9 112 Samaradivakara S DNA barcoding of cinnamon

Saroopa Samaradivakara Genetech Research Institute

Cinnamon ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Genetech Research Institute

What is Barcoding? ,[object Object],[object Object],[object Object],Genetech Research Institute

Why TrnH and MatK barcoding loci? ,[object Object],[object Object],[object Object],http://www.pnas.org/content/106/31/12794 (12.10.2009) Genetech Research Institute

[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Why is it important to barcode Cinnamon? http://en.wikipedia.org/wiki/Cinnamon Genetech Research Institute

[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Genetech Research Institute

OBJECTIVES ,[object Object],[object Object],[object Object],Genetech Research Institute

Method Objective 1 ,[object Object],[object Object],[object Object],[object Object],[object Object],Genetech Research Institute

Genetech Research Institute Cinnamomum aromaticum “ Wal Kurundu” “ Dawul kurundu” Cinnamomum camphora

Results Genetech Research Institute

[object Object],A - λ 100 bp ladder B - PCR amplified products of primers trnH-psbA C - Negative control for trnH-psbA primer products (all except template DNA) D - PCR amplified products of primer matK with 0.5 µ l of 14.07 M DMSO E - PCR amplified products of primer matK with 1.0 µ l of 14.07 M DMSO F - PCR amplified products of primer matK with 1.5 µ l of 14.07 M DMSO G - Negative control for matK (including 1.0 µ l of 14.07 M DMSO) 500bp Genetech Research Institute matK trnH A B C D E F G H

GTAGTTATGAACCCTGTAGACATCCCCACGGGGTGGTGAAGGGAGGGCCCGATTGGTAGAAAAAAAC CCACAACCCCGGGGTTATCCTGCGCTTGGAAGAAAAAGTAGGAAAAGGAATAAATATAGTAATAGTTT TATTATTCGTCGCCGTAAATAGAAATATTCAAAATCAAATAAATATTGTTTTTTAAGGTGAAATAAAGATATTTACACCCCGTCCAAGTTTATAGGGATAGCAAATGCTGGGCGAACGACGGGAATTGAACCCGCGCATGTGGATTCACTCCACTGCCTTGATCCACTTGGCTACATCCGCCCCTCCTCTCTCAAAAGGATTCCATTTTCACCATTCATTATTTTTTCTTTATTACTTCACTCTCCTTCCTGCTGAAATACAGATATTGTACATAAAACAAAATGTTGTACGTAAAATAAAAAAAAAAAGAAAAATGCTTTGATTTTTTCCTAAAATCAAATTCTTTTGAAGAATAAGAGTATATAAATTGCAGGTTGGTACAGAAGAAACTACGATATCGATCACGAAATAACCAGCGGTTTTCATAAGTTGAATAAAAGAAATGAAAATGAAAAACGATTATGTGAAAACACTCTGAACCAAATAGATCAATCCAAACTTCTTAATAGAACAGAAGTTTGGTATTGATC Trn H Cinnamomum camphora Genetech Research Institute

[object Object],[object Object],Genetech Research Institute

“ Dawul kurundu” D1 - λ 100 bp ladder D2 - PCR amplified products of primers matK for “ Dawul kurudu ” D3 - Negative control for matK D4 - PCR amplified products of primer trnH-psbA for “ Dawul kurudu ” D5 - PCR amplified products of primer trnH-psbA for C. camphora D6 - Negative control for matK primer products Genetech Research Institute 500bp D1 D2 D3 D4 D5 D6 trnH

“ Dawul kurundu” TrnH ,[object Object],Genetech Research Institute

Cinnamomum aromaticum and “Wal kurundu” TrnH A- 100bp Ladder B- Amplification with TrnH C- negative control D- Amplification with MatK having 1ul of DMSO E- negative control F- Amplification with MatK having 1.5ul of DMSO G- negative control Genetech Research Institute 500bp

[object Object],[object Object],[object Object],[object Object],Genetech Research Institute

[object Object],[object Object],[object Object],Objective 2 Extraction of DNA from processed Cinnamon bark for obtaining DNA Barcodes Genetech Research Institute

Discussion ,[object Object],[object Object],[object Object],[object Object],Genetech Research Institute

[object Object],[object Object],[object Object],Genetech Research Institute

[object Object],[object Object],Cinnamon bark DNA extraction and amplification Genetech Research Institute

[object Object],[object Object],[object Object],[object Object],[object Object],Genetech Research Institute

References ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Genetech Research Institute

Aknowledgement ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Genetech Research Institute

[object Object],[object Object],[object Object],[object Object],[object Object],PCR protocol Genetech Research Institute

A- 100bp Ladder B- Amplification of Cinnamomum aromaticum with TrnH C- Amplification of “Wal kurundu” with TrnH Genetech Research Institute 500bp

9 112 Samaradivakara S DNA barcoding of cinnamon

Recommended

Recommended

More Related Content

What's hot

What's hot (8)

Viewers also liked

Viewers also liked (20)

Similar to 9 112 Samaradivakara S DNA barcoding of cinnamon

Similar to 9 112 Samaradivakara S DNA barcoding of cinnamon (20)

Recently uploaded

Recently uploaded (20)

9 112 Samaradivakara S DNA barcoding of cinnamon