Ligação, permuta, mapas genéticos 2010

25.590 visualizações

Publicada em

1 comentário
6 gostaram
Estatísticas
Notas
Sem downloads
Visualizações
Visualizações totais
25.590
No SlideShare
0
A partir de incorporações
0
Número de incorporações
6
Ações
Compartilhamentos
0
Downloads
579
Comentários
1
Gostaram
6
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Ligação, permuta, mapas genéticos 2010

  1. 1. Ligação, permuta,mapas genéticosProf. Dra. Adriana DantasUERGS Bento Gonçalves
  2. 2. Segregação independente
  3. 3. Descoberta da Ligação• William Bateson e R.C. Punnett estudaram herança de dois genes:• Um afetando a cor da flor • (P – púrpura; p – vermelho)• Um afetando a forma dos grãos de pólen • (L – longo; l – redondo)• Propuseram que a proximidade física entre alelos dominantes e entre alelos recessivos impedem a distribuição independente na F1.
  4. 4. Bateson e Punnet ~1906 PPLL (purpura, longo) X ppll (vermelha, redondo) PpLl Fenótipos de ervilhas observados na F2Fenótipo (genótipo) Observado Proporção esperada 9:3:3:1Purpura longo (P_L_) 4.831 3.911Purpura, redondo (P_ll) 390 1.303Vermelho, longa (ppL_) 393 1.303Vermelho, redonda (ppll) 1.338 435 6.952 6.952
  5. 5. Bateson e Punnet ~1906
  6. 6. Cruzamento teste Cis Trans
  7. 7. Oque esta ocorrendo?• Os fenótipos desviam da proporção esperada de 9:3:3:1• Não parece ser explicado pela proporção mendeliana• Duas classes fenotípicas são maiores que o esperado: purpura longo e vermelha redondo.• Presença de mais gametas PL e pl do que seria produzido na distribuição independente
  8. 8. Teoria Cromossômica da Herança• Thomas Hunt Morgan em 1910, trouxe a primeira evidência para essa teoria.• Foi obtida a partir de estudos em uma mosca da fruta, a Drosophila melanogaster.• Adequado para estudos genéticos. • pequeno tamanho • baixo número de cromossomo • fácil criação em pequenos espaços de laboratório • cultura de manutenção econômica • grande número de descendentes por geração • grande número de gerações em pouco espaço de tempo • possibilidade de se obter fêmeas virgens logo após a eclosão para efetuar cruzamentos precisos.
  9. 9. Ligação e padrão de segregação
  10. 10. Morgan ~1911
  11. 11. Experimento de Morgan• Morgan cruzou moscas de linhagens puras com olhos vermelhos (gene dominante) e de olhos brancos.• Entretanto nem toda a progênie era de olho vermelho.• Quando cruzava machos de olho vermelho da geração F1 com suas irmãs fêmeas de olho vermelho produzia somente ¼ de• machos de olho branco mas nenhuma fêmea de olho branco.• Explicação desse resultado - a cor de olho nessa mosca deveria ser ligada ao sexo.• Então existiriam cromossomos sexuais que carregariam genes como os da coloração de olhos.
  12. 12. Proporções desviadas
  13. 13. Conclusões de Morgan• Valores observados se desviam muito da proporção mendeliana prevista 1:1:1:1 – INDICA LIGAÇÃO GÊNICA.• Morgan chamou a combinação não-parental de genes ligados de recombinantes;• Ele esperava 50% de fenótipos recombinantes se a segregação ocorresse independentemente;• Morgan observou 900/2.441 (36,9%) de fenótipos recombinantes. Então, concluiu que os dois genes devem estar ligados.
  14. 14. • Observando essa características apresentava o mesmo padrão de segregação em Drosophila: asas pequenas (Miniature), cor de corpo amarela (Yelow)• Morgan trouxe, portanto, como evidência da Teoria Cromossômica da Herança, os padrões de segregação dos genes ligados aos cromossomos sexuais em Drosophila.
  15. 15. Autossomos ligados P X pr+pr+ vg+vg+ prpr vgvg Gametas pr+ vg+ pr vg F1 pr+pr vg+vgAs duas maiores classes são as combinações pr+vg+ e prvg, originalmenteintroduzidas pelas linhagens parentais homozigotas.
  16. 16. Herança dos gametas Na herança dos genes ligados, a freqüência dos gametas de um heterozigoto depende da taxa de crossing-over ou taxa de recombinação que ocorre entre os cromossomos homólogos. Os Gametas Parentais são formados mesmo que não haja recombinação e aparecem em maior quantidade. Os Gametas Recombinantes são formados apenas se houver permuta e aparecem em menor quantidade. A Taxa de Crossing é expressa em porcentagem e corresponde a freqüência de gametas recombinantes formados na gametogênese.
  17. 17. Cruzamento teste• Um dos genitores (o testador) contribui com gametas que só possuem alelos recessivos• Os fenótipos da prole revelam a contribuição gamética do outro, o genitor duplamente heterozigoto• Analisador se concentra na meiose de um genitor e esquece o outro• Analise da prole F1 autofecundada, apresenta dois conjuntos de meiose a ser considerada: um genitor masculino e genitor feminino
  18. 18. Autossomos ligados P X F1 pr+pr vg+vg pr+pr vgvg prpr vg+vg prpr vgvg 1339 151 154 1195 Parental Recombinante Recombinante ParentalCruzamento teste revela a aproximação de uma proporção 1:1 entre os dois tiposparentais e também entre os dois tipos não parentais
  19. 19. F1 usado em cruzamentoteste• pr+pr+ vgvg X prpr vg+vg+• F1 pr+pr vg+vg  X prpr vgvg• F2 pr+vg+ 157 Desvio da proporção prvg 146 mendeliana de 1:1:1:1 Classes maiores são pr+vg 965 as que tem um alelo dominante prvg+ 1.067
  20. 20. Herança simples de dois pares de alelossituados no mesmo par cromossomico• Duas situações: • Alelos dominantes se repelem – REPULSÃO • Um dominante e um recessivo em cada cromossomo pr+ vg pr+ vg • Alelos dominantes estão grudados – LIGAÇÃO • Num cromossomo estão ligados os alelos dominantes dos dois genes ou dos recessivos pr+ vg+ pr vg
  21. 21. Posição dos genes Na vinculação gênica a posição dos genes no heterozigoto (AaBb) pode ser Cis ou Trans. Estas posições também podem ser utilizadas para se definir quem são os gametas parentais e os recombinantes. A B A b a b a B Posição CIS Posição TRANS
  22. 22. Genes Ligados - Linkage Quando dois ou mais genes, responsáveis por diferentes características, estão localizados em um mesmo cromossomo, a herança é chamada de Vinculação Gênica. Nestes casos a quantidade de gametas e portanto a freqüência da descendência apresentarão diferenças em relação ao diibridismo. Crossing-Over ou permuta é a troca de partes entre cromossomos homólogos durante a meiose e é um dos principais fatores para a variabilidade genética.
  23. 23. Entendendo a recombinação• As disposições originais de alelos nos dois cromossomos são chamados combinações parentais• As duas novas combinações são chamadas de produtos do crossing ou recombinantes
  24. 24. Crossing-over• A ligação entre os genes pode ser incompleta, pois durante a prófase I da meiose, quando os cromossomos homólogos estão pareados, ocorrem trocas de partes entre as cromátides irmãs, num processo chamado crossing-over ou permutação.• Essas trocas resultam na formação de gametas recombinantes, que são cromossomos com novas combinações de alelos.
  25. 25. Recombinaçãointercromossômica • Distribuição mendeliana independente causa recombinação intercromossômica • As duas classes recombinantes constituem 50% da prole, isto é 25% de cada tipo recombinante na prole. • Os dois genes estão em pares separados de cromossomos
  26. 26. Ligação gênica• Se não houvesse recombinação nesses genes, a proporção de gametas formados por um duplo heterozigoto seria 50% AB e 50% ab.• No processo de segregação independente, um indivíduo AaBb produz 4 tipos de gametas, na proporção de 25% cada.• Quando ocorre um caso de ligação gênica, o indivíduo AaBb produz apenas gametas AB e ab, na proporção de 50% cada.
  27. 27. Recombinaçãointracromossômica • O crossing-over produz recombinação intracromossomica • Duas cromátides não-irmas podem fazer crossing • Não há crossing entre dois genes específicos em todas as meioses, mas qdo há, metade dos produtos desta meiose são recombinantes • A meiose sem crossing entre os genes em estudo só produz genótipos parentais. • Sinal de recombinação intracromossômica é menos de 50% - genes ligados • Com 50% - não ligados – genes em cromossomos separados
  28. 28. Ligação gênica• Quando há recombinação, observa-se na descendência uma pequena proporção de recombinantes, por exemplo: 40% – AB (parental) 40% – ab (parental) 10% – Ab (recombinante) 10% – aB (recombinante)• Quanto mais afastado um gene estiver do outro, maior será a taxa de recombinação.
  29. 29. Formação de Gametas Tetrade A s B Cromátides irmãsCromossomos A BHomólogos a b Cromátides irmãs a b A B Quiasma: estrutura de A b recombinação entre a B cromátides não-irmãs a b Primeira divisão meiótica A B a B A b a b Segunda divisão meiótica A B A b a B a b Quatro gametas haplóides
  30. 30. Crossing Over e Recombinação Permuta simples
  31. 31. Permutas duplas envolvendo 2 cromátides Permutas duplas envolvendo 3 cromátides
  32. 32. Permutas duplas envolvendo 4 cromátides
  33. 33. Crossing over
  34. 34. Mapas de ligação•Morgan observava que a proporção de prole recombinantevariava, dependente de quais genes ligados estavam sendoestudados•Variações na frequência de crossing-over refletem a distanciareal que separa os genes do cromossomos•A porcentagem de recombinantes genéticos produzidos numcruzamento teste reflete a relação de ligação entre os genes.•Stutervant desenvolveu um método para descrever adiferença de separação espacial dos genes, onde asvariações de recombinantes determinaria as sequencias nadimensão linear de um cromossomo
  35. 35. Postulado de Sturtevant• Quanto maior a distancia entre os genes ligados, maior a probabilidade de as cromátides não- irmãs se cruzarem na região entre os genes e, e portanto, maior a proporção de recombinantes que seriam produzidos• Assim obtendo a frequência de recombinantes, obtemos uma medida de distancia do mapa genético de ligação entre os genes
  36. 36. Unidade de mapa (u.m.)• A partir da frequência de recombinação é possível construir o mapa gênico de um cromossomo.• Definição – é a distancia entre os genes para a qual um produto de meiose em 100 é recombinante.• Uma frequência de recombinação (FR) de 0,01 (ou 1%) é definida como 1 u.m.• Uma unidade de mapa é chamada centimorgan (cM)• As unidades são medidas em unidades de recombinação (UR), morgan ou centimorgan • uma UR corresponde a 1% da taxa de recombinação
  37. 37. Distância de mapa A BMapa baseado na recombinação A-B 5 u.m. A C Mapa baseado na recombinação A-C 3 u.m. A C B Mapas com 5 u.m. genes combinados possiveis C A B 8 u.m.
  38. 38. Locus gênico (loci)• Local onde o gene esta situado no cromossomo• Locus do gene cor de olho e locus do gene para comprimento de asa estao separados em 11 u.m. pr 11.0 vg
  39. 39. Analise em três caracteresO macho é triplo homozigoto recessivo abc/abcA femea é tripla heterozigota dominante ABC/ABCGeraram 1000 descendentes
  40. 40. Frequência de recombinantesA–B 367/1000 = 36,7% = 36,7 CmB–c 107/1000 = 10,7% = 10, 7 cMA–C 450/1000 = 45,0% = 45,0 cMPodemos construir um mapa genético a partir destes dados
  41. 41. Teste de dois pontos 415 92 88 405
  42. 42. Parentais 820 Freqüência de 180 _____Recombinantes 180 = recombinação 1.000Total 1.000 vg 18 u.m. b
  43. 43. Teste dos três pontos
  44. 44. sc 9,1 ec 10,5 cv
  45. 45. Mapas gênico em Drosofila• Em drosófilas, encontraram as seguintes taxas de recombinação e mapearam os genes p, v e r: Taxa de Genes recombinação Distância p–v 17% 17 UR p–r 9% 9 UR r–v 8% 8 UR
  46. 46. Problema• Em Drosophila melanogaster, asa selvagem (normal) é dominante sobre asa miniatura; olho selvagem (marrom-avermelhado) é dominante sobre olho vermelho. Fêmeas selvagens puras foram cruzadas com machos de asa miniatura e olhos vermelhos. As fêmeas da geração F1 foram cruzadas com machos recessivos, produzindo a seguinte descendência:
  47. 47. Problema  48,5 % asa selvagem / olho selvagem  48,5 % asa miniatura / olho vermelho  1,5 % asa selvagem / olho vermelho  1,5 % asa miniatura / olho selvagem Pergunta-se: a) Qual é a evidência de que se trata de um caso de ligação gênica? b)Qual é a distância relativa entre os loci considerados?
  48. 48. Soluçãoa) Como se trata de um cruzamento-teste, o fenótipo da descendência é determinado pelo genótipo dos gametas produzidos pelo indivíduo com características dominantes. Assim, os tipos de óvulos que geraram cada uma das classes de descendentes são:
  49. 49. Solução Fenótipos da Genótipo dos Porcentagem descendência óvulosselvagem / selvagem MV 48,5 %miniatura / vermelho mv 48,5 %selvagem / vermelho Mv 1,5 %miniatura / selvagem mV 1,5 % Percebe-se que não se trata de segregação independente porque os gametas femininos não ocorrem na proporção de 1:1:1:1 (25 % de cada tipo)
  50. 50. Solução Trata-se, portanto, de um caso de ligação gênica incompleta, pois se formaram quatro classes fenotípicas, duas em maior frequência (classes parentes) e duas em menor frequência (classes recombinantes)
  51. 51. Soluçãoa) Estimamos a distância relativa entre os dois loci gênicos a partir da frequência de permutação entre eles. A frequência de permutação é igual à soma das frequências das classes recombinantes, ou seja, 3 % (1,5 % + 1,5 %). Assim, a distância entre esses dois loci é de 3 UR ou 3 centimorgans.
  52. 52. Mapeamento gênico emeucariotos• Genes sobre cromossomos não homólogos segregam independentemente.• Genes sobre o mesmo cromossomo (sintênicos) estão fisicamente ligados (grupo de ligação) e podem ser herdados juntos.Objetivo:• Analisar a freqüência de recombinação alélica em cruzamentos;• Novas combinações de alelos parentais são produzidos por recombinação (“crossing-over” durante a meiose I);• Cruzamentos-teste são usados para determinar quais genes estão ligados e criar um mapa de ligação (mapa genético de cada cromossomo).
  53. 53. Mapeamento Genético Mapa genético ou cromossômico é a representação da posição dos genes no cromossomo. Está diretamente relacionada a taxa de crossing. Unidades de Recombinação (U.R.) ou Morganídeos (M) são as unidades usadas para determinar a posição dos genes no cromossomo e correspondem a taxa de crossing. Exemplo: Em um cromossomo há a seguinte frequência de recombinação entre os genes A,B,C e D: A-B  45% A-C  20% C-B  25% B-D  5% C-D  20% A-D  40%
  54. 54. Qual a posição dos genes nocromossomo? 20M 20M 5M A C D B 40M 45M
  55. 55. Grupo de Ligação
  56. 56. Populações de Mapeamento
  57. 57. Aplicação dos mapas geneticos Guia para o sequenciamento de genomas, pois mostra a posição de genes e dos e marcadores genéticos Tipos de mapas: Mapa Genético de ligação e Mapa Físico• Identificar genes relacionados a doenças herdadas• Analisar uma série de marcadores polimórficos em famílias com o gene de interesse.
  58. 58. Como se faz?• Cromossomos individuais em muitas espécies animais tendem a ter cerca de 100 cM de comprimento (100 x 106 pb)• Assim, ocorre um “crossing over” por cromossomo por geração.• Marcadores localizados em cromossomos diferentes têm 50% de chance de “co-segregarem”, estando a 50 cM de distância.• 50 cM é o limite mínimo para se caracterizar dois marcadores como pertencentes ao grupo de ligação (“linkage group”) – ou ao mesmo cromossomo.
  59. 59. Marcadores que co-segregam• Ainda assim, é possível, dois marcadores que se recombinem em 50% das vezes podem estar no mesmo grupo de ligação, desde que estejam relacionados a um terceiro marcador que mostre menos de 50% de recombinação com cada um dois primeiros marcadores
  60. 60. RAPD Dominante DNA 100 - 1,500 basesPrimers são separados em pouca distância, fragmento É AMPLIFICADO
  61. 61. RAPD (Random Amplified Polymorphic DNA) A BA B
  62. 62. Marcadores “dominantes” A1A1 A1A2 A2A2
  63. 63. Marcadores “dominantes” 01 02 03 04 05 06 07 08 09 10 Ind. L1 L2 L3 L4 L5 L6 L7 L8 01 0 1 0 1 1 0 1 1 02 1 0 0 0 1 1 0 1 03 0 0 1 1 1 0 0 1L1L2 04 0 1 1 1 0 1 0 1L3 05 1 1 0 0 1 1 0 1L4 06 0 0 1 0 1 0 0 1L5 07 0 1 1 0 1 0 0 0L6 08 0 1 0 1 0 1 0 1L7 09 1 0 1 0 0 0 0 1L8 10 0 1 0 1 1 0 0 1
  64. 64. Análise em gel de RAPDQUAIS AS POLIMÓRFICAS? QUAIS AS (CO)SEGREGANTES?
  65. 65. Onde estão localizados no genoma os marcadores? Genoma Genes e sequências DNA extragênico relacionadas DNA codificante DNA não DNA repetitivo codificanteRAPDs Introns Repetições em Repetições Fragmentos de tandem dispersasAFLPs genesoutros Transposons Satélites Sequências de inserção Microssatélites Minissatélites
  66. 66. Microsatélites• SSR – Simple Sequence Repeats • Pequenas sequências (“sequence motif”) com 1 a 4 nucleotídeos repetidos em tandem - Amplificados via PCR • Classe de marcadores moleculares mais polimórficosSinonímiasSSR (Simple Sequence Repeats);STMS (Sequence Tagged Microsatellites);SSLP (Single Sequence Length Polymorphisms);Onde são encontrados ???Mamíferos: (CA)n ( 50.000 a 100.000 vezes no genoma)Plantas: (AT)nMitocôndriasCloroplastos
  67. 67. M homozigoto heterozigoto Marcador co-dominante Marcador multialélico
  68. 68. Marcadores “co-dominantes” A1 A1 A1 A2 A2 A2
  69. 69. Marcadores “co-dominantes” Ind. L1 01 1/3 02 3/4 01 02 03 04 05 06 07 08 09 10 03 2/3 04 3/3 05 1/3 06 1/11 07 1/323 08 1/4 09 3/34 10 1/2
  70. 70. Sequenciamento de regiões microssatélites
  71. 71. Mapeamento genético de ligação• Identificar marcadores genéticos ligados aos genes de interesse,nos respectivos cromossomos;•Disponibilizados para as principais espécies de importânciaagronômica;•QTLs e/ou QRLs rastreados e etiquetados, visando uma melhoria na eficiência da seleção. AFLP Gene Vf (Sarna) Xu & Korban, 2000
  72. 72. CARACTERIZAÇÃO BIOLÓGICA Fenotipagem (Locos de resistência)• Melrose x Gala – 86 plantas• M13/91 x Gala - 129 plantas• M13/91 x M46/94 -185 plantas
  73. 73. M9 x Marubakaido - 85 F1 (QTLs - loci quantitativos) A B Perfilhos uniformespulgão espinhos tipo spur Perfilhos uniformes
  74. 74. Marcas segregantesProgênie F1 (Santa Rosa x Chatard) S C M
  75. 75. 840marcadores:475 AFLPs235 RAPDs129 SSRs
  76. 76. Caracterização molecularIdentificação de marcas candidatas
  77. 77. Desenvolvimento de um SCAR (Sequence characterized amplified RAPD)• identificação de um iniciador que confere polimorfismo a dois bulks de DNA com fenótipos contrastantes,• o isolamento e a clonagem do fragmento amplificado em um vetor (plasmideo),• sequenciamento do fragmento isolado,• desenho dos iniciadores de tamanho maior que os decâmeros,• teste final em plantas.
  78. 78. Validação das Marcas – Desenvolvimentos demarcadores específicos (Clonagem por mapeamento)
  79. 79. Marcador Primer Gene Referencia RAPDS OPM18900 CACCATCCGT Vf Koller et al.,1994 OPU01400 ACGGACGTA Vf Koller et al.,1994 OPD20500 ACCCGGTCAC Vf Yang & Kruger, 1994 OPC081100 TGGACCGGTG Vf Tartarini 1996 OPC09900 CTCACCGTCC Vf Tartarini 1996 OPAL07580 CCGTCCATCC Vf Tartarini 1996 OPAM192200 CCAGGTCTTC Vf Tartarini 1996 OPA15900 TTCCGAACCC Vf Durham and Korban 1994 OPO141700 AGCATGGCTC Vf King et al. 1998 OPAF132000 CCGAGGTGAC Vf King et al. 1998 OPAG051900 CCCACTAGAC Vf King et al. 1998 OPAG12800 CTCCCAGGGT Vf King et al. 1998 SSR CH05e03 For:CGAATATTTTCACTCTGACTGGG Vbj M.Gygax (Frey et al.,2004) Rev:CAAGTTGTTGTACTGCTCCGA CH02B10 For: CAAGGAAATCATCAAAGATTCAAG Vr Hemmat et al.,2002 Rev: CAAGTGGCTTCGGATAGT CHVf1 For: ATCACCACCAGCAGCAAAG Vf C.Gessler (Frey et al.,2004) Rev: CATACAAATCAAAGCACAACCC CH02c06 For: TGACGAAATCCACTACTAATGCA Vr Baldi et al.,2004 Rev: GATTGCGCGCTTTTTAACAT CH02C02a For: CTTCAAGTTCAGCATCAAGACAA Vr2 Patocchi et al., 2003 Rev: TAGGGCACACTTGCTGGTC CH02B07 For: CCAGACAAGTCATCACAACACTC Vd Calenge et al., 2005 Rev: ATGTCGATGTCGCTCTGTTG Primers específicos Vf Vfa1 For: TCTATCTCAGTAGTTTCTATAATTCC Vf Xu & Korban (2002) Rev:GTAGTTACTCTCAAGATTAAGAACTT Vfa2 For: CTCAATCTCAGTAGTTTCTATGGA Vf Xu & Korban (2002) Rev: CCCCCGAGATTAAGAGTTG Vfa3 For:ATATTAGTAGTTTCTATAATCTGAAGG Vf Xu & Korban (2002) Rev:CCCCCGAGATTAAGAGATG Vfa4 For:TATCTCAATCTCAGTAGTAATAGTATC Vf Xu & Korban (2002) Rev:GACCTTGGAAACCACAATC AL07/SCAR 450 464 For: TCCTTACTGAGGAGGAAACCAG Tartarini et al. (1999) Rev: CAAGGGAACTGATCTTTCGTTG ARGH ARGH 25/CH02B07 For:CAAACATCATCGTAATTTTGACG Vd Baldi et al.,2004 Rev:CATACTCTTCATGAGGATAATTC ARGH37 For:TGCACGACATTAGCAACACTG Vr2 Baldi et al.,2004 Rev:GAAACAACTTCTTTTGAGAGTTC ARGH17 For:TTGCCGACGTTCGTGATGCT Vr2 Baldi et al.,2004 Rev:GATATCCTTTGTTTGGACAACC ARGH 34/CHVf1 For:TGTATGACCAGCCGAAGGTG Vf1 Baldi et al.,2004 REv:CCAGGACAACAATGTACCTCSeleção assistida por marcadores (SAM)
  80. 80. ProteínasAtributos Isoenzimas de sementes RFLPs RAPDs Microssatélites AFLPsNível de baixo alto baixo-alto baixo-alto muito alto muito altoPolimorfismoEstabilidade moderada alta alta alta alta altaambientalNúmero de locos moderado (<50) baixo (<10) alto alto alto altoExpressão genética co-dominate co-dominante co-dominante dominante co-dominante dominanteNúmero de alelos por 2-5 multialélico multialélico 2 multialélico 2locoDistribuição no regiões de cópia regiões de cópia várias ao acaso ao acaso ao acasogenoma única únicaAcessibilidade muito alta muito alta média muito alta muito baixa médiatecnológicaAplicabilidade no rápido, rápido, lento, rápido, baixo lento, custo alto rápido, customelhoramento baixo custo baixo custo custo médio custo baixoIdentificação de baixa baixa alta muito alta muito alta muito altagenótiposAvaliação de média baixa alta alta alta muito altagermoplasmaMapeamento baixa muito baixa alta alta muito alta altagenéticoMapeamento de baixa inadequado média muito alta média muito altaregiões específicasMapeamento baixa inadequado muito alta baixa alta baixacomparativoGenética de baixa baixa média alta muito alta muito altaAutógamasGenética de média baixa média alta muito alta muito altaAlógamasAnálise Filogenética média baixa muito alta média alta médiaAdaptado de Gepts (1993) e Ferreira & Grattapaglia (1995).
  81. 81. Mapas físicosÉ a distância entre posições de seqüências definidas de DNAexpressa de kilo bases.•O mapa físico final é a seqüência completa.•Montagem de mapas físicos: • Alinhamento de clones isolados aleatórios com base em perfis de fragmentos de restrição. • Abordagem baseada em hibridizações: uma sonda comum é usada para identificar quais numa série de clones são provavelmente contíguos. • Sequenciamento de diferentes fragmentos de DNA e organização dos fragmentos pela análise de superposições (contigs) • Contigs podem ser estendidos pelo sequenciamento da extremidade de clones específicos, levando à identificação de “sequenced-tagged sites” – STSs.
  82. 82. 5’..GTPyPuAC..3’3’..CAPuPyTG..5’5’..AAGCTT..3’3’..TTCGAA..5’ Mapa de restrição: duas moléculas de DNA com o mesmo mapa de restrição devem ser iguais.
  83. 83. Os diferentes fragmentos de DNA são sequenciados e apartirdos mesmos vão sendo contruídas as seqüênciascontínuasCONTIGS
  84. 84. Mapa físico Genoteca de BAC/YACMapa
  85. 85. Mapa genético humanoO primeiro mapa genético humano de alta resolução foi publicado em 1994.Em 2.000, mais de 1milhão de SNPs identificados. Um marcador polimórfico a cada ~2.000 pb.Marcadores genéticos são geralmente considerados como atributos do DNA: uma seqüência específica identificada em um dado locus (sequence tags) repetições simples (microssatélites) polimorfismo de restrição
  86. 86. Mapas detalhadosde cromossomoshttp://www.ncbi.nlm.nih.gov
  87. 87. HumanosArroz
  88. 88. Melhoramento molecular (molecular breeding)Populações segregantes Expressão gênica - RNAm Marcador molecular Bibliotecas cDNA Polimorfismo Banco de dados Mapeamento de QRL/ QTL Seleção assistida Proteôma

×