Acidos Nucleicos

36.452 visualizações

Publicada em

Fundamentos da estrutura dos ácidos nucleicos.

Publicada em: Educação
2 comentários
9 gostaram
Estatísticas
Notas
Sem downloads
Visualizações
Visualizações totais
36.452
No SlideShare
0
A partir de incorporações
0
Número de incorporações
375
Ações
Compartilhamentos
0
Downloads
1.158
Comentários
2
Gostaram
9
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Acidos Nucleicos

  1. 1. ATTTATTTCGGGCCGTATTTAAGGCGCGTTTTAATT TTAATATATGCGATAGGCATAGCAGTTAATATATA ATTTATTTCGGGCCGTATTTAAGGCGCGTTTTAATT CCCGGGGGAAATTTTAACGCGCGGGCAGTGTGCAT TTAATATATGCGATAGGCATAGCAGTTAATATATA ATTTATTTCDNACCGTATTTAAGGRNAGTTTTAATT CCCGGGGGAAATTTTAACGCGCGGGCAGTGTGCAT TTAATATATGCGATAGGCATAGCAGTTAATATATA ATTTATTTCGGGCCGTATTTAAGGCGCGTTTTAATT DNA RNA ÁCIDOS NUCLEICOS
  2. 2. <ul><li>O que é um </li></ul><ul><li>ácido nucléico ? </li></ul>
  3. 3. Do ponto de vista da química .... São uma das maiores e mais complexas biomoléculas São polímeros formados por unidades chamadas nucleotídeos
  4. 4. Molécula de DNA
  5. 5. Molécula de DNA vista ao microscópio eletrônico de grande resolução
  6. 6. Representações gráficas podem variar ...
  7. 7. Representando sem mostrar o volume dos átomos
  8. 11. <ul><li>Existem dois tipos de ácidos nucléicos: </li></ul><ul><li>DNA </li></ul><ul><li>RNA </li></ul>Ácido desoxirribonucléico Ácido ribonucléico
  9. 12. A forma em escada torcida é o resultado da união de duas cadeias quase gêmeas. O ponto de união entre as cadeias estão no meios dos “degraus”.
  10. 13. Os degraus da escada não são exatamente iguais embora pertençam ao mesmo grupo químico. São as bases nitrogenadas. Existem 4 tipos.
  11. 14. Adenina Timina Citosina Guanina Bases Nitrogenadas
  12. 15. São polímeros muito grandes podendo atingir até 15cm, dependendo da espécie. Polímero  molécula de DNA Monômero  Nucleotídeo
  13. 16. Estrutura dos nucleotídeos que compõe uma das cadeias do DNA
  14. 17. Cada nucleotídeo tem: Grupo fosfato P Açúcar S Base nitrogenada B
  15. 18. Nucleotídeo
  16. 19. Monômeros do DNA
  17. 20. Duas fileiras de monômeros se ligam através de ligações de hidrogênio A cadeia é dupla e torcida Vista em planta
  18. 21. Representando DNA ...
  19. 22. Recapitulando.....
  20. 23. Bases nitrogenadas
  21. 24. Carboidratos (monossacarídeos)que constituem os nucleotídeos
  22. 25. Resumindo....
  23. 28. RNA Ácido ribonucleico
  24. 29. RNA  ácido ribonucleico Ocorre no núcleo e no citoplasma È uma molécula formada no processo de “ leitura” da informação contida no DNA São conhecidos 3 tipos de RNA
  25. 30. Esqueleto do RNA
  26. 31. Bases nitrogenadas do RNA
  27. 32. RNA é uma molécula que possui uma cadeia simples de nucleotídeos
  28. 33. RNA pode ter algumas formas diferentes, dependendo de sua função na célula
  29. 34. Outro forma de representação + simplificada...
  30. 36. 2. Qual é a origem dos ácidos nucléicos ? São sintetizados a partir de nutrientes acumulados nas células: acúcares, aminoácidos, fosfatos.
  31. 37. Uma molécula de DNA é sempre sintetizada a partir de uma outra pré-existente. A nova molécula é uma cópia da pré-existente. A pré-existente se constitui no molde para a síntese da nova molécula
  32. 38. Duplicação semi-conservativa do DNA
  33. 39. Síntese de DNA (autoduplicação do DNA)
  34. 40. Síntese de DNA (duplicação)
  35. 41. 3. Onde ocorrem os ácidos nucléicos ?
  36. 42. Ocorre sempre em estruturas chamadas cromossomos
  37. 44. Núcleo de células.... Várias células de raíz de cebola em diferentes fases da divisão celular
  38. 45. DNA ocorre... Vírus
  39. 46. Nas mitocôndrias...
  40. 47. RNA ocorre... a) nucléolo b) ribossomos
  41. 48. 4. Qual é o significado biológico do DNA ?
  42. 49. O DNA é uma molécula que contém informações codificadas. Estas informações são replicadas a cada duplicação celular Cada molécula de DNA é copiada fielmente na replicação.
  43. 50. Durante muito tempo não se sabia ao certo se as informações das características dos organismos estavam nas proteínas ou nos ácidos nucléicos. Os experimentos de Hershey e Chase resolveram esta questão
  44. 52. O DNA é um código químico, formado por uma seqüência de bases nitrogenadas. ATCCTAATACGGTCA TAGGCTTATGCCAGT
  45. 53. ATCCTAATACGGTCA TAGGCT TAT GCCAGT Cada trinca de bases codifica uma molécula de um determinado aminoácido isoleucina
  46. 55. Leitura e processamento da informação genética
  47. 56. DNA é molécula. Gene é uma função do DNA. É o DNA em ação .
  48. 57. Mapa genético dos genes do cloroplasto do tabaco
  49. 58. Gene da beta-globina Seqüência de codifica uma das subunidades que forma a estrutura quaternária de uma molécula de hemoglobina

×