O slideshow foi denunciado.
Utilizamos seu perfil e dados de atividades no LinkedIn para personalizar e exibir anúncios mais relevantes. Altere suas preferências de anúncios quando desejar.
Serie de Simposios de DuPont Plant Sciences
Octubre 17 y 18
Centro Internacional de Agricultura Tropical-CIAT
Palmira-Vall...
Generar cambios/mutaciones permanentes y heredables en un sitio específico
del ADN. Estos cambios son mediados por los sis...
KO: Polyphenol oxidase (PPO) - Oxidación
KO: granule bound starch synthase GBSSI – Almidón
tipo ceroso (Waxy)
KO: Genes FA...
Prueba de concepto en arroz, var. IR64
122 130 150
Diseño CRISPR
Transformación IR-64
Evaluación plantas editadas
Flor mas...
Eliminación del gen de selección nptII en plantas transgénicas sobreexpresando el gen OsNas.
Deficiencia global de Hierro ...
Transformar embriones inmaduros de líneas transgénicas OsNAS
Regenerar plantas
Evaluación molecular
Confirmar deleción
Del...
Pérdidas 25-75% en producción
Foto por: Michael Gomez Selvaraj. CIAT Phenotyping Platform
Validación del gen AGO4 en la re...
1kB p40 p46 p47 p48 p49 p50 p51 p52 p53 p54 p55 p56 p57 p58 p60 p61 n59 n34 n33 fd50 2000H20
RHBV / AGO 4
Egg Aparatous (EA)
Obtención de líneas androestériles
Factor de transcripción MYB35 (TDF)
Fenotipo TDF1
TDF1-P2 90 % del polen es estéril. Para P4, P5, P1 100% del polen es estéril
TDF1-P2 TDF1-P4 TDF1-P1 TDF1-P5...
Zhou et al. Nucleic Acids Research, 2014, Vol. 42 IR64 Editada única copia
Inducción de mutaciones en los promotores de lo...
Callo Embriogénico Friable de la
línea CP2-Cl10. Todos los callos
presentan tinción azul depués de
30 min en buffer de tin...
Resistencia a herbicidas en Yuca
Kaitano et al. 2009; Butterworth et al. 2008; Nweke, 2004
• Al menos tres homólogos para ALS en Yuca.
Target region 1 Target region 2
csr1-1 (Pro197→Ser) csr1-2 (Ser653→Asn)
Resist...
Desarrollo de cassava “WAXY” Methodology
Diseño CRISPRs
Transformación genética de cassava
Producción de callo
embriogénic...
• Tiempo de desarrollo de líneas endogámicas (12-15 años)
• Alta heterozigosidad.
• Difícil sincronización de floración.
•...
Transformación genética de P. vulgaris
1 Kb E14.1.1 E14.1.2 E 8.4 pCambia ICA H2O
Amplificación gen GUS
1 Kb E14.1.1 E14.1...
Prueba concepto con CRISPR/CAS9
FRIJOL
Diseño CRISPR
(PDS)
Metodología
Transformación Frijol
Evaluación molecular
Amplific...
Perspectivas
Establecimiento de nuevas variedades en la plataforma de transformación
Genotipos
Japónicas Indicas Líneas me...
Perspectivas
Diseño y Transformación con CRISPRs para:
- Aumento del número de granos/panícula
- Reducción en la absorción...
Perspectivas
Obtención de plantas editadas a partir de protoplastos
Fotos & Figs : Tiew TWY et al, Frontiers in Plant Scie...
Detección de acidos nucleicos mediante CRISPR-Cas13a/C2c2
Perspectivas
J. S. Gootenberg et al., Science 10.1126/science.aa...
Aplicación de la edición de genomas en los cultivos del CIAT
Próximos SlideShares
Carregando em…5
×

Aplicación de la edición de genomas en los cultivos del CIAT

604 visualizações

Publicada em

"Aplicación de la edición de genomas en los cultivos del CIAT" por Paul Chavarriaga. Líder Plataforma de Transformación y Edición de Genomas del CIAT.

Publicada em: Ciências
  • DOWNLOAD THIS BOOKS INTO AVAILABLE FORMAT (2019 Update) ......................................................................................................................... ......................................................................................................................... Download Full PDF EBOOK here { https://soo.gd/irt2 } ......................................................................................................................... Download Full EPUB Ebook here { https://soo.gd/irt2 } ......................................................................................................................... Download Full doc Ebook here { https://soo.gd/irt2 } ......................................................................................................................... Download PDF EBOOK here { https://soo.gd/irt2 } ......................................................................................................................... Download EPUB Ebook here { https://soo.gd/irt2 } ......................................................................................................................... Download doc Ebook here { https://soo.gd/irt2 } ......................................................................................................................... ......................................................................................................................... ................................................................................................................................... eBook is an electronic version of a traditional print book THIS can be read by using a personal computer or by using an eBook reader. (An eBook reader can be a software application for use on a computer such as Microsoft's free Reader application, or a book-sized computer THIS is used solely as a reading device such as Nuvomedia's Rocket eBook.) Users can purchase an eBook on diskette or CD, but the most popular method of getting an eBook is to purchase a downloadable file of the eBook (or other reading material) from a Web site (such as Barnes and Noble) to be read from the user's computer or reading device. Generally, an eBook can be downloaded in five minutes or less ......................................................................................................................... .............. Browse by Genre Available eBooks .............................................................................................................................. Art, Biography, Business, Chick Lit, Children's, Christian, Classics, Comics, Contemporary, Cookbooks, Manga, Memoir, Music, Mystery, Non Fiction, Paranormal, Philosophy, Poetry, Psychology, Religion, Romance, Science, Science Fiction, Self Help, Suspense, Spirituality, Sports, Thriller, Travel, Young Adult, Crime, Ebooks, Fantasy, Fiction, Graphic Novels, Historical Fiction, History, Horror, Humor And Comedy, ......................................................................................................................... ......................................................................................................................... .....BEST SELLER FOR EBOOK RECOMMEND............................................................. ......................................................................................................................... Blowout: Corrupted Democracy, Rogue State Russia, and the Richest, Most Destructive Industry on Earth,-- The Ride of a Lifetime: Lessons Learned from 15 Years as CEO of the Walt Disney Company,-- Call Sign Chaos: Learning to Lead,-- StrengthsFinder 2.0,-- Stillness Is the Key,-- She Said: Breaking the Sexual Harassment Story THIS Helped Ignite a Movement,-- Atomic Habits: An Easy & Proven Way to Build Good Habits & Break Bad Ones,-- Everything Is Figureoutable,-- What It Takes: Lessons in the Pursuit of Excellence,-- Rich Dad Poor Dad: What the Rich Teach Their Kids About Money THIS the Poor and Middle Class Do Not!,-- The Total Money Makeover: Classic Edition: A Proven Plan for Financial Fitness,-- Shut Up and Listen!: Hard Business Truths THIS Will Help You Succeed, ......................................................................................................................... .........................................................................................................................
       Responder 
    Tem certeza que deseja  Sim  Não
    Insira sua mensagem aqui

Aplicación de la edición de genomas en los cultivos del CIAT

  1. 1. Serie de Simposios de DuPont Plant Sciences Octubre 17 y 18 Centro Internacional de Agricultura Tropical-CIAT Palmira-Valle, Colombia
  2. 2. Generar cambios/mutaciones permanentes y heredables en un sitio específico del ADN. Estos cambios son mediados por los sistemas de reparación del ADN de la maquinaria celular, que posibilitan la inserción, deleción o alteración de las secuencias. Aplicaciones • Función génica: Knock-out • Reemplazo de alelos, inserciones, Knock-in. • Regulación de la expresión génica y epigenética • Gene Drive ¿Qué significa editar un genoma? https://ghr.nlm.nih.gov/primer/genomicresearch/genomeediting
  3. 3. KO: Polyphenol oxidase (PPO) - Oxidación KO: granule bound starch synthase GBSSI – Almidón tipo ceroso (Waxy) KO: Genes FAD2: Menos ácidos grasos poliinsaturados, + acumulación de aceite. KI: TALENs, inserción alelo en el gen POLLED
  4. 4. Prueba de concepto en arroz, var. IR64 122 130 150 Diseño CRISPR Transformación IR-64 Evaluación plantas editadas Flor masculina en plantas editadas IR64WT Fenotipo : Drooping leaf IR64WT
  5. 5. Eliminación del gen de selección nptII en plantas transgénicas sobreexpresando el gen OsNas. Deficiencia global de Hierro y Zinc Fuente: PSD online database(USDA) and FAOSTAT population database (FAO) 0 5 10 15 20 25 30 35 40 45 50 Fe Zn IRON AND ZINC CONCENTRATIONS IN RICE [] initial Conventional Plant breeding Required Transgenic ug/g Concentraciones de Hierro y Zinc en arroz
  6. 6. Transformar embriones inmaduros de líneas transgénicas OsNAS Regenerar plantas Evaluación molecular Confirmar deleción Delete 2.3 kb using CRISPR/Cas9 Eliminación del gen de selección nptII en plantas transgénicas sobreexpresando el gen OsNas.
  7. 7. Pérdidas 25-75% en producción Foto por: Michael Gomez Selvaraj. CIAT Phenotyping Platform Validación del gen AGO4 en la resistencia al Virus de la Hoja Blanca en Arroz . Morales y Jennings. CAB Reviews: Perspectives in Agriculture, Veterinary Science, Nutrition and Natural Resources 2010 5, No. 043
  8. 8. 1kB p40 p46 p47 p48 p49 p50 p51 p52 p53 p54 p55 p56 p57 p58 p60 p61 n59 n34 n33 fd50 2000H20 RHBV / AGO 4
  9. 9. Egg Aparatous (EA) Obtención de líneas androestériles Factor de transcripción MYB35 (TDF)
  10. 10. Fenotipo TDF1 TDF1-P2 90 % del polen es estéril. Para P4, P5, P1 100% del polen es estéril TDF1-P2 TDF1-P4 TDF1-P1 TDF1-P5 IR64 1kB p1 p2 p3 p4 p5 p6 p7 p8 p9 p10 p11 p12 p13 p14 p15 p16 p17 p18 p19 p20 IR64 H20
  11. 11. Zhou et al. Nucleic Acids Research, 2014, Vol. 42 IR64 Editada única copia Inducción de mutaciones en los promotores de los genes de susceptibilidad a Xanthomonas (SWEET11, 13, 14)
  12. 12. Callo Embriogénico Friable de la línea CP2-Cl10. Todos los callos presentan tinción azul depués de 30 min en buffer de tinción GUS a 37oC. GUSPlusTM NosT 35S hptII RB LB CP2 NosT cleavage site ATGGCTACTACTAAGCATTTGGCTCTTGCCATCCTTGTCCTCCTTAGCATTGGTATGACCACCAGTGCAAGAACCCTCCTAGATCTGAGGGTAAATTT CTAGTTTTTCTCCTTCATTTTCTTGGTTAGGACCCTTTTCTCTTTTTATTTTTTTGAGCTTTGATCTTTCTTTAAACTGATCTATTTTTTAATTGATTGGTTA TGGTGTAAATATTACATAGCTTTAACTGATAATCTGATTACTTTATTTCGTGTGTCTATGATGATGATGATAGTTACAGAACCGACGAACTAGTCTGTA CCCGATCAACACCGAGACCCGTGGC… CEF de la línea CP2-Cl10 editada con CRISPR/Cas9. Ensayo de GUS muestra callo blancos. Target site (yellow); PAM site (green); restriction site (triangle) CRISPR/Cas9 diseñado para editar GUSPlusTM CRISPR/Cas9 diseñado para phytoene desaturase (PDS) pdsKO wt Prueba concepto en Yuca
  13. 13. Resistencia a herbicidas en Yuca Kaitano et al. 2009; Butterworth et al. 2008; Nweke, 2004
  14. 14. • Al menos tres homólogos para ALS en Yuca. Target region 1 Target region 2 csr1-1 (Pro197→Ser) csr1-2 (Ser653→Asn) Resistencia a herbicidas en Yuca
  15. 15. Desarrollo de cassava “WAXY” Methodology Diseño CRISPRs Transformación genética de cassava Producción de callo embriogénico friable (CEF), desarrolado en CIAT, disponible para su transformación (60444). (Estado actual) Contenido de amilosa wt waxy Prueba Iodo Editar el gen GBSSI para obtener almidón libre de amilosa
  16. 16. • Tiempo de desarrollo de líneas endogámicas (12-15 años) • Alta heterozigosidad. • Difícil sincronización de floración. • Intentos infructuosos de producir DH a partir de cultivos de anteras y micro esporas. Obstáculos en el mejoramiento convencional Edición en Maíz Inducir mutación en el gen ortólogo ZmPLA1 en yuca para generar haploídia Obtención de líneas inductoras haploides en el maíz, generando una sola inserción en el gen ZmPLA1 Diploide Haploide Análisis de similitud para la selección de genes candidatos. Diseño sgRNAs Liu et al. 2017 Inducción de haploidía en yuca
  17. 17. Transformación genética de P. vulgaris 1 Kb E14.1.1 E14.1.2 E 8.4 pCambia ICA H2O Amplificación gen GUS 1 Kb E14.1.1 E14.1.2 E 8.4 pCambia ICA H2O Amplificación gen marcador hptII
  18. 18. Prueba concepto con CRISPR/CAS9 FRIJOL Diseño CRISPR (PDS) Metodología Transformación Frijol Evaluación molecular Amplificación región CAS9 gRNA PDS Cas9 HPT Spe E6.1.1 E.6.1.2 E.6.1.3 E6.1.4 E.6.1.5 E.6.1.6 Calima PLASMI H2O FRIJOL Diseño CRISPR Metodología Transformación Frijol Obtención de plantas Edición Proteínas antinutritivas Pruebas moleculares Identificación de Rafinosa y Estaquiosa en frijol
  19. 19. Perspectivas Establecimiento de nuevas variedades en la plataforma de transformación Genotipos Japónicas Indicas Líneas mejoradas Nipponbare IR64 CT21375F3-43-1 Curinga IRGA 424 CT24019 Caiapo Fedearroz 50 CT24026 Bluebonnet Fedearroz 2000 Nerica 4_T5 Fedearroz 60 Azucena Palmar 18 Llanura 11 SD20A Inia Olimar Supremo 13 Triunfo 960 CT21375 Fedearroz 2000IRGA 424 Bluebonnet Azucena
  20. 20. Perspectivas Diseño y Transformación con CRISPRs para: - Aumento del número de granos/panícula - Reducción en la absorción de Cd & As Inez et al. Enriching rice with Zn and Fe while minimizing Cd risk. Frontiers in Plant Science. 2015 Chen et al.Arsenic transport in rice and biological solutions to reduce arsenic risk from rice. Frontiers in Plant Science. 2017
  21. 21. Perspectivas Obtención de plantas editadas a partir de protoplastos Fotos & Figs : Tiew TWY et al, Frontiers in Plant Science 6, August 2015. https://www.mirusbio.com/applications/genome-editing-using-crispr-cas/rnp-delivery CIAT Ribonucleo-Proteína Planta Editada/Mutada No-ADN No transgenes No selección PEG
  22. 22. Detección de acidos nucleicos mediante CRISPR-Cas13a/C2c2 Perspectivas J. S. Gootenberg et al., Science 10.1126/science.aam9321 (2017). SHERLOK(Specific High sensitivity Enzymatic Reporter unlocking)

×