Marcadores e Genômica
Engenheiro Agrônomo
Mestrando em Agronomia - Genética e Melhoramento de Plantas
Thiago Martins Pinhe...
Marcadores moleculares
Homozigotos e heterozigotos não são
diferenciados
Indivíduos
homozigotos e
heterozigotos
são diferenciados
Marcadores moleculares
Importância
• Melhoramento
– Marcadores moleculares ligados a diferentes
características de importância econômica tem
sido...
Importância
• Estudos de caracterização de populações
• Avaliação de germoplasma e populações de
melhoramento:
– Variabili...
Importância
• Estrutura de populações
– Fluxo de genes
– Sistema de cruzamento
– O tamanho efetivo
• Evolução
• Construção...
Tipos de marcadores
• Marcadores isoenzimáticos
• Marcadores RFLP
• Marcadores baseados em PCR
–Marcadores RAPD
–Marcadore...
Marcadores isoenzimáticos
• Termo introduzido por Market & Moller (1959)
• Designa formas moleculares múltiplas de
enzimas...
Marcadores isoenzimáticos
• Aplicações:
–Caracterização da variabilidade genética de
populações naturais e espécies cultiv...
Marcadores isoenzimáticos
• Vantagens
–Herança mendeliana simples
–Co-dominância
–Técnica barata
–Operacionalmente acessív...
Marcadores isoenzimáticos
• Desvantagens
–Cobertura reduzida do genoma (nº de locos
detectáveis)
–Baixo nível de polimorfi...
Marcadores RFLP
• Polimorfismo no comprimento de fragmentos
de restrição (Restriction Fragment Length
Polymorphism)
• Enzi...
Marcadores RFLP
• Detecção
–Extração e purificação do DNA
–Tratamento com enzimas de restrição
–Separação por eletroforese...
Marcadores RFLP
• Vantagens
–Co-dominância
–Não afetados por pleiotropia, epistasia ou
variações ambientais
–DNA extraído ...
Marcadores RFLP
• Desvantagens
–Desenvolvimento de marcadores RFLP é
caro e trabalhoso
–Não permite automatização
–Inexist...
O marcador RFLP usa a técnica do
SOUTHERN BLOTTING
Marcadores SNPs
Vantagens
• Alta densidade no genoma
• Estáveis do ponto de vista
evolucionário
• Genotipagem dos SNPs não...
Marcadores RAPD
• DNA polimorfico amplificado ao acaso
(Random amplified polymorphic DNA)
• Primer curto (10 nucleotídeos)...
Marcadores RAPD
• Vantagens
–Técnica simples, fácil e rápida de se obter
resultados
–Custo relativamente reduzido
–Aplicáv...
Marcadores RAPD
• Desvantagens
–Baixo conteúdo de informação genética em cada
loco (dominância)
–Baixa reprodutibilidade d...
Marcadores microssatélites - SSR
• Sequência Simples Repetida (Simple Sequence
Repeat)
• 1 a 6 nucleotídeos repetidos em t...
Marcadores microssatélites - SSR
• Os produtos amplificados são observados em gel de
poliacrilamida desnaturante ou não-de...
Marcadores microssatélites - SSR
• Uso
–Mapeamento genômico
–Mapeamento comparativo
–Estudos de ligação
–Identificação de ...
Marcadores microssatélites - SSR
Vantagens
• Uso fácil e eficiente
Desvantagens
• Necessidade de serem
isolados e desenvol...
Exemplo de Microssatélites
Marcadores AFLP
• Polimorfismo no comprimento de fragmentos
amplificados (Amplified Fragment Lenght
Polymorphism)
• Amplif...
Marcadores AFLP
• Utiliza duas enzimas de restrição, uma de
corte raro e outra de corte frequente
• Os produtos da amplifi...
Marcadores AFLP
• Uso:
–Mapas de ligação
–Clonagem de genes
–Acessar diferenças genéticas entre indivíduos,
populações e e...
• Uso
– Diagnóstico de doenças
– Análise de pedigree
– Análise de diversidade genética
– Análise de marcadores ligados a c...
Marcadores AFLP
• Vantagens
–Capacidade de analisar várias regiões
diferentes do genoma
–Capacidade de analisar grande núm...
Marcadores AFLP
• Desvantagens
–Nível de polimorfismo detectado é menor
quando comparado com outros
marcadores
–Dificuldad...
Marcadores SNPs
• Polimorfismo em único nucleotídeo (Single
Nucleotide Polymorphism)
• Detectam polimorfismos de uma única...
Marcadores SNPs
• Natureza bi-alélica e abundantes no genoma
• Estimativas
–Genoma humano: 1 SNP : 1000 bases ou menos
–Mi...
Marcadores SNPs
• Indispensável validação experimental dos dados
obtidos para se conhecer o potencial informativo
de cada ...
Marcadores SNPs
–Ensaios com extensão de primers
–PCR em tempo real
–Minissequenciamento
–Sequenciamento de única base
–Di...
Marcadores SNPs
• Uso:
–Mapas de resolução 100x maior que os existentes
–Melhoramento assistido por marcadores
moleculares...
Marcadores SNPs
–Análise de genes
–Descobertas da base genética molecular de
importantes características vegetais
–Associa...
Características RFLP RAPD SSR AFLP
Ação gênica Co-dominante Dominante Co-dominante Dominante
Número de
alelos/loco
Multi-a...
Genômica
• Genoma: Conjunto completo de cromossomos de
uma espécie
• Genômica: É o estudo da estrutura e função dos
genoma...
Espécies sequenciadas e em andamento até o dia 10 de Junho de 2009
(http://www.ncbi.nlm.nih.gov/sites/genome)
Espécies sequenciadas e em andamento até o dia 24 de Novembro de
2009 (http://www.ncbi.nlm.nih.gov/sites/genome)
Espécies sequenciadas e em andamento até o dia 21 de Abril de 2010
(http://www.ncbi.nlm.nih.gov/sites/genome)
Espécies sequenciadas e em andamento até o dia 3 de Maio de 2010
Fonte: http://www.ncbi.nlm.nih.gov/sites/genome
Genômica: Exemplos de plantas sequenciadas
• O genoma da primeira planta a ser totalmente
seqüenciado foi a da Arabidopsis...
Exemplos de alguns microrganismos
fitopatogênicos sequenciados
•Xylella fastidiosa (Amarelinho dos citros),
•Xanthomonas c...
Xylella fastidiosa
Xanthomonas campestris
Magnaphorte oryzae
Exemplos de algumas espécies vegetais
sequenciadas
• Eucalipto (Eucalyptus globulus subsp. globulus)
• Cana-de-açúcar (Sac...
Genômica no Brasil
• 1998: criação de uma
rede de laboratórios para
sequenciamento: rede
ONSA
• Instituto virtual.
• Criad...
Estudos de genômica comparativa ou sintenia
• Uma análise comparativa entre
monocotiledôneas mostrou que o genoma do
cloro...
Fonte: Zimmer et al. (2003)
Bioinformática
• Análise da informação biológica utilizando a
ciência da computação.
• Envolve desenvolvimento de bancos d...
Diferentes abordagens
para o estudo da
Biotecnologia em plantas
e suas interrelações
Desafios...
• Produzir mais alimentos em menor área, com
menos água e menos insumos
• O desenvolvimento de uma agricultura...
A aplicação criteriosa e segura da biotecnologia
na agricultura, juntamente com a utilização
racional dos recursos genétic...
thiago_mpinheiro@yahoo.com.br
Marcadores e Genômica - Aula Teórica Thiago final
Marcadores e Genômica - Aula Teórica Thiago final
Marcadores e Genômica - Aula Teórica Thiago final
Marcadores e Genômica - Aula Teórica Thiago final
Marcadores e Genômica - Aula Teórica Thiago final
Marcadores e Genômica - Aula Teórica Thiago final
Marcadores e Genômica - Aula Teórica Thiago final
Marcadores e Genômica - Aula Teórica Thiago final
Marcadores e Genômica - Aula Teórica Thiago final
Marcadores e Genômica - Aula Teórica Thiago final
Marcadores e Genômica - Aula Teórica Thiago final
Marcadores e Genômica - Aula Teórica Thiago final
Marcadores e Genômica - Aula Teórica Thiago final
Marcadores e Genômica - Aula Teórica Thiago final
Próximos SlideShares
Carregando em…5
×

Marcadores e Genômica - Aula Teórica Thiago final

100 visualizações

Publicada em

0 comentários
0 gostaram
Estatísticas
Notas
  • Seja o primeiro a comentar

  • Seja a primeira pessoa a gostar disto

Sem downloads
Visualizações
Visualizações totais
100
No SlideShare
0
A partir de incorporações
0
Número de incorporações
1
Ações
Compartilhamentos
0
Downloads
12
Comentários
0
Gostaram
0
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide
  • Glycine max - soja
  • Glycine max - soja
  • Glycine max - soja
  • Glycine max - soja
  • Marcadores e Genômica - Aula Teórica Thiago final

    1. 1. Marcadores e Genômica Engenheiro Agrônomo Mestrando em Agronomia - Genética e Melhoramento de Plantas Thiago Martins Pinheiro thiago_mpinheiro@yahoo.com.br
    2. 2. Marcadores moleculares
    3. 3. Homozigotos e heterozigotos não são diferenciados
    4. 4. Indivíduos homozigotos e heterozigotos são diferenciados
    5. 5. Marcadores moleculares
    6. 6. Importância • Melhoramento – Marcadores moleculares ligados a diferentes características de importância econômica tem sido desenvolvidos, permitindo a seleção indireta de características desejáveis em gerações precoces, reduzindo tempo, fontes e energia necessários. • Estudos genéticos – São ferramentas úteis para detectar variações no genoma, o que aumenta o poder de análise genética das plantas.
    7. 7. Importância • Estudos de caracterização de populações • Avaliação de germoplasma e populações de melhoramento: – Variabilidade – Diversidade genética – Classificação – Distância genética – Filogenia; • Construção de coleções nucleares;
    8. 8. Importância • Estrutura de populações – Fluxo de genes – Sistema de cruzamento – O tamanho efetivo • Evolução • Construção de mapas genéticos; • Mapeamento de QTLs •Seleção assistida
    9. 9. Tipos de marcadores • Marcadores isoenzimáticos • Marcadores RFLP • Marcadores baseados em PCR –Marcadores RAPD –Marcadores microssatélites –Marcadores AFLP –Marcadores SNPs
    10. 10. Marcadores isoenzimáticos • Termo introduzido por Market & Moller (1959) • Designa formas moleculares múltiplas de enzimas que ocorrem em um mesmo organismo e membros da mesma espécie • Detecção, isolamento, e distinção: métodos bioquímicos = cromatografia, filtração gélica, eletroforese, etc. • Controle genético: monogenético, co- dominante = híbridos
    11. 11. Marcadores isoenzimáticos • Aplicações: –Caracterização da variabilidade genética de populações naturais e espécies cultivadas; –Estudos de evolução e dispersão de espécies e análises filogenéticas; –Identificação de ligação gênica entre isoenzimas e caracteres de herança simples e complexa –Identificação de acessos e cultivares; –Seleção indireta de caracteres de interesse agronômico; –Aumento na resolução de mapas de ligação
    12. 12. Marcadores isoenzimáticos • Vantagens –Herança mendeliana simples –Co-dominância –Técnica barata –Operacionalmente acessível –Determinação genotípica dos locos em qualquer parte da planta –Análise simultânea de vários locos isoenzimáticos –Não-detecção de efeitos deletérios, epistáticos ou pleinotrópicos
    13. 13. Marcadores isoenzimáticos • Desvantagens –Cobertura reduzida do genoma (nº de locos detectáveis) –Baixo nível de polimorfismo por loco –Especificidade de algumas isoenzimas em certas partes da planta –Expressão de certas enzimas é influenciada pelo ambiente e estádio de desenvolvimento da planta –Complexidade de alguns zimogramas
    14. 14. Marcadores RFLP • Polimorfismo no comprimento de fragmentos de restrição (Restriction Fragment Length Polymorphism) • Enzimas de restrição  “tesouras” moleculares • Criação/eliminação de sítios de restrição  substituição ou modificação de par de bases, deleções, inserções, inversões ou translocações
    15. 15. Marcadores RFLP • Detecção –Extração e purificação do DNA –Tratamento com enzimas de restrição –Separação por eletroforese em gel de agarose –Transferência para suporte sólido (membrana de náilon ou nitrocelulose) –Fixação por alta temperatura ou luz UV –Hibridização com sonda radioativa ou quimioluminescência –Autoradiografia (Raio X)
    16. 16. Marcadores RFLP • Vantagens –Co-dominância –Não afetados por pleiotropia, epistasia ou variações ambientais –DNA extraído de qualquer parte do organismo –Não depende do estádio de desenvolvimento do organismo –Resultados altamente estáveis e reproduzíveis –Ampla cobertura do genoma –Disponibilidade de diversas enzimas de restrição
    17. 17. Marcadores RFLP • Desvantagens –Desenvolvimento de marcadores RFLP é caro e trabalhoso –Não permite automatização –Inexistência de biblioteca de sondas para espécies “menos importantes”
    18. 18. O marcador RFLP usa a técnica do SOUTHERN BLOTTING
    19. 19. Marcadores SNPs Vantagens • Alta densidade no genoma • Estáveis do ponto de vista evolucionário • Genotipagem dos SNPs não se baseia na medida de comprimento dos alelos • Distinção dos alelos pode ser automatizada • Taxa de mutação relativamente baixa Desvantagens • Alto custo de desenvolvimento e genotipagem
    20. 20. Marcadores RAPD • DNA polimorfico amplificado ao acaso (Random amplified polymorphic DNA) • Primer curto (10 nucleotídeos), de sequência arbitrária • Amplificações de fragmentos de DNA ao acaso • Detecção normalmente feita em gel de agarose corado com brometo de etídio, visualizado sob luz ultravioleta
    21. 21. Marcadores RAPD • Vantagens –Técnica simples, fácil e rápida de se obter resultados –Custo relativamente reduzido –Aplicável em qualquer organismo –Não emprega radioatividade –Não necessita mão-de-obra altamente especializada –Não exige sequenciamento de nucleotídeos nem desenho de primers específicos –Necessidade mínima de DNA necessária
    22. 22. Marcadores RAPD • Desvantagens –Baixo conteúdo de informação genética em cada loco (dominância) –Baixa reprodutibilidade dos resultados (bastante sensível a pequenas modificações –Requer certa experiência com procedimentos moleculares: preparo de soluções-estoque e componentes da reação; manipulação cuidadosa de micropipetas, reagentes e enzimas; programação de termocicladores; etc
    23. 23. Marcadores microssatélites - SSR • Sequência Simples Repetida (Simple Sequence Repeat) • 1 a 6 nucleotídeos repetidos em tandem (AACT  AACTAACTAACTAACTAACT) • Repetições –Perfeitas  não são interrompidas –Imperfeitas  interrompidas por bases não repetidas –Compostas  duas ou mais repetições estão dispostas adjacentes –Simples  Apenas uma repetição
    24. 24. Marcadores microssatélites - SSR • Os produtos amplificados são observados em gel de poliacrilamida desnaturante ou não-desnaturante, ou em gel de agarose de alta resolução, corados com brometo de etídio ou nitrato de prata • Cada microssatélite constitui um loco genético altamente variável, multialélico e de grande conteúdo informativo • Natureza altamente informativa + especificidade + rapidez = eficiente ferramenta para estudos de genes eucarióticos • Microssatélites desenvolvidos para uma espécie podem ser utilizados com sucesso em outras espécies
    25. 25. Marcadores microssatélites - SSR • Uso –Mapeamento genômico –Mapeamento comparativo –Estudos de ligação –Identificação de genótipos –Proteção de variedades –Avaliação de pureza de sementes –Utilização e conservação de germoplasma –Estudos de diversidade –Análise gênica e de QTLs –Análise de pedigree –Seleção assistida por marcadores –Análise de bibliotecas para clonagem de genes
    26. 26. Marcadores microssatélites - SSR Vantagens • Uso fácil e eficiente Desvantagens • Necessidade de serem isolados e desenvolvidos especificamente para cada espécie, não sendo possível desenho de “primers universais” • Desenvolvimento  processo demorado, trabalhoso e com alto custo
    27. 27. Exemplo de Microssatélites
    28. 28. Marcadores AFLP • Polimorfismo no comprimento de fragmentos amplificados (Amplified Fragment Lenght Polymorphism) • Amplificação do DNA via PCR para detectar diferenças em um conjunto de fragmentos selecionados e digeridos com enzima de restrição • Crucial utilização de DNA genômico altamente puro  garantir completa digestão
    29. 29. Marcadores AFLP • Utiliza duas enzimas de restrição, uma de corte raro e outra de corte frequente • Os produtos da amplificação são separados em gel de poliacrilamida desnaturante (alto nível de resolução). Polimorfismo detectado por presença ou ausência de bandas • Revelação feita com radioatividade, visualização por auto-radiografia; nitrato de prata ou fluorescência
    30. 30. Marcadores AFLP • Uso: –Mapas de ligação –Clonagem de genes –Acessar diferenças genéticas entre indivíduos, populações e espécies –Estudos filogenéticos –Discriminação de variedades –Registro de variedades (testes de distinção, homogeneidade e estabilidade) –Monitoramento da herança de características agronômicas
    31. 31. • Uso – Diagnóstico de doenças – Análise de pedigree – Análise de diversidade genética – Análise de marcadores ligados a características de interesse – Análise de erosão genética causada por melhoramento – Estimativa de taxas de fecundação cruzada em populações melhoradas Marcadores AFLP
    32. 32. Marcadores AFLP • Vantagens –Capacidade de analisar várias regiões diferentes do genoma –Capacidade de analisar grande número de locos polimórficos simultaneamente –Alta reprodutibilidade e robustez –Número de marcas geradas virtualmente ilimitado –Alto valor informativo –Herança mendeliana
    33. 33. Marcadores AFLP • Desvantagens –Nível de polimorfismo detectado é menor quando comparado com outros marcadores –Dificuldade de identificar variantes alélicos em um loco específico
    34. 34. Marcadores SNPs • Polimorfismo em único nucleotídeo (Single Nucleotide Polymorphism) • Detectam polimorfismos de uma única base no genoma • Deve ocorrer em pelo menos 1% da população para ser considerada SNP • 90% do polimorfismo no genoma humano são SNPs • Sequenciamento em larga escala de espécies vegetais tem permitido evidenciar presença de SNPs (Arabidopsis thaliana, Oryza sativa, Glycine max, Cucumis melo, Zea mays, etc)
    35. 35. Marcadores SNPs • Natureza bi-alélica e abundantes no genoma • Estimativas –Genoma humano: 1 SNP : 1000 bases ou menos –Milho: 1 SNP : 70 bases • Visualização (técnicas): –Cromatografia líquida de alta pressão desnaturante (DHPLC) –Polimorfismo conformacional fita única (SSCP) –Outros métodos de clivagem química ou enzimática
    36. 36. Marcadores SNPs • Indispensável validação experimental dos dados obtidos para se conhecer o potencial informativo de cada polimorfismo • Métodos de validação e genotipagem disponíveis atualmente –Microarranjos –Cromatografia líquida de alta pressão desnaturante (DHPLC) –Espectrometria de massa
    37. 37. Marcadores SNPs –Ensaios com extensão de primers –PCR em tempo real –Minissequenciamento –Sequenciamento de única base –Digestão por enzimas de restrição (RFLP)
    38. 38. Marcadores SNPs • Uso: –Mapas de resolução 100x maior que os existentes –Melhoramento assistido por marcadores moleculares –Construção e integração de mapas genéticos e físicos –Estudos de genética de populações –Estudos de filogenias
    39. 39. Marcadores SNPs –Análise de genes –Descobertas da base genética molecular de importantes características vegetais –Associação entre doses de alelos e expressão fenotípica (poliploides) –Identificação de variedades
    40. 40. Características RFLP RAPD SSR AFLP Ação gênica Co-dominante Dominante Co-dominante Dominante Número de alelos/loco Multi-alélico 2 Multi-alélico 2 Disponibilidade de marcadores no genoma Ilimitada Ilimitada Ilimitada Ilimitada Nível de polimorfismo Alto Alto Muito alto Muito alto Necessidade de procedimentos prévios Construção bibliotecas genômicas ou cDNAs Não há Desenho de primers Não há Concentração de DNA 10 mg 25 ng 50 ng 500 ng Marcação radioativa Sim / não Não Não Sim / não Reprodutibilidade Alta Média Alta Média Investimento Alto Médio Alto Médio
    41. 41. Genômica • Genoma: Conjunto completo de cromossomos de uma espécie • Genômica: É o estudo da estrutura e função dos genomas inteiros • Genômica estrutural e funcional • Genômica estrutural: Estuda a estrutura dos genomas inteiros através do sequenciamento do DNA dos mesmos • Genômica funcional: Estuda a função das sequências obtidas na genômica estrutural
    42. 42. Espécies sequenciadas e em andamento até o dia 10 de Junho de 2009 (http://www.ncbi.nlm.nih.gov/sites/genome)
    43. 43. Espécies sequenciadas e em andamento até o dia 24 de Novembro de 2009 (http://www.ncbi.nlm.nih.gov/sites/genome)
    44. 44. Espécies sequenciadas e em andamento até o dia 21 de Abril de 2010 (http://www.ncbi.nlm.nih.gov/sites/genome)
    45. 45. Espécies sequenciadas e em andamento até o dia 3 de Maio de 2010 Fonte: http://www.ncbi.nlm.nih.gov/sites/genome
    46. 46. Genômica: Exemplos de plantas sequenciadas • O genoma da primeira planta a ser totalmente seqüenciado foi a da Arabidopsis thaliana em 2001. • Em seguida foi sequenciado o do Arroz (Oryza sativa) em 2002. • O Brasil vem se destacando nessa área e participou do sequenciamento de: A cana-de- açúcar (Saccharum officinarum), o eucalipto (Eucalyptus ssp), o Café (Coffea ssp), o milho e a banana (único ainda em andamento).
    47. 47. Exemplos de alguns microrganismos fitopatogênicos sequenciados •Xylella fastidiosa (Amarelinho dos citros), •Xanthomonas campestris (cancro cítrico), •Magnaphorte oryzae (brusone)
    48. 48. Xylella fastidiosa
    49. 49. Xanthomonas campestris Magnaphorte oryzae
    50. 50. Exemplos de algumas espécies vegetais sequenciadas • Eucalipto (Eucalyptus globulus subsp. globulus) • Cana-de-açúcar (Saccharum officinarum) • Café (Coffea arabica) • Milho (Zea mays)
    51. 51. Genômica no Brasil • 1998: criação de uma rede de laboratórios para sequenciamento: rede ONSA • Instituto virtual. • Criado e financiado pela FAPESP
    52. 52. Estudos de genômica comparativa ou sintenia • Uma análise comparativa entre monocotiledôneas mostrou que o genoma do cloroplasto da cana de açúcar é muito semelhante ao do milho mas não ao do arroz e do trigo.
    53. 53. Fonte: Zimmer et al. (2003)
    54. 54. Bioinformática • Análise da informação biológica utilizando a ciência da computação. • Envolve desenvolvimento de bancos de dados on-line e de algoritmos (programas) para comparação de dados genéticos. • Genômica Estrutural e Funcional • Proteômica e Metabolômica • Construção de mapas genéticos e mapeamento de QTLs
    55. 55. Diferentes abordagens para o estudo da Biotecnologia em plantas e suas interrelações
    56. 56. Desafios... • Produzir mais alimentos em menor área, com menos água e menos insumos • O desenvolvimento de uma agricultura sustentável é a chave para a diminuição da pobreza, segurança alimentar e proteção ambiental Considerações finais
    57. 57. A aplicação criteriosa e segura da biotecnologia na agricultura, juntamente com a utilização racional dos recursos genéticos, podem aumentar a lucratividade dos agricultores, produzir melhores alimentos, e menor dependência de agroquímicos.
    58. 58. thiago_mpinheiro@yahoo.com.br

    ×