Glioblastoma (GBM) is the most common and aggressive type of brain tumor. It originates from glial cells in the brain and is cancerous. GBM occurs more often in adults and can cause symptoms like headaches, seizures, and neurological problems depending on its location. Diagnosis involves MRI, CT scans, and biopsy. Treatment is challenging and typically involves maximal surgical resection followed by radiation and chemotherapy with temozolomide, though recurrence is common due to the invasive nature of GBM. Ongoing research focuses on improved therapies targeting genetic alterations in GBM and overcoming the blood-brain barrier to treat this deadly cancer.

1. Glioblastoma

4. Its an abnormal Growth tissue in the brain
 non – cancerous
Primary : originate in the brain itself
 cancerous ( Malignant )
Metastatic or Secondary : come from another part of the
body ( e.g. lung or breast etc )

5. • A normal brain cell ( Glial Cell : which are supportive
cells that surround) becomes malignant and is called a
Glioma .
• Gliomas , are subdivided in :
Glioblastoma ( GBM )
Ependymoma
Astrocytoma
Oligodendroglioma

6.  myelin producing cells of the CNS
 one oligodendroglial cell can myelinate more
than one axon

7.  These cells line ventricles of brain and spinal canal
 They have Cilia on their luminal surface
 Pathological changes to the ependyma include infections and
tumor formation

9.  "star-shaped" glial cells that are the majority cell type in the CNS
 involved in metabolic exchange between neurons and blood
 support and improving conduction in neurons
 uptake and/or breakdown of some neurotransmitters and formation of
the blood-brain-barrier

10. ¾ of all gliomas

More than

For astrocytomas, there are 4 general grades :
1 - 2 : Low Grade & Pilocytic Astrocytoma
more commonly in children and its Benign
They also have a more favorable prognosis
The most common symptoms are Headache, Nausea etc

11. 3 : Anaplastic Astrocytoma ( AA )
AA is a malignant type and more commonly in Adult
Symptoms may include , speech problems , headaches , visual loss etc
(MRI) is the preferred imaging technique for diagnosis

12. 4 : Glioblastoma Multiform(GBM)
Harvey Cushing and Percival Bailey coined the term in 1926
Scherer first classified GBMs into primary and secondary tumors
in 1940
Ted Kennedy
 at age 77
 Seizure
 Parietal lobe
 He survived 14 months after he was diagnosed

13. Primary
Secondary
De novo

18. In The USA GBM is 2.5 times higher in European Americans Than in African
Americans and 60% higher in Men than in Women .
2nd most common cause of death due to intracranial disease after stroke .
10% of children brain tumors
More prevalent in developed countries and caucasian
 Incidence is approximately 5-8 new cases per 100,000 people per year
Annual Incidence 24,000
Annual deaths 14,000

20. 10 Year
5 Year

21. Geographic Variation I

22. Geographic Variation II

23. Chromosomal Abnormality
Loss
13q and 10q
gain
1p, 2q, 3q and 17q
Loss = left
Gain = right

24. Results of LOH 10q assay for individual cases with the four microsatellite markers. (B - Blood
DNA, T - Tumor DNA, LOH - Loss of heterozygosity, NLOH - No loss of heterozygosity, NI Noninformative)

25. Pathway Alterations in GBM

26. receive signals from growth factors
activation of the RAS and PI3K pathways
cell proliferation, survival, and
migration

27. 1. mutation or deletion of p53
2.overexpression of p53 inhibitors
(MDM2 and MDM4)
3. indirectly, deletion of CDKN2A, an
MDM2 inhibitor

28. 1 . direct mutation of gene Rb1
2 . overexpression of cyclin-dependent kinase 4 (CDK4)
3 . deletion of CDKN2A

29. Micro RNA
Alteration in GMB
Targets
miR-21
up
RECKd-TIMP3d
APAF1-Caspases
PTEN
HNRPK-TAp63,
LRRFIP1- PDCD4
miR-124
down
CDK6
miR-137
down
CDK6
miR-128
down
WEE1- p70S6K1
Msi1- E2F3a- Bmi-1,
EGFR- PDGFRAd
miR-7
down
EGFR

30.  the most extensively investigated miRNA is Mir 21
 Transfection with antisense-miR-21 has been shown to significantly
increase GBM cell line sensitivity to both radio- and chemotherapy .

32.  It is capable of suppressing tumor growth
 miR-128 is a good candidate for repressing GBM growth and
invasion

33. Interaction of SOX6 in GBM
 TF expressed in CNS
 More prevalent in GBM than in normal brain tissue
 Come from a family of proteins called the SOX gene family
 SOX6 is an glioblastoma-associated antigen; it helps distinguish
a glioblastoma from normal cells
 This suggests that SOX6 is more involved in the genesis of GBM
than in their proliferation
* SOX gene family encodes proteins that bind to a groove in the DNA and
cause local bends and changes

35. 4
1. Pathogenic
Chr 10 , 7
2 . Non-Pathogenic
3 . Other
(http:// www.ncbi.nlm.nih.gov )
Chr 3
Chr 17
rs121909218 [Homo sapiens]
AGCAATTCACTGTAAAGCTGGAAAGG[A/G]ACGAACTGGTGTAATGATATGTGCA
rs3856806 [Homo sapiens]
GACCTCAGACAGATTGTCACGGAACA[C/T]GTGCAGCTACTGCAGGTGATCAAGA

36.  TMZ alkylates/methylate the O6-position in guanine
replication
 MGMT(O6-methylguanine-DNA methyltransferase) remove alkyl
groups
Expressing in GBM cell line
 Methylated MGMT = making TMZ more efficient
cell

37. memory loss
speech difficulty
changes in sight , sound or smell
headaches

38. MRI
(CT) scan
Positron emission tomography (PET)
Needle biopsy
•* Needle inserted through a burr
hole and tissue extracted for tissue
diagnosis

39. It is very difficult to treat GBM due to several complicating factors :
 Resistant to conventional therapies
 Limited capacity of brain to repair itself
 Blood-brain barrier
 Surgery :
the first stage of treatment Complete removal is impossible - a reduction of 98%
GBM tumor cells (it is located near the parts of the brain that control important functions
such as language )
near-complete removal of a tumor
5-aminolevulinic acid (5-ALA)
Fluorescent dye
red/pink fluorescence under a blue light from an operating microscope
distinguish glioblastoma from normal tissue

41.  Radiation therapy
In addition to surgery
Prolong survival ( 7 – 12 Months )
1.Conventional fractionated external beam radiation
“standard”
• 5 days a week for 5 or 6 weeks
• aimed at the tumor site and the area around the
tumor
2 . Photodynamic therapy ( PDT ) uses a sensitizing drug and laser light to
destroy tumor cells
Monoclonal antibodies or Nanocarrier

42. 1. Temozolomide (TMZ) :
oral alkylating agent
With radiation overall survival (12.1 - 14.6 months)
induces DNA methylation of guanine O6 position
O6-MG incorrectly pairs with thymine and triggers the mismatch repair
(MMR) system leading to double strand break
arrest of cell cycle and induction of apoptosis
2. Carmustine and cis -platinum (cisplatin) primary chemotherapeutic for
malignant gliomas.
3. Nitrosoureas

44. Novel Biologic therapies
 Dendritic cell vaccination

45. Using a attenuated virus (such as the Adeno virus) genetically engineered
to produce a human antigen .

46. Conclusions
 GMB is the highest glioma (grade4) tumor
 Specific symptoms depend on the size and location of GBM
 GBM occurs at any age but is most common after 50 years
 Genetic alteration can be seen in GBM
 Diagnosis (MRI,CT scan and…)
 Treatment( surgery, radiotherapy and chemotherapy )