PadminiNarayanan-Intro-2018.pptx

1. • Introduction, Medical Application and Recent Advances in Molecular Biology and Bioinformatics Refresher Course in Molecular Biology and Bioinformatics, 2018 Padmini Narayanan, Ph.D. pnarayan@bcm.edu

2. Learning Objectives • Why do you need to attend this series? What can you expect from this course? How can you translate this knowledge in to better patient care? • To provide a solid introduction to molecular biology with an emphasis on techniques and bioinformatic tools that are currently used to investigate the molecular mechanisms and its application to diagnose and treat diseases. • To introduce and give context to all the following lectures of this course

3. From: Genome, transcriptome and proteome: the rise of omics data and their integration in biomedical sciences Brief Bioinform. 2016;19(2):286-302. doi:10.1093/bib/bbw114

4. •Parasitology •Physiology •Biophysics •Developmental Biology •Bio-Informatics •Molecular Diagnostics •Structural Biology •Biochemistry •Gene Therapy •Molecular Epidemiology •Pharmacology •Virology •Genetics •Molecular Biology •Enzymology

5. •lindsaydigital.com •Molecular Medicine Molecular Insights  Identify pathology  Find inheritance of disease  Find ‘candidate gene’  Screen for mutations Applications • Improved diagnosis of disease • Earlier detection of genetic predisposition to disease (BRCA1) • Rationaldrug design • Genetherapy • “targeted/custom drugs"

6. •Parasitology •Physiology •Biophysics •Developmental Biology •Bio-Informatics •Molecular Diagnostics •Structural Biology •Biochemistry •Gene Therapy •Molecular Epidemiology •Pharmacology •Virology •Genetics •Molecular Biology •Enzymology Translational Bioinformatics

7. • Diseases are inherently complex with multitude of interactions on different levels – genomic-environmental- transcriptome-etc. • Network analysis approach offers sophisticated means for multidimensional omnics data integration. • Its integrative informatics – pulling and curating information from various “-omnics” – identifying functional subnetworks in complex disease phenotypes – prioritizing candidate genes (GWAS) • Exploring biochemical networks for identifying drug combinations and off target effects • PPI networks – revel novel pathways – molecular underpinning of diseases Translational Bioinformatics – Clinical Significance

8. • Using this approach – new methods/ models can be developed • Better understanding of different aspects of the disease progression • Generate new diagnostic tools – biomarkers – prognostic and drug targets • Valid hypothesis generation , targeted therapy – personalized medicine Translational Bioinformatics – Clinical Significance

9. RESOURCES • The Cancer Genomic Atlas (TCGA) • Therapeutically Applkicable Research to generate Effective Treatments (TARGET) • Cancer Target and Driver Discovery Network (CTD2) • NCI Genomic Data commons (GDC)

10. PROCESSES, TOOLS AND APPLICATION

11. Replication Gene and Gene regulatory units Transcription Translation Posttranslational modifications Splicing Transport, Stability Structure, Transport, Stability Interactions Activity Downstream signaling Structural support https://www.dnalc.org/resources/animations/

12. Exceptions to Central Dogma of Molecular Biology RNA dependent RNA synthesis DNA RNA Protein RNA Interference Reverse transcription GENOTYPE PHENOTYPE

13. Increasing genome repertoire and functional diversity Genome -20-25,000 genes Transcriotome ~100,000 transcripts Proteome <1,000,000 proteins Alternative promoters Alternative splicing rnRNAediting Post-translational modifications

14.  A genome is an organism’s complete set of •DNA, including all of its genes  Each genome contains all of the information •needed to build and maintain that organism  In humans, a copy of the entire genome has •more than 3 billion DNA base pairs and is •contained in all cells that have a nucleus DNA structure and Genomes Aug 10th 2018 Dr. Yasminka Jakubek DNA- Structure and Genomes

15. Human Genome, 3x109bp packaged into chromosomes  <3 % is expressed as proteins!!  ~80% is transcribed  What does the transcripts do?? remaining 98–99% (non- coding regions) holds structural and functional relevance Regulatory function http://www.sciencemag.org/news/2012/09/human- genome-much-more-just-genes

16. DNA Replication  ~160 proteins are involved in replication  Numerous genetic diseases result from mutations in these proteins or from errors in DNA replication or repair  e.g. recQ Helicases: Premature Aging, cancer predisposition (Werner’s syndrome) DNA replication and PCR methods Aug 17th 2018 - Dr. Aparna Krishnavajhala

17. PCR: in vitro DNA Replication PCR Applications  Molecular Biology and Genetics Research  ClinicalApplications  Forensic Sciences  RT-PCR: Reverse Transcription PCR  Real time quantitative-PCR (qPCR)  Nested PCR  PCR Arrays  Multiplex PCR 1st cycle 2nd cycle 30th cycle 2 2 =4 copies 2 3 =8 copies 2 31 =2 Billion copies

18. DNA Sequencing  Very important tool for biologists  Sequence of genes  Positioning of genes  Sequences of regulatory regions Applications: HealthCare Diagnostics Forensics (DNA fingerprinting) Agriculture Research Next generation DNA sequencing methods Aug 24th 2018 Dr. Devon Marie Fitzgerald

19. • Sanger Sequencing – base by base sequencing of a locus – 1kb per run • DNA-microarrays – hybridization of the DNA sample with a set of pre-defined oligonucleotide probes distributed across the entire genome or enriched around regions of interest • Next-generation sequencing (NGS) - fragmentation of the genomic DNA into pieces that are subsequently sequenced and aligned to a reference sequence. Allows detection of novel changes • Whole Exome Sequencing (WES)– specific region – sequencing of all variants in the coding regions – reveals protein affecting modifications • Whole Genome Sequencing (WGS) of an individual – identify all rare coding and non-coding variations. Technologies and methods to identify genetic variants - Simple Nucleotide Variants (SNVs) & Structural variants (SVs)

21. Questions  Is DNA the only genetic material?  Is DNA sequence/gene alone responsible for heritable traits?  Can heritable changes take place without changes in DNA Sequence?

22. • Mitotically or meiotically heritable changes in gene expression that don’t involve a change in DNA sequence. • Macromolecules that bind and functionally affect the metabolism of the DNA • Dependent on cell/tissue type! What is epigenetics? 1. DNA methylation: CpG islands: • transcription starting sites (UTR-areas): hypo- /hypermethylation • imprinting (X-inactivation): hypermethylation Repetitive sequences: • Transposable elements: hypermethylation 2. Histone modifications: • Acetylation: HAT/HDAC- enzymes • Methylation: H3K4me3: near the transcription start sites • Phosphorylation, Ubiquitylation, Sumoylation

23. Epigenomics Epigenomics – methylation and histone modification Aug 31st 2018 Dr. Jacob Junco

24. Epigenomics • The Encyclopedia of DNA Elements (ENCODE) Program that screens the entire genome and map every detectable functional unit in the database. • identify signature patterns, such as DNA methylation, histone modification and transcription factors, suppressors that bind the specific region. • 88% of trait associated variants detected with GWAS fall in non-coding regions, ENCODE will tremendously impact their assessment and phenotype-related interpretation

25. DNA Repair, Genomic Instability o DNA is constantly mutating  Reactive oxygen species  Replication errors  Radiation  Mutagen  Virus o Mutation in a DNA repair gene can cripple the repair process (Werner, Rothmund Thomson) o Repair mechanisms restore DNA to its original state •Application:  Disease pathology (Cancer, accelerated aging etc) DNA repair, recombination and genomic instability Sept 7th 2018 Dr. Devon Marie Fitzgerald

26. • Manipulating DNA molecule – study effect of genes – develop novel medicine • Recent advances – rather than studying the DNA taken out of the genome –able to modify genes directly in their endogenous context – any organism • Elucidate their effect in relevant environment – functional organization of the genome at the system levels – identify causal genetic variations. Genome editing A new era in molecular biology Just CRISPR it!!!

27. Targeted Genome editing and CRISPR/Cas9 A new era in molecular biology Genome engineering with Cas9 nuclease Origin: Bacterial immune system  Guide RNA  Cas9 (CRISPR associated endonuclease)  Make precise modifications in target DNA (HDR)  Generate knock-outs (NHEJ)  Activate or repress target genes (promoter binding)  Genome wide screens (disease/pathway associated novel genes) Targeted genomic editing CRISPR Sep 14th 2018Dr. Hyun Hwan

28. CRISPR applications and Animal Models CRISPR application and Animal Models Sep 21nd 2018 Dr. Sirena Soriano Hsu. P, et al. Cell 2014 June5, 157(6). Genetic and epigenetic control of cells with genomic engineering – Broad rage of application. Application of genomic eng - causal genetic mutation – Rapid identification of epigenetic variants associated with altered biological functions or disease phenotype – effectively recapitulated in animal and

29. Gene Expression: Transcription, Alternative splicing, RNA Seq Regulation of gene expression is the critical link between the genome and cellular morphology/physiology • Transcription • Transcriptional Factors • Transcriptional Regulation Sep 28th 2018 Dr. Tao Ling  90% of human genes are alternatively spliced!

30. Gene Expression: Non-Coding RNA and Personalized Medicine • A non-coding RNA (ncRNA) is a functional RNA molecule that is not translated into a protein. • Non-coding RNAs: Junk or Critical Regulators in Health and Disease? o Prader–Willi syndrome (snoRNA-HBII52) o Alzheimer's disease (lncRNA-BACE-AS) o Cancer (miR200) RNAi therapeutics – potent –specific mechanism – targeting gene expression – siRNA bound o RNA induced silencing complex(RISC) mediated target mRNA degradation using endonucleases (Arg). Pathway present in all mammalian cells. First-in-Humans Trial of an RNA Interference Therapeutic Targeting VEGF and KSP in Cancer Patients with Liver Involvement Cancer Discovery April 2013 3; 406

31. Oct – 5th 2018 – Dr.Narayan Sastri Palla Gene expression – Non-coding RNA and personalized medicine. Breaking the genetic enigma

32. Translation and Protein Function Prediction and detection  mRNA to Protein  Single nucleotide change can alter codon and possibly aminoacid  Change in amino acid sequence causes changes in – 3-D structure of protein – Defective protein folding – Protein function  Cystic fibrosis – Misfolded CFTR protein – Protein retained in ER  Huntington disease – Trinucleotide repeats – Multiple CAG repeats  Antibiotics often target bacterial •Translation

34. Protein Detection • Extraction of proteins • Separation of proteins • Identification of proteins • Quantification of Proteins • Western Blot • Immunohistochemistry/Immunofluorescence • ELISA/EIA • Immunoprecipitation • Mass-Spectrometry • X-Ray Chrystallography

35. •Tissue Preparation for IHC

36. Immunohistochemistry Avidin-biotin complex detection Signal amplification is not possible Suitable for high abundant ptn. Moderate signal amplification – commonly used. Substrate usually Horse Radish peroxidase (HRP) or alkaline phosphatase (AP) or the primary or secondary ab will be conjugated with fluorophore.

37. Immuno-colocalization of GP130 surface receptor with Lipid rafts in Pediatric AML blasts 260 125 70 38 15 Caveolin-1 Kasumi HS5 THP-1 K562 K61 MLLM-13 NB4 A16468-surface_unstim-surface.fcs FITC-A Count 10 0 10 1 10 2 10 3 10 4 0 10 19 29 38 GP130 Surface staining observed using flowcytometry Translation, function prediction and detection of proteins Oct 12th 2018 Dr. Nikhil Jain

38. Protein Modification: Localization and activity  Enzymes, Receptors, Cytokines, Hormones etc.  Translation, Transport and activity  Metabolic disorders  Types of protein modification Molecular Biology Techniques  Activity Assay  Identification of Post-translational modification Protein Modification – Localization and activity Oct 19th 2018 Dr. Poonam Sarkar

39. Cell cycle and chromosomal Instability  Historical context  Preservation and propagation of gene associated diseases  Molecular biology techniques used to these disorders  Molecular biology application in treatment  Introduction to relevant Bio-informatic tools Oct 26th 2018 Dr. Renuka Ramankutty Menon

40. • Based on isolation of DNA sequence of interest to obtain multiple copies invitro • Insertion of genetic information in to replicating vehicles • Plasmids, viral vectors, BAC etc. • Different techniques of cloning and vectors tailored to the final application. • Lecture – Structure of plasmids, cloning sites, restriction enzymes- cloning softwares and clone a gene in a vector. Molecular Cloning and its application Nov 2nd 2018 Dr. Paramahamsa Maturu

41. http://www.genome.gov/20019523 • A genome-wide association study is an approach that involves rapidly scanning markers across the complete sets of DNA, or genomes, of many people to find genetic variations associated with a particular disease. • Once new genetic associations are identified, researchers can use the information to develop better strategies to detect, treat and prevent the disease. Such studies are particularly useful in finding genetic variations that contribute to common, complex diseases, such as asthma, cancer, diabetes, heart disease and mental illnesses. Genome-wide association study

42. • Introduction to genome-wide association studies (GWAS), clinical relevance of GWAS of complex disease • Introduction to relevant databases to identify haplotype blocks and performing genetic and epigenetic profiling or susceptibility loci • Experimental techniques to determine underlying mechanisms of susceptibility loci • Walkthrough of a leukemia-specific post-GWAS analysis using HaploReg and RegulomeDB • GWAS- Population Genetics

43. Potentials of GWAS GWAS population Genetics Nov 9th 2018 Dr. Vince Gant

44. So by the end of this series ….. “Must be a clinical fellow." Well! this meme will be obsolete…..

45. •Bioinformatics  OMIM  Gene Card  Gene  NCBI Primer Design  UCSC Genome Browser  HPRD  ExPASy

46. •OMIM  Online Mendelian Inheritance in Man®  Compendium of genes & genetic phenotypes  Contain information on all known Mendelian •disorders (~15,000 genes)  Relationship between phenotype & genotype  Initiated 1960s by Dr. Victor A. McKusick  McKusick-Nathans Institute of Genetic •Medicine, JHU  www.omim.org

47. •Type gene or disease name to get further details

48. • Home About Statistics • Downloads Y Help Y External Links Terms of Use Contact Us MIMmatch NEW a Select Language I • I insulin Search Advanced Search - I Search History I Display Options • I Retrieve Corresponding: Gene Map Clinical Synopsis Search: 'insulin' Results: 1 - 10 of 1,056 I Show 1 GO I Download As • I 1 2 3 4 5 6 7 8 9 10 Next Last * 147670. INSULIN RECEPTOR; INSR Crogenetic location: 19p132, Genomic coordinates (GRC1137): 19:7,112 765-7251,010 I'vatching terms: insulin 2 * 176730. INSULIN; INS ENS-IGF2 SPLICED READ-THROUGH TRANSCRIPTS, INCLUDED Crogenetic location 1105.5, Genomic coordinates (GRCIL37). 11:2,181,008-2,182,438 Gene Tests, Links Gene Tests, ICD+, Links Home About Statistics • Downloads Y Help Y External Links Terms of Use • Contact Us MI Mmatch NEW al Select Language I V I insulin Search Advanced Search • I Search History I Display Options • •*176730 •INSULIN; INS •Alternative titles; symbols PROINSULIN •Other entities represented in this entry: •INS-IGF2 SPLICED READ-THROUGH TRANSCRIPTS, INCLUDED; INSIGF, INCLUDED •HGNC Approved Gene Symbol: INS •Cytogenetic location: 11p15.5Genomic coordinates(GRCh37): 11:2,181,008-2,182,438or..New Gene-Phenotype Relationships •-:3+• Table of Contents for *176730 •Title •Gene-Phenotype Relationships •Text •Description •Gene Structure •Mapping •Gene Function •Biochemical Features •Molecular Genetics •Animal Model •History •Allelic Variants •Table View •See Also •References •Contributors •Creation Date •Edit History •External Links for Entry: •Genome DNA Protein Gene Info ...Clinical Resources Variation Animal Models •Location Phenotype Phenotype •MINI number 125S52 •613370 •3.10.5.5 •Hypexproinsulinenta •Maturity-onset diabetes of the voting, type 10 •Phenotype mapping key •606176 •616214 •Diabetes mellitus, insulin-dependent, 2 •Diabetes mellitus, permanent neonatal •3 •3 •3 •3 •T W Y T

49. •Gene  http://www.ncbi.nlm.nih.gov/gene •F ; 7 2 : •NCBI Resources 1:vi How To NI •Gene •Gene No. •Advanced •Help •Gene •Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes, and links to genome-, phenotype-, and locus-specific resources worldwide. •Using Gene Gene Tools Other Resources •Gene Quick Start Submit GeneRIFs 1-10moloGene •FAQ Submit Correction OMIM •DowniaadIFTP Statistics RefSeo •RefSeq Mailing List BLAST RefSeqGene •Gene News 13 Genome Workbench UniGene •Factsheet Splign Protein Clusters

50. •1 •of 64 Next > Last » •P a g e •Aliases •Location •Chromosome 1, •ER-alpha, Esr  Esrl •estrogen receptor 1 [Rattus •NCBI Resources 17.1 How To 1,71 •Sign in to NCBI •Gene •V •Help •Hide sidebar » •Send to: 2 •Advanced •Display Settings: l,71 Full Report •re, NCBI Resources El How To 17 •Sign in to NCBI •estrogen receptor rat •X •Gene •Gene •Create alert Advanced •Help •Send to: (=I •Gene sources Genomic •Hide sidebar » •Filters: Manage Filters •Display Settings: 0 Tabular, 20 per page, Sort by Relevance •Categories Alternatively spliced Annotated genes Non-coding Protein-coding Pseudogene •Results: 1 to 20 of 1271 •0 See also 13 discontinued or replaced items. •Name/Gene ID Description •Results by taxon • Top Organisms [Tree]Homo sapiens (644) Mus musculus (300) Rattus norvegicus (294) •Gene •A •Table of contents •Summary •Genomic context •Genomic regions, transcripts, and products •Bibliography •Variation •Pathways from BioSystems •Interactions •General gene information •Markers, Homology, Gene Ontology •General protein information •NCB! Reference Sequences (RefSeq) Related sequences •Additional links •Related information •Unactive previous page of results •Esrl estrogen receptor 1 [ Rattus norvegicus (Norway rat) ] •Gene ID 24890, updated on 25-Jul-2015 •Esr1 provided by RGD •estrogen receptor 1 provided by RGD •RGD:2581 •Ensembl:ENSRNOG00000019358; Vega: OTTRNOG00000001366 •protein coding •PROVISIONAL •Rattus norvegicus •Eukaryota: Metazoa; Chordata; Craniata; Vertebrata: Euteleostomi; Mammalia; Eutheria; Euarchontoglires; •Glires; Rodentia; Sciurognathi; Muroidea; Muridae, Murinae; Rattus •Esr; ER-alpha: RNESTROR •acts as a transcriptional activator when bound to estrogen; may play a role in myocardial regulation IRGD, •Feb 2006] •Annotation category suggests misassembly •Summary •Official Symbol Official Full Name Primary source See related Gene type Ref Seq status Organism Lineage • Also known as Summary •Annotation

51. •Summary Genomic context O0 Genomic regions, transcripts, and products 00 •111.7, Bibliography O0 •Variation •Pathways from BioSystems •NM 012689.1 } NP 036821.1 estrogen receptor •See identical proteins and their annotated locations for NP_036821.1Status: PROVISIONAL • Source sequence(s) Y00102 UniProtKafSwiss-Prot P06211 • Related ENSRNORX1000026350, OTTRNOP00000001225, ENSRNOT00000028350, OTTRNOT00000002098 •Conserved Domains 44) summary •cd06949 •Location:315 —*552 •cd07171 •Location:185 — 266 •pfarnl 2743 •Location:557 —* 600 • pfarn 021,59 Oest_recep, Oestrogen receptor Location:42 — 186 •Genomic regions, transcripts, and products •Bibliography •Variation •Pathways from BioSystems •Interactions •General gene information • Markers, Homology, Gene Ontology General protein information •NCBI Reference Sequences (RefSeq) Related sequences •BioAssay by Target (Summary) •BioProjects •BioSystems •Conserved Domains •Full text in PMC •Full text in PMC nucleotide •Gene neighbors •Genome •GEO Profiles •HornaloGene •Map Viewer •Nucleotide •Probe •Protein ·ubChenn Compound Pubehem Substance ·ubMed ·ubrded (GeneRIF) PubMed(nucleatide/PMC) RefSeq Proteins •RefSeq RNAs •SNP •NR_LBD_ER: Ligand binding domain of Estrogen receptor, which are activated by the hormone 17beta-estradicil (estrogen) •NR_DBD_ER; DNA-binding domain of estrogen receptors (ER) is composed of two G4-type zinc fingers •ESR1_C; Oestrogen-type nuclear receptor final C-terminal •NCBI Reference Sequences (RefSeq) •Ref Seqs maintained independently of Annotated Genomes •These reference sequences exist independently of genonne builds. Explain •mRNA and Protein(s)

52. • • • • •Gene Card •www.genecards.org GeneCardsSuite GeneCards MalaCards LiteMap Discovery PathCards GeneAnalyIics GeneALaCart VarElect GenesLikeMeGeneLac •GeneCards ® •HUMANGENEDATABASE •Free for academic non-profit institutions_ Other users need a Commercial license ;MTV On •OFSCIENCE •Search Term 4 LifelViap Pius •Advanced •Home User Guide Analysis Tools- News And Views About My Genes Log In Sign Up •GeneCardse: The Human Gene Database •GeneCards is a searchable, integrative database that provides comprehensive, user-friendly information on all annotated and predicted human genes. It automatically integrates gene-centric data from >100 web sources, including genomic, transcriptomic, proteomic, genetic, clinical and functional information. •*GeneCardsSuite •Affiliated Databases •O,I,V1 a la ds •LifeMar •GeneLoc •GOICAIE Explore a Gene Analysis Tools G O1 1 1 1 4 7 `g e a T e A n NW } Sp ly k ic s ALB ry?rE)11,9t •Compounds Disorders •Domains •Expression Function •GeneALaCart •OGenesLikeMe •Jump to section for this gene: •Aliases

53. • 15) GeneCardsSultf GeneCards MalaCardsLifeMap Discovery PathCards GeneAna!rim GeneALaCart liarElect GenesLikeMe GeneLoc GeneCards® Free Ix academic non-profit institution& Other users need a Commercial license WEIZMANN INSTITUTE OF SCIENCE LifelViap HUMAN GENE DATABASE Advanced Home User Guide Analysis Tools, News And Views About"'My GenesLog In / Sign Up A ati MILUPORG Proteins & Enzymes Jump io Aliases Compounds Disorders Domains Expression Function Ge nom ics Localization Orthologs Research Products for AR Gene section Paralogs Pathways Products Proteins Publications Sources =3 Transcripts Variants Antibodies Proteins More... •SummariesAR or Gene o •Entrez Gene Summary forAR Gene Cf: •The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid- hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract causes spinal bulbar muscular atrophy (Kennedy disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Two alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008] •GeneCardsSummary forAR Gene •AR (Androgen Receptor) is a Protein Coding gene. Diseases associated with AR include prostate cancer and hypospadias 1, x-linked. Among its related pathways are Pathways in cancer and Akt Signaling. GO annotations related to this gene include sequence-specific DNA binding transcription factor activity and chromatin binding. An important para/og of this gene is NR3C1. •UniProtKBjSwiss-Prot for AR Gene ANDR_HUMAN,P10275 •Steroid hormone receptors are ligand-activated transcription factors that regulate eukaryotic gene expression and affect cellular proliferation and differentiation in target tissues. Transcription factor activity is modulated by bound coactivator and corepressor proteins. Transcription activation is down-regulated by NROB2. Activated, but not phasphorylated, by HIPK3 and ZIPIVIDAPK3. •Tocris Summary for AR Gene C

54. • •pJurnp to section •Research Products WAR Gene •Antibodies Proteins More •Aliases Compounds Disorders Domains Expression Function Genomics Localization Orthologs •Paralogs Pathways Products Proteins Publications Sources Summaries Transcripts Variants Localization for All Gene Addgene plasmids for AR RD R&D Systems cDNA Clones for AR (Androgen R 3CA ) Subcellular locations from UniProtKB/Swiss-Prot for AR Gene Nucleus. Cytoplasm. Note—Predominantly cytoplasmic in unligated form but translocates to the nucleus upon ligand-binding. Can also translocate to the nucleus in unligated form in the presence of GNB2L1. P13275-ANDR HUMAN Cell Line Products I—a:—"—ff... an atarr 1-1—, (n Junin to section Aliases Compounds Disorders Domains Expression Function Genomics Localization Orthologs Paralogs Pathways Products Proteins Publications Sources Summaries Transcripts Variants •Expression toeAft Gene mRNA expression in normal human tissues for AR Gene •Microarray •BrnGPS < Intensity >5'1 •0 1 1 0 1 0 0 •I •RNAseqGTExSAGE (Serial Analrisuf Gene Expression) •ClaIxFPKM)14 inumlna Body MapCLAP TAG. GCACCTTCAG • 1000 0 1 10 100 1000 0 1 10 100 1000 •I I I I I I I •B o n e M a r r o w W h o l e B l o o d W h i t e B l o o d C e l l s L y m p h N o d e T h y m u s B r a i n C o r t e x C e r e b e l l u m •Swine •Spinal Cord third Nerve •Heart •Merry •Smooth Muscle Skeletal Muscle Small Intestine Colon Adipocyte Kidney Liver •Major Tissues Research Products tor MI Gene •Antibodies Proteins More... •— mouse, rat tor AK •Predesigned siRNA for gene silencing in human,mouse,rat for AR • I I Santa Cruz Biot echnology (SCBT) s iRNA f or A R S ee all 4 - A R s iRNA (h) •AR sh RNA (h) Lentiviral Particles •Clone Products • I OriGene clones in human,mouse for AR •OriGene ORF clones in mouse,rat for AR Custom cloning services - gene synthesis, suhcloning, mutagenesis,. variant library, vector shuttling •GenScript: cDNA clones in your preferred vector •NM_001011645 Nk1_000044 •0Vector BioLabs ready-to-use •adenovirusiAAV for human, mouse, rat •Addgene plasmids for AR • RD R&D Systems cDNA Clones for AR (Androgen RiNR3C4) •Sino Biological Human cDNA Clone for AR •ACA AAA., ACCI.CC,APJ—AAA—I.

55. •NCBI •http://www.ncbi.nlm.nih.gov/ •e . •NCBI Resources 1...7.1 How To 1:.71 N ucleot ide Nucleotide horn° sapiens p531 •Save search Limits Advanced •Display Settings: CI Summary, 20 per page, Sorted by Default order •0 Found 16050 nucleotide sequences. Nucleotide (15791) EST (224) GSS () Results: Ito 20 of 15791 Pagel F-1 of 790I 0 Homo sapiens mRNA for P53, complete cds 12,451 bp linear mRNA Accession! AB082923.1 GI: 23491728 GenBank FASTA Graphics Related Sequences Homo sapiens p53 (p53) gene, axon 7 and partial cds 2. 110 bp linear DNA Accession: JF923572.1 GI: 349734069 GenBank FASTA Graphics Related Sequences

56. •NCB! Resouires 1:7..) How To 1:7.) Nucleotide [Nucleotide Limits Advanced •Display Settings: CI GenBank Send: CI •Change region shown Homo sapiens m RNA for P53, complete cds GenBank: A13082923.1 FASTA Graphics Customize view Basic Features (3 Default features 0 Gene. RNA. and CD Features added by N SNPs g 3 conserved domai Display options g Show sequence 0 Show reverse comp Go to: C) LOCUS AP082023 2451 bp mRNA linear PRI 01-APR-2003 DEFINITION Demo sapiens mRNA for P55, complete cds. ACCESSION AP082925 VERSION AP082923.1 GI:23491728 KEYWORDS SOURCE Goma sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoliresr. Primates; Saplorrhinir. Catarrhini; Dominidae; Homo. REFERENCE 1 AUTHORS Azuma,K., Shichijo,S., Maeda,Y., Nakatsura,T., Nonaka,Y., Fujii,T., Koike,K. and Itoh,K. TITLE Mutated p55 gene encodes a nonmutated epitope recognized by EILA-2+4601-restricted and tumor cell-reactive CTLs at tumor site JOURNAL Cancer Res. 65 {4), 854-858 {2005) PUSHED 12591757 REFERENCE 2 {bases 1 to 2451) AUTDORS Shichijo,S. and Itoh,K. TITLE Direct Submission JOURNAL Submitted (26-MAR-2002) Shigeki Shichijo, Kurume Univ. School of Med., Dep. Immunol..r. 67-Asahi-machi, Kurume, Fukuoka 830-0011, Japan {E-mail:shichijoOmed.kurume-u.ac.jp, Tel:81-542-31-7551, Fax:81-942-11-7699) FEATURES Location/ Qualifiers scsnrnp 1..249.1 Analyze this sequence R Pick Primers Highlight Sequence Featur Sequence Articles about the TP53 Nemo-like kinase is critica in response [Cell De Prp.rtrintir: uniHe of TPS: WAW

57. •NCBI Primer Blast •http://www.ncbi.nlm.nih.gov/tools/primer-blast/ •Primer-BLAST •firictirro •;61/Primer-BLAST: Finding primers specific to your PCR template (using Primer3 and BLAST).More... Tips for finding specific primers •Reset page Save search parameters Retrieve recent results •PCRTemplate •Enter accession, gi, or FASTA sequence (A refseq record is preferred)Clear •Or, upload FASTA file •(Choose File j no fib selected •M i n •Opt •M. Max Tm difference •Intron length range •Intron inclusion •(Tm) •Exoniintron selection •Exon junction span Exon junction match •A refseq mRNA sequence as PCR template Input Is required for options In the section • No preference1-41V.) Exon at 5' shift Exonat S' sIde •7'4 •Minimalnumberofbasesthatmustannealtoexons attheTor3'sideoftheJunction  Primerpairmustbeseparatedbyatleastoneintrononthe=respondinggenomIcDNA0, •MinMax •1000 101300130 •at a n •a a LIZ a Al •AB082923.1 •Primer Parameters •Use my own forward primer (5'->3' on plus strand) •Use my own reverse primer (5'- >3' on minus strand) •PCR product size •# of primers to return •1 0 •C l e a r •C l e a r •*low- Amplicon size 50-150bp for qPCR •Primer melting temperatures 57.0 60.0 63.0 3 •Range •From To •Clem •Forward primer Reverse primer •Mln Max •713 1060

58. • •Primer pair 3 • Sequence (5'->31 Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity • Forward primer AAAGTCTAGAGCCACCGTCC Plus 20 65 84 59.10 55.00 6.00 0.00 • Reverse primer GCAGTCTGGCTGCCAATCC Minus 19 186 168 61.41 63.16 7.00 3.00 • Product length 122 • Exon Junction 174/175 (reverse primer) on template NM 001276696.1 •Products on Intended target •>NM 001126114.2 Homo sapiens tumor protein p53 (TP53), transcript variant 3, mRNA •product length = 122 •Forward primer 1 AAAGTCTAGAGCCACCGTCC 20 •Template 65 •Reverse primer 1 GCAGTCTGGCTGCCAATCC 19 •Template 186 169 •Products on potentially unintended templates •>NM 001125118.1 Home sapiens tumor protein p53 (TP53), transcript variant 8, mRNA •product length = 122 •Forward primer 1 AAAGTCTAGAGCCACCGTCC 20 •8 4 •Template 65 94 •Reverse primer 1 GCAGTCTGGCTGCCAATCC 19 •Template 186 169 •>NM_001126113.2 Homo sapiens tumor protein p53 (TP53), transcript variant 4, mRNA •product length = 122 •Forward primer 1 AAAGTCTAGAGCCACCGTCC 20 •Template 65 94 •Reverse primer 1 GCAGTCTGGCTGCCAATCC 19 •Template 196 169

59. • •Sequence Similarity Search Tool: •UCSC Browser/BLAT •https://genome.ucsc.edu/ •U C S C •Genome Bioinformatics •Genomes - Blat - Tables - Gene Sorter - PCR - VisiGene - Session - FAQ - Help •G en o me B r o w s er •ENCODE •Neancle •Blat •Table •rowser •ne Sorter •n Silica •R • n a m e r a p h s •laxy •isiGene •Utilities •Down! •lease Log •u s t o m r a c k s • nc er r o w s er •About the UCSC Genome Bioinformatics Site •Welcome to the UCSC Genome Browser website. This site contains the reference sequence and working draft assemblies fora large collection of genomes. It also provides portals to the ENCODE and Neandertal projects. •We encourage you to explore these sequences with ❑urtools. The Genome Browserzoorns and scrolls over chromosomes, showing the work of annotators worldwide. The Gene Sorter shows expression, homology and other information on groups of genes that can be related in many ways. Blat quickly maps your sequence to the genome. The Table Browser provides convenient access to the underlying database. VisiGene lets you browse through a large collection of in situ mouse and frog images to examine expression patterns. Genome Graphs allows you to upload and display genome-wide data sets. •The UCSC Genome Browser is developed and maintained by the Genome Bioinformatics Group, a cross-departmental team within the Centerfor Biomolecular Science and Engineering (CBSE) at the University of California Santa Cruz (UCSC) If you have feedback or questions concerning the tools or data on this website, feel free to contact us on ourpublic mailing list The Genome Browser project team relies on public funding to support our work. Donations are welcome — we have many more ideas than ourfunding supports1 DONATE NOW •NewsD News Archives •To receive announcements of new genome assembly releases, new software features, updates and training seminars by email, subscribe to the genome- announce mailing list. •30 July 2014 — New Rat (rni6) Assembly Now Available in the Genome Browser •We are excited to announce the release of a Genome Browser for the July 2014 assembly of rat, Rattus norvegicus (RGSC Rnor_6.0, UCSC version rn6)1 This assembly is provided by the Rat Genome Sequencing Consortium, which is comprised of eight research organizations a cross the United States and Canada and led by the Baylor College of Medicine. The new RGSC Rnor6.0 assembly contains a new, partially assembled Y chromosome as well as improvements to other regions of the genome. You can find more information on the RGSC's efforts to sequence rat geno me on the Baylor College of Medicine's project page. •I_I •2.

60. • •UCSC Browser BLAT •https://genome.ucsc.edu/ •Genomes Genome Browser Tools Mirrors Downloads My Data Help About Us •Human BLAT Search •BLAT Search Genome Genome: Assembly: Query type: Sort output Output type: Human 'I411 [ Dec. 2013 (GRO138/hg38) [ DNA query,score'144 hyperlink •AAAGTCTAGAGCCACCCTCC •• •submit) I'm feeling lucky Cclear) •Paste in a query sequence to find its location in the the genome. Multiple sequences may be searched if separated by lines starting with '>' followed by the sequence name. •File Upload: Rather than pasting a sequence, you can choose to upload a text file containing the sequence. •Upload sequence: CChoose File) no file selected C submit Me) •Only DNA sequences of 25,000 or fewer bases and protein ortranslated sequence of 10000 or fewer letters will be processed. Up to 25 sequences can be submitted at the same time. The total limit for multiple sequence submissions is 50,000 bases or 25,000 letters. •For locating PCR primers, use In-Silico PCR for best results instead of BLAT.

61. •vvvvw.hprd.org • Human Protein Reference Database •' 1 Q u e r y 1 0 4 . B r o w s e I oiw a s / •4 i t F A Q s •-road •I. •Proteinpedpia •You are at: HMO •News •NOWChnOkigy •mewl: •bkudinakgy •"Human Proteinpedia enables data sharing of human proteins" in Februa •PhosphoMotif Finder, published in February 2007 issue of nature giotechf •6.1-C •nformatics •Comparison of Protein-Protein Interaction !Databases, published in MC Ei •fleconie •"Noiccarla Aulhoehly' •• •EA: •PatirwayS •PhasphtiVoli f Findor

62. Human Protein Reference Database •Query Browse Blast FAQs DowiloatJTI •isrnerp •1=6 flu Proteirrpedie I .▪."••-•• •. ' n •Pathways ji gibPhosphoidollf lirFinder ••••••••1* •Become aill •..111 •oilecarle Author •r You are at: HPRD »Query Query •The default behavior if more than one term is entered within afield is 'AND.' e.g. entering 'SH2SH3' in 'Domain' search field+, the proteins that have both 8H2 and SH3 domains. Similarly, if more than one field is filled in, it will be treated as an 'AND' c •information go to the FAQ Protein Name E53 Accession Number RefSeq V HPRD Identifier Gene Symbol Chromosome Locus Molecular Class See List See List PTMs Cellular Component See List See List Domain Name Motif See List Expression See List Length of Protein Sequence From : to : in amino acids Molecular Weight From : to : in kDa Diseases seam Clear_

63. •are at HPRD » Query » p53 ILT:plocularClass Transcription factor •p53 •'Molecular Function Transcription factor ac •Regulation of nucleol •Biological Process nucleoside, nucleotide •acid metabolism ; Apc •GO TO: Isc •PThs&SUBSTRATES •INTERACTIONS ETERNAL LINKS1 If ALTERNATE NAMES DISEASES SEQUENCE SUMMARY •I Protein Sequence 393AA NP 0011195341 •HEEPQSDPSI T hIPLSSSVPSQ RICSDSDGLAP EVRVCACPGR GSRAHSSHLK •EPPLSWFS DLWKLLPENN RTYQGSYGFR LGFLHSGTAK PUIIRVEGN LRVEYLDDRN DRRTEEENLR KKGEPHHELP SKRGINTSRE ECKLMFRTEGP •-VLSPLPSQAM SVICTYSPAL TFRESVVVPY PGSTRRALPN DSD •DDLMLSPDDI NEMFCQLART EPPEVGSDCT NTSSSPQPPY •EQWFTEDPGP DEAPRMPEAA PPVAPAPAAP TPAAPAPAPS CP1NLWVDST PPPGTRVRAM AIYKQSQHHT EVVRRCPHHE TIHYNYMOINS SCMGGMNRRP ILTIITLEDS SGNLLGRNSF RPLDGEYFTL QIRGRERFEM FRELNEALEL ZDAQAGREPG

64. •http://expasy.org/proteomics •3 -15E11 ExPAy •Bioinformatics Resource Portal •IQuery all databases •JI. search help •Visual Guidance •Categories •proteomics •protein sequences and identification mass spectrometry and 2-DE data protein characterisation and function families, patterns and profiles post-translationaI modification protein structure •protein-protein interaction •similarity search/alignment •genomics •structural bioinformatics systems biology phylogenyievolution population genetics transcriptomics biophysics •imaging •asy.orgiproteomics •neXtProt • human proteins • [more] •PROSITE • protein domains and families • [more] •STRING • protein-protein interactions • [more] •2 SWISS-MODEL Repository • protein structure homology models • [more] •UniProtKB • functional information on proteins • [more] •UniProtKB/Swiss-Prot • protein sequence database • [more] •ViralZone • portal to viral UniProtKB entries • [more] •EMBnet services • bioinformatics tools, databases and courses • [more] •2 ENZYME • enzyme nomenclature • [more] •GPSDB • gene and protein synonyms • [more] •ria HAMAP • UniProtKB family classification and annotation • [more] •MetaNetX • Metabolic Network Repository & Analysis • [more] •riaMIAPEGelDB • MIAPE document edition • [more] •ra MyHits • protein domains database and tools • [more] •PANDITplus • protein families and domains resources • [more] •PaxDb • protein abundance database • [more] •ria Prolune • Popular science articles (in French) • [more] •Drntoin fulnriol Dnrhal • otnintlir.ol infrornotinn fnr nrntoin • in-inrol •- . - • 2 SWISS-MODEL Workspace • structure homology-modeling • [rr SwissDock • protein ligand docking server • [more]  2ZIP • Prediction of leucine zipper domains • [more]  3of5 • find user-defined patterns in protein sequences • [more] it AACompldent • protein identification by as composition • [more] •AACompSim • amino acid composition comparison • [more] • Agadir • Prediction of the helical content of peptides • [more] la ALF • simulation of genome evolution • [more] • I3 Alignment tools • Four tools for multiple alignments • [more] AIIAII • protein sequences comparisons • [more]  APSSP • Advanced Protein Secondary Structure Prediction • [m •Ascalaph • Molecular modeling software • [more] •fl big-PI • predict GPI modification sites • [more] •2 Biochemical Pathways • Biochemical Pathways • [more] •2 BLAST • sequence similarity search • [more] •laBLAST (UniProt) • BLAST search on the UniProt web site • [mon •fl BLAST - NCBI • Biological sequence similarity search • [more] •I5 RI AqT _ DPII • PI AgT Q O U r r h nn nrntoi n conl i onno ttatal nacoo • •la SIB resources •If External resources - (No support from the ExPASy Teem) •Databases Tools

65. •Determination of theoretical molecular weight/pi •of a protein/fusion protein ExPASy Bioinfornnatics Resource Portal Ho Query all databases X search help SIB resources If External resources - (No support from the ExPASy Team) isual Guidance ategories Databases Tools •rig neXtProt • human proteins • [more] •UniProtKB • functional information on proteins • [more] UniProtKB/Swiss-Prot • protein sequence database • [more] •ENZYME • enzyme nomenclature • [more] •GPSDB • gene and protein synonyms • [mom] •HAMAP • UniProtKB family classification and annotation • [more] •re •MetaNetX • NICLOILJUIlt. INCLWAUIRE-S.C1.2U6ILUly CIL rtiridiy5isLinuiej •UniPathway • metabolic pathways for the UniProtKB • [more] •prOte0MiCS •protein sequences and identification mass spectrometry and 2-DE data •protein characterisation and function •families, patterns and profiles post-translational modification protein structure protein-protein interaction •rarity search/alignment •genomics •structural bioinformatics systems biology phylogenyievolution population genetics transcriptomics biophysics •imaging •IT infrastructure •AACompSim • amino acid composition comparison • [more] •Biochemical Pathways • Biochemical Pathways • [more] •14Compute pliMIN • theoretical pl and Mw computation • [more] •FindMod • protein post-translational modification prediction • [more] •FindPept • peptide identification from unspecific cleavage • [more] •HAMAP • UniProtKB family classification and annotation • [more] •MetaNetX • Metabolic Network Repository & Analysis • [more] •PredictProtein - Prediction of physico-chemical protein properties - [more]  PROPSEARCH • Functional and / or structural homolo-g search • [more] ProtParam • protein physical and chemical parameters • [more] ProtScale • protein profile computation and representation • [more]  PSORT • Protein subcellular location prediction • [more]  SAPS • Statistical analysis of protein sequences • [more]  SOSUI • Classification and Secondary Structure Prediction • [more]  TargetP • Sulacellular location prediction • [more] TopPred • Topology prediction of membrane proteins • [mom]

66. Summary  Molecular Biology  Processes and Tools  Molecular Medicine  Bioinformatic tools  Data bases

67. •N-N •ri N-N •ihm •I •"Upper panel is my first 4 years of work, •but the lower panel took only 1 year." Thank you all!!

PadminiNarayanan-Intro-2018.pptx

Esté a ler uma amostra.

Confira estes a seguir

PadminiNarayanan-Intro-2018.pptx

Mais Conteúdo rRelacionado

Semelhante a PadminiNarayanan-Intro-2018.pptx (20)

Mais de DESMONDEZIEKE1 (7)

Mais recentes (20)