This talk is about how both private enterprise and government wish to improve the value of their data and how they deal with this issue. The talk summarizes the ways we think about Big Data, Open Data and their use by organizations or individuals. Big Data is explained in terms of collection, storage, analysis and valuation. This data is collected from numerous sources including networks of sensors, government data holdings, company market databases, and public profiles on social networking sites. Organizations use many data analysis techniques to study both structured and unstructured data. Due to volume, velocity and variety of data, some specific techniques have been developed. MapReduce, Hadoop and other related as RHadoop are trendy topics nowadays.
In this talk several applications and case studies are presented as examples. Data which come from government sources must be open. Every day more and more cities and countries are opening their data. Open Data is then presented as a specific case of public data with a special role in Smartcity. The main goal of Big and Open Data in Smartcity is to develop systems which can be useful for citizens. In this sense RMap (Mapa de Recursos) is shown as an Open Data application, an open system for Madrid City Council, available for smartphones and totally developed by the researching group G-TeC (www.tecnologiaUCM.es).
Axa Assurance Maroc - Insurer Innovation Award 2024
Big&open data challenges for smartcity-PIC2014 Shanghai
1. Big and Open Data
Challenges for Smartcity
Victoria López
Grupo G-TeC
www.tecnologiaUCM.es
Universidad Complutense de Madrid
2. Big and Open data. Challenges for Smartcity
• Introduction
• Fighting with Big Data: Genoma Data
• Big Data. Big Projects
• Open Data. Technology Transfer Opportunities
• Smartcity. Big and Open Systems
• Madrid as Smartcity
• Conclusions
2
3. Introduction
Our Goal: to transfer technology and knowledge
– Mobile technologies applyed to environment
– Intelligent agents
– Optimization and forecasting from data
– Bioinformatics, Biostatistics
G-TeC group: statisticians, physicists, mathematicians,
economists and several computer scientists.
– www.tecnologiaUCM.es
4. Fighting with the Big Data
• Every day we need to deal with more and more data.
• For many years, new computers with more memory and higher
speed seem to be the solution for data growing (Elephant vendors).
• Many researching areas which was fighting with the Big Data:
Bioinformatics, Genoma data, DNA, RNA, proteins and, in general all
biological data have been required by computing monitors and
storing in large data bases in several laboratories and researching
centers along the world.
The future of genomics rests on the foundation of the Human Genome Project4
5. Fighting with the Big Data
• Each time an organization or an individual is not able
to deal with data, a big data problem is facing.
• Human Genoma Project managed with same
philosophy than modern Big Data: large data bases
distributed along the world with parallel processing
when available and suitable.
• Our experience: Sequence alignment and its
optimization with Dynamic Programming and
their heuristics.
• The amount of biological data is a Big Data base.
• Adding new sequences, searching and forecasting are
task very similar than those we face in every Big Data
problem.
5
6. 22/05/2014
Vineyards in La Geria, Lanzarote
6
Case of Use. Looking for a Fungus
• Application to infections in agricultural
crops when it is no possible to identify
the real fungus.
• The responsible needs to make
decisions about what to do, what
medicine apply, or procedure is better.
– A fragment of fungus DNA must be
sequenced in the lab.
– Then the scientist looks for it in molecular
data bases by means of sequence
searching (“DB homology search”).
– Some alignment algorithms (Blast, Fasta)
are executed to return the best matches.
• gtttacgctctacaaccctttgtgaacatacctacaactgttg
cttcggcgggtagggtctccgcgaccctcccggcctcccgcct
ccgggcgggtcggcgcccgccggaggataaccaaactctgatt
taacgacgtttcttctgagtggtacaagcaaataatcaaaact
tttaacaaccggatctcttggttctggcatcgatgaagaacgc
agcgaaatgcgataagtaatgtgaat
The sequence
7. 22/05/2014 7
1. EBI: European Bioinformatics Institute
2. Choose the tools available into the web site
a. Fasta3
b. Select DATABASE:
• Nucleic ACIDS
• FUNGI
c. Fit sequences and run queries
3. A sorted list (but not complete) from better to
worst similarity is returned.
Data Base and Algorithm Selection
PIC 2014, Shanghai
Case of Use
13. 22/05/2014 13
The output
• FASTA searches a protein or DNA sequence data bank
• version 3.3t09 May 18, 2001
• Please cite:
• W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448
• @:1-: 241 nt
•
• vs EMBL Fungi library
• searching /ebi/services/idata/v225/fastadb/em_fun library
• 104701680 residues in 66478 sequences
• statistics extrapolated from 60000 to 61164 sequences
• Expectation_n fit: rho(ln(x))= -1.2290+/-0.000361; mu= 72.1313+/- 0.026
• mean_var=907.6270+/-295.007, 0's: 68 Z-trim: 4246 B-trim: 15652 in 3/79
• Lambda= 0.0426
• FASTA (3.39 May 2001) function [optimized, +5/-4 matrix (5:-4)] ktup: 6
• join: 48, opt: 33, gap-pen: -16/ -4, width: 16
• Scan time: 3.180
• The best scores are: opt bits E(61164)
• EM_FUN:CGL301988 AJ301988.1 Colletotrichum glo (1484) [f] 1184 88 5.7e-17
• EM_FUN:AF090855 AF090855.1 Colletotrichum gloe ( 500) [f] 1205 88 7.3e-17
• EM_FUN:CGL301986 AJ301986.1 Colletotrichum glo (1484) [f] 1166 87 1.2e-16
• EM_FUN:CGL301908 AJ301908.1 Colletotrichum glo (2868) [f] 1148 87 1.3e-16
• EM_FUN:CGL301909 AJ301909.1 Colletotrichum glo (2868) [f] 1148 87 1.3e-16
• EM_FUN:CGL301907 AJ301907.1 Colletotrichum glo (2867) [f] 1148 87 1.3e-16
• EM_FUN:CGL301919 AJ301919.1 Colletotrichum glo (1171) [f] 1166 87 1.6e-16
• EM_FUN:CGL301977 AJ301977.1 Colletotrichum glo (1876) [f] 1148 86 2e-16
• EM_FUN:CFR301912 AJ301912.1 Colletotrichum fra (2870) [f] 1137 86 2.1e-16
PIC 2014, Shanghai
Case of Use
14. Our background about Bioinformatics
• Bioinformatics (Master in researching in
Informatics, UCM)
• Several Master Thesis & publications
– Alignment of sequences with R and Rhadoop*
– Analysis & Visualization with R Language and
Chernoff faces
– Others
14
15. Big Data
From Data Warehouse to Big Data (large Data Bases)
15
1970 relational model invented
RDBMS declared mainstream till 90s
One-size fits all, Elephant vendors- heavily
encoded even indexing by B-trees.
16. Alex ' Sandy' Pentland, director of 'Media Lab' at
Massachusetts Institute of Technology (MIT):
The big data revolution,
2013 Campus Party Europe
16
Nowadays bussiness needs a high
avalailability of data, then new
techniques must be developed:
Complex analytics, Graph Databases
Data Volume is increasing
exponentially
– 44x increase from 2009 2020
– From 0.8 zettabytes to 35zb
17. unstructured
data
17
¿Quién genera Big Data?
Progress and innovation are no longer hampered by the ability to collect data,
but the ability to manage, analyze, synthesize, visualize, and discover
knowledge from data collected in a timely manner and in a scalable way
19. From data to value
• Big Data Collection
– Monitoring
– Data cleaning and integration
– Hosted Data Platforms and the Cloud
• Big Data Storage
– Modern Data Bases
– Distributed Computing Platforms
– NoSQL, NewSQL
• Big Data Systems
– Security
– Multicore scalability
– Visualization and User Interfaces
• Big Data Analytics
– Fast algorithms
– Data compression
– Machine learning tools
– Visualization & Reporting
19
The MIT proposal stage list
to deal with Big Data
20. Big Data in use
1. High Availability is now a requirement
2. Host (not only in house) and Cloudcomputing
3. Running in parallel
1. Data Aggregation process
2. Analytics on Data
3. GraphDBMSs similarities
4. Not only SQL: Cassandra* and MongoDB**
*The Apache Cassandra database is the right choice when you need
scalability and high availability without compromising performance.
**Document oriented storage
20
MONGO
21. 21
• Main feature: scalability to many nodes
– Scan of 100 TB in 1 node @ 50 MB/sec = 23 days
– Scan in a cluster of 1000 nodes = 33 minutes
MapReduce
– Parallel programming model
– Simple concept, smart, suitable for multiple applications
– Big datasets multi-node in multiprocessors
– Sets of nodes: Clusters or Grids (distributed programming)
• By Google (2004)
– Able to process 20 PB per day
– Based on Map & Reduce, classiclal methods in functional programming
related to the classic divide & conquer
– Come from numeric analysis (big matrix products).
Big Data: Map Reduce
MapReduce
22. • Friendly for non technical users
Map Reduce
22
Big Data: Map Reduce
24. More technical information
• http://www.slideshare.net/vlopezlo
24www.hortonworks.com www.coursera.com www.Bigdatauniversity.com www.mit.edu
25. Technology Transfer Opportunities
• A great opportunity for researchers working to transfer
technology, who can increase their efforts in
developing new techniques in optimization of:
– Monitoring data (Sensors, smartphones, …)
– Storing data (Cloud Computing, Amazon S3, EC2, Google
BigQuery, Tableau …)
– Cleaning, Integrating & Processing data (Data Curation at
Scale: The Data Tamer System, M. Stonebraker et al., CIDR 2013)
– Analysing data (R, SAS… but also Google, Amazon, eBay...)
– Encryption & searching on encrypted data
– Techniques of Data Mining (Machine Learning, Data
Clustering, Predictive Models, ...) which are compatible
with big data by complex analytics
25
26. Big Data. Big Projects.
• Google
• eBay
• Amazon
• Twitter
• …
• They develop big projects with their big data,
but also many business get their data to make
analysis.
• Government data. Public data.
26
29. Academia & Industry Working Together
OMUS
Industry
know-how
and
expertise
Data
Collection Big
Data
and
Analytics
Patents,
Intellectual
Property and
other output
Doctoral
Thesis: joint
guidance
University
Theoretical
Models &
Research
30. Open Data
“Open data is data that can be freely used, reused and redistributed by anyone –
subject only, at most, to the requirement to attribute and sharealike.”
OpenDefinition.org -
“Open data is data that can be freely used,
reused and redistributed by anyone – subject
only, at most, to the requirement to attribute
and share alike.” OpenDefinition.org
Availability and Access: the data must be
available as a whole and at no more than a
reasonable reproduction cost, preferably by
downloading over the internet. The data
must also be available in a convenient and
modifiable form.
Reuse and Redistribution: the data must be
provided under terms that permit reuse and
redistribution including the intermixing with
other datasets. The data must be machine-
readable.
Universal Participation: everyone must be
able to use, reuse and redistribute – there
should be no discrimination against fields of
endeavour or against persons or groups. For
example, ‘non-commercial’ restrictions that
would prevent ‘commercial’ use, or
restrictions of use for certain purposes (e.g.
only in education), are not allowed.
30
33. Open Data for Smartcity
• What a citizen can expect when living in a
city?
• Internet of the things
– Libraries
– Public transportation, trafic monitoring
– Pets, devices, cars, even people
• Intelligent agents
– Interacting without our control
– Credit cards control (BBVA case of use)
33
34. C-KAN
• The Comprehensive Knowledge Archive
Network (CKAN) is a web-based open source
data management system for the storage and
distribution of data, such as spreadsheets
and the contents of databases. It is inspired
by the package management capabilities
common to open source operating systems
like Linux.
34
• Its code base is maintained by the Open Knowledge
Foundation.
• The system is used both as a public platform on Datahub and
in various government data catalogues (UK's data.gov.uk, the
Dutch National Data Register, the United States government's
Data.gov and the Australian government's "Gov 2.0“)
36. Smartcity concept
• Large amount of people. Big cities.
– Search 7 thousand differences
• Smartcity business.
• The role of technology in the city: efficiency & security
• Normalization of the concept of Smartcity (May, 2014)
– Better quality of life. Security
– Sustainability
– Innovation opportunities
– Multidiscipline: social researchers, engineers, architects, …
• Relationships are in change. Based on mobile
technologies (smartphones, tablets, internet of the
things,…)
• Transverse developing projects: sensors and monitoring
devices, connectivity, platform, services in the cloud. 36
37. Smartcity concept
• Large amount of non structured information
• Machine learning, big data technologies, internet
of the things, intelligent systems are needed.
• Technology development as a service in all areas:
1. Structure:
– Environment, infrastructure (water, energy, material,
mobility, nature), built domain
2. Society:
– pubic space, functions, people
3. Data:
– information flows, performance
37
38. Mariam Saucedo
Pilar Torralbo
Daniel Sanz
Recycla.me
Ana Alfaro
Sergio Ballesteros
Lidia Sesma
Héctor Martos
Álvaro Bustillo
Arturo Callejo
Belén Abellanas
Jaime Ramos
Ignacio P. de Ziriza
Victor Torres
Alberto Segovia
Miguel Bueno
Mar Octavio de
Toledo
Antonio Sanmartín
Carlos Fernández
MAPA DE RECURSOS
RECYCLA.TE
38
39. • Parks and gardens
• Parkings for
• Cars
• Motorbikes
• Bikes
• Recycing Points
• Fixed
• Mobile
• Cloths
• Stations
• Bioetanol
• Gas
• Oil
• Electric
• Routes for bikes
• Vías ciclistas
• Calles seguras
• Residential Priority Areas
Madrid – Smart City
39
47. Conclusions
47
Big Data, Open Data and Smartcity
• A great opportunity for researchers working to transfer
technology, who can increase their efforts in developing
new techniques in optimization of:
– Monitoring data
– Storing data
– Cleaning, Integrating & Processing data
– Analysing data
– Encryption & searching on encrypted data
– Techniques of Data Mining
• A great future work in relation to development new smart
cities in environment, security and infrastructures.
48. Big and Open Data
Challenges for Smartcity
Victoria López
Grupo G-TeC
www.tecnologiaUCM.es
Universidad Complutense de Madrid
Notas do Editor
GRASIA: Agentes inteligentes e ingeniería del software
Esta plantilla se puede usar como archivo de inicio para proporcionar actualizaciones de los hitos del proyecto.
Secciones
Para agregar secciones, haga clic con el botón secundario del mouse en una diapositiva. Las secciones pueden ayudarle a organizar las diapositivas o a facilitar la colaboración entre varios autores.
Notas
Use la sección Notas para las notas de entrega o para proporcionar detalles adicionales al público. Vea las notas en la vista Presentación durante la presentación.
Tenga en cuenta el tamaño de la fuente (es importante para la accesibilidad, visibilidad, grabación en vídeo y producción en línea)
Colores coordinados
Preste especial atención a los gráficos, diagramas y cuadros de texto.
Tenga en cuenta que los asistentes imprimirán en blanco y negro o escala de grises. Ejecute una prueba de impresión para asegurarse de que los colores son los correctos cuando se imprime en blanco y negro puros y escala de grises.
Gráficos y tablas
En breve: si es posible, use colores y estilos uniformes y que no distraigan.
Etiquete todos los gráficos y tablas.
¿Cuáles son las dependencias que afectan a la escala de tiempo, costo y resultado de este proyecto?
Este Esta presentación, que se recomienda ver en modo de presentación, muestra las nuevas funciones de PowerPoint. Estas diapositivas están diseñadas para ofrecerle excelentes ideas para las presentaciones que creará en PowerPoint 2010.
Para obtener más plantillas de muestra, haga clic en la pestaña Archivo y después, en la ficha Nuevo, haga clic en Plantillas de muestra.