°C for 30 s and 72°C 60 s, and the reaction continued for 10 min at 72 °C after the
last cycle. The purified PCR product was digested with NheI , EcoRI and subcloned into NheI
/EcoRI double digested pET- 24-Arah2 plasmid ( kindly provided by Dr. Hugh Sampson) and
transformed to E.coli BL21. CTB-Arah2 DNA was amplified by using the constructed pET24-
CTB-Arah2 plasmid as template. The PCR primers include: forward primer:
5’CGGTCTAGAGACACCTCAAAATATTACTGATT3’ with an XbalΙ site, reverse primer:
5’AAAAAGCTTTTAGTCTCTGTCTCTGCCGCCAC3’ with a HindШ site. The purified PCR
product was double digested by XbalI/ HindШ and ligated to the 3’ end of the CotC gene in
pUS186-CotC plasmid constructed [16-17] and transformed into B. Subtilis WB600. The
sequences of the fusion gene were confirmed. My mentor did this.
Spore coat protein extraction and Western blot analysis
Pus186cotC-CTB-Ara h1/B. Subtilis WB600 strain was cultured in LB medium with
25µg/ml kanamycin at 37 °C overnight, and then transferred to Difco Sporulation Medium
(DSM) and cultured for 24 hours for sporulation. Spores were collected and purified. Briefly, the
spores were incubated with 4-mg/ml lysozyme followed by washing in 1 M NaCl and 1 M KCl
with 1 mM PMSF. After the last suspension in water, spores were treated at 65 °C for 1 hour in
water bath to kill any residual sporangial cells. I did the above procedures. My mentor

5. determined the number of spores by directly counting under microscopy using a hemacytometer.
Approximately 1011 spores were obtained from 1.0 L of DSM medium.
Spore coat proteins were extracted from suspensions of spores at high density (>1×1010
spores per ml) in sodium dodecyl sulphate- dithiothreitol (SDS–DTT) extraction buffer (0.5%
SDS, 0.1 M DTT, 0.1 M NaCl) by sonication as described previously. Then to confirm the
surface display of CTB-AraH1 on the spores’ coat, my mentor extracted proteins were separated
on a 12% SDS-PAGE gel and then transferred onto a nitrocellulose membrane. Proteins were
incubated with mouse anti-AraH1 antibody; reactive bands were visualized with horseradish
peroxidase (HRP)-coupled anti-mice antibody via Chemiluminescent HRP Antibody Detection
Reagent (Denville Scientific, South Plainfield, NJ) according to the manufacturer’s procedures.
The same procedure is repeated with AraH2 and AraH3. And all the spores are combined
together as mixed treatment.
Mice model and treatment
Five-week-old female C57BL/6J mice purchased from Jackson Laboratory (Bar Harbor,
Me) were maintained on peanut-free chow under specific pathogen-free conditions according to
standard guidelines for the care and use of animals. There were 14 mice in four groups: sham
(group 1 and 3), FAHF-2 treatment (group 4), and CTB-AraH1, 2,3 mixed spores treatment
(group 2).
Roasted peanuts were shelled with red skins retained, and allowed to soak in PBS for 20
minutes; peanuts were blended periodically in PBS for 3 h until a smooth suspension was
obtained. Mice were sensitized intragastrically with peanut (10mg) and cholera toxin (20µg; List
Laboratories Campbell, CA) in a total volume of 500µL PBS on three consecutive days of week
0-3. Mice were then treated three consecutive days of week from week 1-3. Mice were sensitized
with both peanuts and egg white, done by my mentor. I made the solutions. Another researcher
administered FAHF-2 while my mentor administered 300µl of mixed spore treatment to group 2,
I simply observed.
Measurement of peanut specific immunoglobulin
Blood was collected by submandibular venipuncture and harvested sera were stored at -
80°C until needed. For Peanut-specific IgE, 100µl 500µg/ml CPE was used to coat wells
overnight at 4°C, 1:20 dilution of sample was added to coated well and incubated at 4°C
overnight, In the third day, 1µg/ml biotinylated rat anti-mouse IgE antibody (BD,San Diego,CA)

6. was added to each well and incubated for 1h at room temperature, followed by adding avidin-
HRP (Sigma, Louis, MO) and incubated for 45m at temperature. Signals were detected by TMB
substrate reagent (BD,San Diego,CA). Mentor collected blood, I did ELISA.
Statistical analysis
All statistical analyses were performed using Excel (me).
Results
Figure 1. 1
IgE level for sham stayed around the same, for FAHF2 decreased and for the spore treatment it
decreaed.
Figure 1.2
IgE level for sham generally decreased.
0
100
200
300
400
500
600
700
800
0w 2w 3w
PNIgE(ng/ml)
Weeks
Peanut Specific IgE Level
sham
FAHF2
CTB
0
200
400
600
800
1000
0w 2w 3w
IgELevel(ng/ml)
Weeks
Peanut Specific IgE Level (Sham)
1.1
1.3
3.1
3.2
3.3
3.5

7. Figure 1.3
IgE level for FAHF2 generally decreased.
Figure 1.4
IgE level for the spore treatment generally decreased.
Figure 2.1
IgE level for sham increased, for FAHF2 increased, for the spore treatment decreased.
0
200
400
600
800
1000
1200
0w 2w 3w
IgE(ng/ml)
Weeks
Peanut Specific IgE Level (FAHF2)
4.1
4.2
4.3
4.5
0
200
400
600
800
1000
0w 2w 3w
IgELevel(ng/ml)
Weeks
Peanut Specific IgE Level (CTB)
2.1
2.2
2.3
2.5
0
1000
2000
3000
4000
5000
0w 2w 3w
EWIgE(ng.ml)
Weeks
Egg White Specific IgE Level
sham
FAHF2
CTB

8. Figure 2.2
IgE level increased for some and decreased for some.
Figure 2.3
IgE level generally increased.
Figure 2.4
IgE level generally decreased at week 3.
0
1000
2000
3000
4000
5000
0w 2w 3w
IgELevel(ng/ml)
Weeks
Egg White Specific IgE Level (Sham)
1.1
1.3
3.1
3.2
3.3
3.5
0
1000
2000
3000
4000
5000
0w 2w 3w
IgELevel(ng/ml)
Weeks
Egg White Specific IgE Level (FAHF2)
4.1
4.2
4.3
4.5
0
1000
2000
3000
4000
0w 2w 3w
IgELevel(ng/ml)
Weeks
Egg White Specific IgE Level (CTB)
2.1
2.2
2.3

9. Discussion
Peanut allergy is typically life long, often severe, and potentially fatal. Because reactions
can occur from small amounts, the allergy presents patients with significant obstacles to avoid
allergic reactions.
B. Subtilis spores were used as a vehicle and peanut major allergens AraH1, 2 and 3
served as vaccine candidates; they were fused with mucosal adjuvant CTB as a treatment for
peanut allergy. It has been demonstrated that IgE plays an important role in mediating peanut
allergy. In this study, oral administration of recombinant mixed spores significantly reduced the
peanut specific IgE. Figures 1.1, 1.4, 2.1, and 2.4 showed that CTB-AraH1, 2 and 3 treatment
was effective in bringing down the IgE level. The decreasing of IgE level means that less
allergens were detected; therefore, a decrease in possibility for an allergic reaction to occur.
In conclusion, CTB-AraH1, 2 and 3 had been expressed on the B. Subtilis spores. Oral
administration of CTB-AraH1, 2 and 3 spores reduced peanut specific and egg white specific
IgE. CTB-AraH1, 2 and 3 B. Subtilis spores might provide the first step toward an
immunotherapy for peanut allergy.

10. References
 Food Allergy Research and Education, Facts and Statistics,
http://www.foodallergy.org/facts-and-stats [May 24, 2014]
 American Academy of Allergy Asthma and Immunology, Allergy Statistics, AAAI.org,
http://www.aaaai.org/about-the-aaaai/newsroom/allergy-statistics.aspx [May 24, 2014]
 Food Allergy Research and Education, Peanut Allergy,
http://www.foodallergy.org/allergens/peanut-allergy [May 24, 2014]
 Mahmood, Tahrin, and Ping-Chang Yang. "Western Blot: Technique, Theory, and Trouble
Shooting." National Center for Biotechnology Information. U.S. National Library of
Medicine, 03 Mar. 0006. Web. 28 May 2014.
<http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3456489/>.
 F. Van Wijk, S. Hoeks, L. Knippels, L. Boon, S. Koppelman, R. Pieters. "The Role of
CTLA-4 and a Mucosal Adjuvant Cholera Toxin in Oral Sensitization to Peanut." The
Journal of Allergy and Clinical Immunology. N.p., n.d. Web. 28 May 2014.
<http://www.jacionline.org/article/S0091-6749%2804%2900307-0/abstract>.
 Marth K, Focke-Tejkl M, Lupinek C, Valenta R, Niederberger V, "Allergen Peptides,
Recombinant Allergens and Hypoallergens for Allergen-Specific Immunotherapy." National
Center for Biotechnology Information. U.S. National Library of Medicine, n.d. Web. 28 May
2014. <http://www.ncbi.nlm.nih.gov/pubmed/24860720>.
 Koppelman SJ, Hefle SL, Taylor SL, de Jong GA. "Digestion of Peanut Allergens Ara H 1,
Ara H 2, Ara H 3, and Ara H 6: A Comparative in Vitro Study and Partial Characterization of
Digestion-resistant Peptides." National Center for Biotechnology Information. U.S. National
Library of Medicine, n.d. Web. 28 May 2014.
<http://www.ncbi.nlm.nih.gov/pubmed/20603832>.
 Rachele Isticato, Giuseppina Cangiano, Hoa T. Tran, Annalisa Ciabattini, Donata
Medaglini2, Marco R. Oggioni2, Maurilio De Felice1, Gianni Pozzi, and Ezio Ricca,.
"American Society for MicrobiologyJournal of Bacteriology." Surface Display of
Recombinant Proteins on Bacillus Subtilis Spores. N.p., n.d. Web. 28 May 2014.
<http://jb.asm.org/content/183/21/6294.abstract>.
 Smits. " Cholera toxin B suppresses allergic inflammation through induction of secretory
IgA.” National Center for Biotechnology Information. U.S. National Library of Medicine,
July 2009. Web. 10 Dec. 2014. <http://www.ncbi.nlm.nih.gov/pubmed/19404246>.
 Srivastava. "Efficacy and Immunological Actions of FAHF-2 in a Murine Model of Multiple
Food Allergies." National Center for Biotechnology Information. U.S. National Library of
Medicine, May 2012. Web. 10 Dec. 2014.
<http://www.ncbi.nlm.nih.gov/pubmed/22541407>.
 Srivastava. "The Chinese Herbal Medicine Formula FAHF-2 Completely Blocks
Anaphylactic Reactions in a Murine Model of Peanut Allergy." National Center for
Biotechnology Information. U.S. National Library of Medicine, Jan. 2005. Web. 10 Dec.
2014. <http://www.ncbi.nlm.nih.gov/pubmed/15637565>