O slideshow foi denunciado.
Utilizamos seu perfil e dados de atividades no LinkedIn para personalizar e exibir anúncios mais relevantes. Altere suas preferências de anúncios quando desejar.
Evolving Prolog
gene expression programming
InfoQ.com: News & Community Site
• 750,000 unique visitors/month
• Published in 4 languages (English, Chinese, Japanese an...
Presented at QCon New York
www.qconnewyork.com
Purpose of QCon
- to empower software development by facilitating the sprea...
mndrix
The Problem
Lending Club
peer to peer loans
which ones are good?
data!
The Result
98% success
p2pquant.com
note selection
Genetic Algorithms
because giraffes
Candida Ferreira FTW!
Genotype
ATGCTTCGGCAAGACTCAAAAAATA
Phenotype
Ophrys apifera
xkcd 1259
Genotype : Phenotype
Source : AST
*b+a-aQab+//+b+babbabbbababbaaa
Investment strategy
and
FICO >
credit
inquiries <
700 2
Prolog
Why Prolog?
homoiconic
?- writeln(hi).
hi
?- X=writeln(hi).
X = writeln(hi).
?- call($X).
hi
logic variables
?- X=writeln(Message).
X = writeln(Message).
?- X=writeln(Message), Message=hi.
Message = hi,
X = writeln(...
*b+a-aQab+//+b+babbabbbababbaaa
declarative
Fitness Function
internal rate of return
Generations
you kids get off my lawn
98% satisfied
p2pquant.com
thanks
Watch the video with slide synchronization on
InfoQ.com!
http://www.infoq.com/presentations/prolog
Evolving Prolog
Próximos SlideShares
Carregando em…5
×

Evolving Prolog

610 visualizações

Publicada em

Video and slides synchronized, mp3 and slide download available at URL http://bit.ly/1PxwnA8.

Michael Hendricks talks about Prolog - a powerful, modern, general purpose language. Michael presents how they used genetic algorithms to evolve Prolog programs based on historic data from peer to peer lending markets. The resulting Prolog program outperforms 98% of similar investors. Filmed at qconnewyork.com.

Michael Hendricks is a cofounder and the lead developer at Hookscript.com .

Publicada em: Tecnologia
  • Seja o primeiro a comentar

  • Seja a primeira pessoa a gostar disto

Evolving Prolog

  1. 1. Evolving Prolog gene expression programming
  2. 2. InfoQ.com: News & Community Site • 750,000 unique visitors/month • Published in 4 languages (English, Chinese, Japanese and Brazilian Portuguese) • Post content from our QCon conferences • News 15-20 / week • Articles 3-4 / week • Presentations (videos) 12-15 / week • Interviews 2-3 / week • Books 1 / month Watch the video with slide synchronization on InfoQ.com! http://www.infoq.com/presentations /prolog
  3. 3. Presented at QCon New York www.qconnewyork.com Purpose of QCon - to empower software development by facilitating the spread of knowledge and innovation Strategy - practitioner-driven conference designed for YOU: influencers of change and innovation in your teams - speakers and topics driving the evolution and innovation - connecting and catalyzing the influencers and innovators Highlights - attended by more than 12,000 delegates since 2007 - held in 9 cities worldwide
  4. 4. mndrix
  5. 5. The Problem
  6. 6. Lending Club peer to peer loans
  7. 7. which ones are good?
  8. 8. data!
  9. 9. The Result
  10. 10. 98% success
  11. 11. p2pquant.com note selection
  12. 12. Genetic Algorithms
  13. 13. because giraffes
  14. 14. Candida Ferreira FTW!
  15. 15. Genotype
  16. 16. ATGCTTCGGCAAGACTCAAAAAATA
  17. 17. Phenotype
  18. 18. Ophrys apifera
  19. 19. xkcd 1259
  20. 20. Genotype : Phenotype Source : AST
  21. 21. *b+a-aQab+//+b+babbabbbababbaaa
  22. 22. Investment strategy and FICO > credit inquiries < 700 2
  23. 23. Prolog
  24. 24. Why Prolog?
  25. 25. homoiconic ?- writeln(hi). hi ?- X=writeln(hi). X = writeln(hi). ?- call($X). hi
  26. 26. logic variables ?- X=writeln(Message). X = writeln(Message). ?- X=writeln(Message), Message=hi. Message = hi, X = writeln(hi). ?- call($X). hi
  27. 27. *b+a-aQab+//+b+babbabbbababbaaa
  28. 28. declarative
  29. 29. Fitness Function internal rate of return
  30. 30. Generations you kids get off my lawn
  31. 31. 98% satisfied
  32. 32. p2pquant.com thanks
  33. 33. Watch the video with slide synchronization on InfoQ.com! http://www.infoq.com/presentations/prolog

×