1. Introduction to molecular markers
for breeding of fruit tree species
Andrea Patocchi (Agroscope)

2. Content
• What is a molecular marker
• Three examples of molecular markers
• Examples of applications and limits of
molecular markers
• Summary

3. What is a molecular markers?
Molecular markers
associated to a gene are
naturally occurring DNA
sequences that are close to
the specific genes
In general, the DNA
sequence of the gene of
interest it is not known,
while the sequence of the
marker associated to it is
known
gene 1
marker for
gene 1
cell
chromosome
DNA
Adapted from:
http://biointeraction.blogspot.ch/2010/09/dnaand-chromosome.html

4. How to find the association …
… between a trait and molecular markers?
Necessary are:
- A good coverage of the genome
with molecular markers
- A precise phenotyping of the
progeny
Phenotyping
e.g. inoculation with
scab of the progeny
plants
An insufficient coverage with
markers leads to weak association
scoring and coding
ABBAABBBABBBAAAAABB
Mistakes during phenotyping lead
to wrong associations (map
positions)
Note: identical score as marker G
R-gene
Adapted from Collard et al. 2005

5. Use in breeding
Most of the times molecular markers are used to make predictions:
Is a specific marker (allele) present, with a determinate probability,
is also the gene (allele) of interest present
The closer (the more associated) are the molecular marker and the
gene of interest, the higher will be the probability of a correct
prediction
The “perfect” marker is a marker developed within the sequence of
the gene
The distance of a marker and the gene of interest (or between two
markers) is expressed in centimorgan (cM):
1cM = 1 wrong prediction in 100 cases
The most used application of markers in breeding is the
Marker Assisted Selection (MAS)
«perfect»
marker for
gene 1
Gene 1
Marker 2 for
gene 1
Marker 1 for
gene 1

6. Three types of molecular markers
Using methods of the molecular biology (polymerase
chain reaction; PCR) a DNA fragment is multiplied, and
made visible
The most used molecular markers in marker assisted
selection are:
• Sequence Characterized Amplified Regions (SCARs)
• Simple Sequence Repeats (SSRs, or microsatellites)
• Single Nucleotide Polymorphism (SNP)

7. Characteristics of the three types of markers
SCAR: have in general only two alleles; alleles show presence/absence
polymorphism or differs greatly by size
Present/absence of a specific band,
only one allele is amplified,
dominant marker
Co-dominant SCAR marker: it
allows to distinguish between
homo- and heterozygous plants
SSR: have often > 10 alleles; the alleles show differences of the length of the
repeated sequence (e.g. CTT);
allele 1
allele 2
allele 3
…ATGCTTATCGG[CTTCTTCTTCTTCTTCTTCTT]GATCAAATTACCCGTAGATA…
…ATGCTTATCGG[CTTCTTCTTCTTCTTCTTCTTCTT]GATCACATTACCCGTAGATA…
…ATGCTTATCGG[CTTCTTCTTCTTCTTCTTCTTCTTCTTCTT]GATCACATTACCCGTAGATA…
CTT X7
CTT X8
CTT X10
SNP: have in general only two alleles; their sequence differ only by a single
nucleotide (null allele also possible)
allele 1
allele 2
…ATGCTTATCGGGATCAAATTACCCGTAGATA…
…ATGCTTATCGGGATCACATTACCCGTAGATA…

8. Examples of applications (1)
• Allele 159bp of SSR marker
CH-Vf1 is associated to Vf
• From Florina to F2 26829-2-2
the pedigree is ok BUT
• F2 26829-2-2 looks not to be a
product of a sib cross (allele
137bp (*) is not present in
Mf821 or Rome Beauty)
10 bases ladder
Rome Beauty
M. floribunda 821 (Vf)
F2 26829-2-2 (Vf)
Golden Delicious
PRI 14-126 (Vf)
Starking
PRI 612-1 (Vf)
Johnatan
Florina (Vf)
10 bases ladder
Verification of pedigrees
Vf allele
outbreeder
Adapted from Vinatzer et al. 2004

9. Examples of applications (2)
Identification of homozygous genotypes…
…in a cross between two
genotypes heterozygous for Vf
• Allele 159bp of SSR marker
CH-Vf1 is associated to Vf
• Three progeny plants are
outbreeders (probably from
the same father)
outbreeders
Allele 159bp
Associated to Vf scab resistance
Adapted from Vinatzer et al. 2004

10. Examples of applications (3)
Identification of pyramids of two R-genes (Rvi2&6)
…in a cross between two
genotypes heterozygous for Rvi2
and Rvi6, respectively
Rvi2
rvi2
rvi2/Rvi6
rvi6
rvi2/rvi6
Rvi2/rvi6
M
Increasing size of the bands
Without molecular markers this
work can only be done if virulent
isolates to both R-genes are
available, BUT is extremely time
consuming!
Rvi6 Rvi2/Rvi6
P1
P2
S1
S2
S3
S4
S5
Rvi2 marker
Rvi6 marker

11. Examples of applications (4)
Early selection for traits that cannot be assessed at
seedling stage (fruit traits)
e.g. peach:
• peach/necatrine phenotype;
• yellow/white flesh
• Flat/round fruit shape

12. Examples of applications (5) / Limits
Screening of collections
… with a marker having an allele highly specific for
the allele of the gene of interest (e.g. Rvi6/Vf
resistance, SSR CH-Vf1)
Caution!
The presence of the R-gene (allele) in the
genotypes amplifying the allele associated to the
R-gene (allele) NEEDS to be validated:
• Are the plants really resistant and showing the
typical symptoms?
• Is it plausible from the pedigree that the
genotype is carrying the R-gene?
Adapted from Vinatzer et al. 2004

13. Summary
• Molecular markers are very useful tools for breeding
• To get efficient and good molecular markers for MAS, we need
good phenotyping and good and many markers (2 outputs from
FruitBreedomics)
• Molecular markers allows to make predictions that cannot be
done without them (e.g. pyramids or R-genes,…)
• They allows to save money by an early identification of progeny
plants having a desired combination of traits

14. Thank you for your attention