SlideShare uma empresa Scribd logo
1 de 15
Baixar para ler offline
Big Data in Life Sciences
1st Symposium on Big Data and
Public Health
FGV 24/10/2013
Big Data
“Big Data in the life sciences sector is now a strategic and operational
issue for almost all stakeholders. Capturing, storing, data flow and
analysis of information-rich processes affect all aspects of the
pharmaceutical and medical device industries but particularly the
discovery, research & development stages”.
“A strategic shift towards big data and data-driven approaches must
be implemented from senior managers and thoroughly rolled-out
across the organization”.
Capturing
Storing
Data flow
Analysis
Summarize
Represent
Life Sciences – drug development
- Drug discovery process - lead / target identification and research follow-up
- Translation to clinical stages
- Why & How of implementing big data approaches
- Genomic & personalized medicines - combination of biomarkers research and retrospective
data analysis, and analysis of current clinical outcomes
- Systems Biology & detailed modeling & simulation processes
- Better design NMEs, re-engineer and re-initiate previously failed drug programs
- Design, collect & manage clinical stage data
- Selecting EDC technologies, outsourcing Data Management responsibilities
- Retain control over data quality
- Real-world big data (Real World Evidence - RWE) for drug safety & surveillance for regulators
in post-marketing, feeding back vital insights into mechanisms of action and real-life
prescription and use
- Understand product health outcome benefits for regulators, payers & other stakeholders:
Product’s effectiveness, associated health outcomes and cost effectiveness endpoints
- Manage and integrate data generated at all stages of the value chain, from discovery to realworld use after regulatory approval
In all fields, the amount of data to be collected and managed has massively increased.
Life Sciences – R&D
 Genomics – metagenomics: generation of genetic code data
 Clinical genomics: pharmacogenomics, disease marker genes etc
 Expression studies: transcriptomics and micro-array

 Protein structure, function and protein-protein interaction (also RNA/DNA/protein;
saccharide, lipids etc)
 System Biology – metabolic systems and their regulation, synthetic biology

 Mass spectrometry analysis (biomarkers; complex mixtures)
 Metabolomics; biodiversity extracts and fractionation
 Phylogeny, Networks of life
 Clinical Research, epidemiology, models
 Public health
 Scientific Literature and Patents – data and text mining
C. Probst, Fiocruz Paraná
C. Probst, Fiocruz Paraná
aaacgcggaccgcacggtctgataggcaagttccggtatcgctattaccagggcagtcat
cgcttgctgtaaccggttatgggttctgtcgtcaccaacgctatgggcacttcagttggc
atgtttttctgcggataggtagcgatacgctgttgcgtcaccaaattccaaccacagaag
ccggtataccgcgatcggttggtgtgcctgtgtttatgccttaccgtaaggaaagcaaca
ggattaaggcgatagtgcgggtgacttcaatgatcgacgcaccgagccgaccggtcccag
tgtgtatcaacacgtcgctagcgcgggtgtagtcgcgtattgctgctgtagcggtcattg
tcttactgtccatcgacagcgaggatttgagacgcacgatatgtgacaaaatttgagaca
tcgcgaccaagtagtggggaagtgatgtttcatcggaggtctcgtgtcattgtggcttgt
ggtcgttgtctttcgatcttgacactccggcaaaaatatggtttatgccgaaatggccgt
aatcacgggtattgggtgtcggcgccgggaagaattggttgtgttggccggccagtatgt
tgatcgcgtcgggcttgtgggttttgctgatgatctgcagcgttttgccgacgaacggcc
ggagagtagggttcggatcgaactgtgaccggtagatttcctcggatcagaacgaatcgg
aacgattgctttgcgcagatatacaggccatagcgaaggtccggtactatcggtgtgtcg
gtattcgcacgccacgaaaacgttgacctccactcaggcctaaccgttaccgtcaaaagt
ttggatcgccactatacggtgaatatgcgagctacttggctgttgatcaaagtgcttgct
aagcgttggccggcaacaggtagaagcgtggtggcgctcaccagtgatcacacaatgaat
aacctaccctacggggctacgaaagccgtaatagatcgaattgtgcttgctgctgcctac
gcactagggtgttcaagccgtgctcgccaacgtgatcaattcgggcccgggcgacattgg
ctggatgacaccccgacctccagacgcgattaacctctatgcaaccgcccggatgtttag
gaaaccctaaaagacttccaacttggtgtgcgctttctgctgtccgactactggcagtag
gttaacggccagctcatccactgcaacggcagtttctccaaagaccaactccatgtctgc
gttagtgcaacatgcagaaaactatggtatcattcctgttatctcgcattcagctgggct
aagtctggccgcccacggttgtaagcgccgtggcggattgtgcattccggcgctgtcgtc
cgatcgtggcgaagtagtaggcaagcgggaaagaaaagctagaagcaaaaaacagccacg
gacaccgcatcccgctccggtagctataaacactggcagcagaatcatattcgtaacgaa
gtagtcacagttgcccgaaacagcggttgggttggtgatctgcatccgcaggaaatgcgg
atagctttccggtccctggaccaggttaccctgcccggccccatcgtgcacacagcgtgt
attgaaatatcatcttagtatggtagccgctataccaactatgaagtgcccgcactttgt
ggagaaaaagacggctttccagtaagtttggtataaaactgtggttttgacgtggttatc
tagccgatagcggataggttacggactgtgtggacaagaagcgagatcatgggtagtgtg
gccatgccatggtggactagggatcacatgcattcccggttacaattccggttgtgcaga
gctggagggcctgtgcagttaaccgtgttgactcagcagttcatcttccagtgcgaggaa
ctcgtcggacctagttcgtggagtaaacgccgggctcagccggagcttgggcccgtccaa
ggtaatcaagatcgacctgaatagcaggtatgagtcaagttttagctagcggtggaaatc
gagggttccccaaatgcgtaaccactgaaagaataggattaacgcttcggctttcatacc
agcatcgctttcagcgcaattaccttcgacgtgccagaaggaaagtgatagcggtgcaac
gtgattaccacgtgatccagctggacaaagccttagtcctaagattcctgcagaattgaa
gtaattttcagaaactccgcaactggtggcaccgtgaggtgagaaaacggccgtcatcca
atcgccattgttacctatacagattacaggtcggtatgtttaccgtgcggtctgccgccg
aacttcaatagatcggttttgacatgggggaagatccgctgaatctccttgcagtacaga
gtgatcgatgcgcaatcctaatgttgtctaggctaaccagctatcgtcttaagcaatgtt
ctcgtccagtcagacatgttgaagaacgtgtacagatattcgttgtagccaccggtccgc
caagccttaaggcacgtggacaagaagatggtgttgatccagtccggttcgtgattaagc
actactggtaagtaacaactccggcactatctacgaatccgtagaatagtttcataatta
gaaatctgctagcgcttgagcatgtttcggaaagtccaaaactacagtttcaagcacgat
aatcaattcgacaagatatccggttctgtcgctgataacgttgctttgcaacatgatcgg
ttcgaacaacacgcgccacctctctagcagaagatcactttctgcgatctcccaatttgc
ctgcttcgcattaagtacggaagccatctgttcggcatagtcggtgatgtaggcggactg
tttggtgttgaagatagccacaattttctcgacctggagtaaatggttcagtgaattcag
tatcctgccatcgcaccagaggatcgactcgataaaatcagcaagtcacgtcagcgcccg
ttcctgtgtatctgatccaggaacaccatgttgaggtagcgcagcaaatcgtggtacgaa
aatgactgcggcactatacaggtggtcctcatctgagtgatgtatagatgcgcactgtcc
atatgacgttggcgtttctgggtagctaatatacccttggcacccgcaggcatgtcgtag
aaattagataccatgtcgctccgaaagtattgcagtagatgtatacaaacgtggaagaac
taagatgtcaatgatttcaagttgacagggcgagcgtagtttatgttgaaaacctttgct
gtgtagtcagaaactgctgccgtcgagtagctgatcgggctgacgttggggtccgcaggc
tatgctcgtgacgttgagcttgcctttggtttcggtcaggcggtgcttgaccgagttggt

All you wanted to know,

but were afraid to ask...
Adams, M.D., Kelley, J.M., Gocayne, J.D., Dubnick, M., Polymeropoulos, M.H., Xiao, H., Merril, C.R., Wu, A., Olde, B.,
Moreno, R., Kerlavage, A.R., McCombie, W.R., and Venter, J.C. Complementary DNA sequencing: "expressed sequence tags"
and the human genome project. Science 252, 1651-1656 (1991).
T. Otto
12
General Proline and Arginine Metabolism
In silico biochemistry

Metabolism and solute transport of A. fulgidus
Klenk et al, Nature n390, 364 (1997)
human
Drosophila
mouse

C. elegans

Vibrio cholera

Plasmodium

Rickettsia

Archaeoglobus

Campilobacter

Aquifex

M. leprae
Neisseria

Chlamidia
M. tuberculosis

Arabidopsis

Xylella
rat

Buchenerasp

Ureaplasma
Helicobacter

E. coli

Thermoplasma
Borrelia

Yersinia

Ralstonia

S. cerevisiae

Thermotoga
Bacillus
Pseudomonas

S. pombe

Salmonella

Mais conteúdo relacionado

Mais procurados (20)

Basics of Data Analysis in Bioinformatics
Basics of Data Analysis in BioinformaticsBasics of Data Analysis in Bioinformatics
Basics of Data Analysis in Bioinformatics
 
LECTURE NOTES ON BIOINFORMATICS
LECTURE NOTES ON BIOINFORMATICSLECTURE NOTES ON BIOINFORMATICS
LECTURE NOTES ON BIOINFORMATICS
 
Biological Database
Biological DatabaseBiological Database
Biological Database
 
Bioinformatics-General_Intro
Bioinformatics-General_IntroBioinformatics-General_Intro
Bioinformatics-General_Intro
 
Bioinformatics ppt
Bioinformatics pptBioinformatics ppt
Bioinformatics ppt
 
Model Organism Linked Data
Model Organism Linked DataModel Organism Linked Data
Model Organism Linked Data
 
Bioinformatics on internet
Bioinformatics on internetBioinformatics on internet
Bioinformatics on internet
 
Bioinformatic, and tools by kk sahu
Bioinformatic, and tools by kk sahuBioinformatic, and tools by kk sahu
Bioinformatic, and tools by kk sahu
 
Features of biological databases
Features of biological databasesFeatures of biological databases
Features of biological databases
 
iOmics
iOmicsiOmics
iOmics
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
Databases in Bioinformatics
Databases in BioinformaticsDatabases in Bioinformatics
Databases in Bioinformatics
 
Bioinformatics Software
Bioinformatics SoftwareBioinformatics Software
Bioinformatics Software
 
Mrr iti phar_mu
Mrr iti phar_muMrr iti phar_mu
Mrr iti phar_mu
 
Genome Database Systems
Genome Database Systems Genome Database Systems
Genome Database Systems
 
Application of blockchain technology in healthcare and biomedicine
Application of blockchain technology in healthcare and biomedicineApplication of blockchain technology in healthcare and biomedicine
Application of blockchain technology in healthcare and biomedicine
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
Gcc talk baltimore july 2014
Gcc talk baltimore july 2014Gcc talk baltimore july 2014
Gcc talk baltimore july 2014
 
NetBioSIG2012 chrisevelo
NetBioSIG2012 chriseveloNetBioSIG2012 chrisevelo
NetBioSIG2012 chrisevelo
 
Kegg databse
Kegg databseKegg databse
Kegg databse
 

Destaque (12)

Les02 Restricting And Sorting Data
Les02 Restricting And Sorting DataLes02 Restricting And Sorting Data
Les02 Restricting And Sorting Data
 
01 basic orders
01   basic orders01   basic orders
01 basic orders
 
A Comprehensive Guide to Data Management for Businesses by Infinit Datum
A Comprehensive Guide to Data Management for Businesses by Infinit DatumA Comprehensive Guide to Data Management for Businesses by Infinit Datum
A Comprehensive Guide to Data Management for Businesses by Infinit Datum
 
Khoury ashg2014
Khoury ashg2014Khoury ashg2014
Khoury ashg2014
 
Data Visualization in Public Health DC TUG March 17 2015
Data Visualization in Public Health DC TUG March 17 2015Data Visualization in Public Health DC TUG March 17 2015
Data Visualization in Public Health DC TUG March 17 2015
 
Les02 (restricting and sorting data)
Les02 (restricting and sorting data)Les02 (restricting and sorting data)
Les02 (restricting and sorting data)
 
Excel Useful Tips
Excel Useful TipsExcel Useful Tips
Excel Useful Tips
 
My ppt on gis
My ppt on gisMy ppt on gis
My ppt on gis
 
Geographic information system
Geographic information systemGeographic information system
Geographic information system
 
Teaching Excel
Teaching ExcelTeaching Excel
Teaching Excel
 
Excel ppt
Excel pptExcel ppt
Excel ppt
 
MS EXCEL PPT PRESENTATION
MS EXCEL PPT PRESENTATIONMS EXCEL PPT PRESENTATION
MS EXCEL PPT PRESENTATION
 

Semelhante a Wim de Grave: Big Data in life sciences

BigData in Life Sciences, Genomics and Systems Biology
BigData in Life Sciences, Genomics and Systems BiologyBigData in Life Sciences, Genomics and Systems Biology
BigData in Life Sciences, Genomics and Systems BiologyHarsha Rajasimha
 
Data Mining and Big Data Analytics in Pharma
Data Mining and Big Data Analytics in Pharma Data Mining and Big Data Analytics in Pharma
Data Mining and Big Data Analytics in Pharma Ankur Khanna
 
5. BIOINFORMATICS.pptx B.Pharm sem 2 Computer Applications in Pharmacy
5. BIOINFORMATICS.pptx B.Pharm sem 2 Computer Applications in Pharmacy5. BIOINFORMATICS.pptx B.Pharm sem 2 Computer Applications in Pharmacy
5. BIOINFORMATICS.pptx B.Pharm sem 2 Computer Applications in PharmacyVedika Narvekar
 
InSyBio at Open Coffee Athens CI
InSyBio at Open Coffee Athens CIInSyBio at Open Coffee Athens CI
InSyBio at Open Coffee Athens CIOpen Coffee Greece
 
P'informatcs.ppt by akshay patel
P'informatcs.ppt by akshay patelP'informatcs.ppt by akshay patel
P'informatcs.ppt by akshay patelakshay patel
 
Health Informatics- Module 5-Chapter 3.pptx
Health Informatics- Module 5-Chapter 3.pptxHealth Informatics- Module 5-Chapter 3.pptx
Health Informatics- Module 5-Chapter 3.pptxArti Parab Academics
 
Role of bioinformatics in drug designing
Role of bioinformatics in drug designingRole of bioinformatics in drug designing
Role of bioinformatics in drug designingW Roseybala Devi
 
Discovery on Target 2014 - The Industry's Preeminent Event on Novel Drug Targets
Discovery on Target 2014 - The Industry's Preeminent Event on Novel Drug TargetsDiscovery on Target 2014 - The Industry's Preeminent Event on Novel Drug Targets
Discovery on Target 2014 - The Industry's Preeminent Event on Novel Drug TargetsJaime Hodges
 
Microbial Genomics and Surveillance: An Overview Snapshot for a Layman’s Unde...
Microbial Genomics and Surveillance: An Overview Snapshot for a Layman’s Unde...Microbial Genomics and Surveillance: An Overview Snapshot for a Layman’s Unde...
Microbial Genomics and Surveillance: An Overview Snapshot for a Layman’s Unde...Iwalokun Abiodun
 
Big Data Analytics in the Health Domain
Big Data Analytics in the Health DomainBig Data Analytics in the Health Domain
Big Data Analytics in the Health DomainBigData_Europe
 
INBIOMEDvision Workshop at MIE 2011. Victoria López
INBIOMEDvision Workshop at MIE 2011. Victoria LópezINBIOMEDvision Workshop at MIE 2011. Victoria López
INBIOMEDvision Workshop at MIE 2011. Victoria LópezINBIOMEDvision
 
Biostatistics and Statistical Bioinformatics
Biostatistics and Statistical BioinformaticsBiostatistics and Statistical Bioinformatics
Biostatistics and Statistical BioinformaticsSetia Pramana
 
Research trends in different pharmaceutical areas.docx
Research trends in different pharmaceutical areas.docxResearch trends in different pharmaceutical areas.docx
Research trends in different pharmaceutical areas.docxImtiajChowdhuryEham
 
Quantifying the content of biomedical semantic resources as a core for drug d...
Quantifying the content of biomedical semantic resources as a core for drug d...Quantifying the content of biomedical semantic resources as a core for drug d...
Quantifying the content of biomedical semantic resources as a core for drug d...Syed Muhammad Ali Hasnain
 
Big Data and Analytic Strategy for Clinical Research
Big Data and Analytic Strategy for Clinical ResearchBig Data and Analytic Strategy for Clinical Research
Big Data and Analytic Strategy for Clinical ResearchBBCR Consulting
 

Semelhante a Wim de Grave: Big Data in life sciences (20)

Precision and Participatory Medicine - MEDINFO 2015 Panel on big data
Precision and Participatory Medicine - MEDINFO 2015 Panel on big dataPrecision and Participatory Medicine - MEDINFO 2015 Panel on big data
Precision and Participatory Medicine - MEDINFO 2015 Panel on big data
 
Basic of bioinformatics
Basic of bioinformaticsBasic of bioinformatics
Basic of bioinformatics
 
Ca ncer proteomics
Ca ncer proteomicsCa ncer proteomics
Ca ncer proteomics
 
BigData in Life Sciences, Genomics and Systems Biology
BigData in Life Sciences, Genomics and Systems BiologyBigData in Life Sciences, Genomics and Systems Biology
BigData in Life Sciences, Genomics and Systems Biology
 
Data Mining and Big Data Analytics in Pharma
Data Mining and Big Data Analytics in Pharma Data Mining and Big Data Analytics in Pharma
Data Mining and Big Data Analytics in Pharma
 
5. BIOINFORMATICS.pptx B.Pharm sem 2 Computer Applications in Pharmacy
5. BIOINFORMATICS.pptx B.Pharm sem 2 Computer Applications in Pharmacy5. BIOINFORMATICS.pptx B.Pharm sem 2 Computer Applications in Pharmacy
5. BIOINFORMATICS.pptx B.Pharm sem 2 Computer Applications in Pharmacy
 
InSyBio at Open Coffee Athens CI
InSyBio at Open Coffee Athens CIInSyBio at Open Coffee Athens CI
InSyBio at Open Coffee Athens CI
 
P'informatcs.ppt by akshay patel
P'informatcs.ppt by akshay patelP'informatcs.ppt by akshay patel
P'informatcs.ppt by akshay patel
 
Health Informatics- Module 5-Chapter 3.pptx
Health Informatics- Module 5-Chapter 3.pptxHealth Informatics- Module 5-Chapter 3.pptx
Health Informatics- Module 5-Chapter 3.pptx
 
Role of bioinformatics in drug designing
Role of bioinformatics in drug designingRole of bioinformatics in drug designing
Role of bioinformatics in drug designing
 
origin, history.pptx
origin, history.pptxorigin, history.pptx
origin, history.pptx
 
Discovery on Target 2014 - The Industry's Preeminent Event on Novel Drug Targets
Discovery on Target 2014 - The Industry's Preeminent Event on Novel Drug TargetsDiscovery on Target 2014 - The Industry's Preeminent Event on Novel Drug Targets
Discovery on Target 2014 - The Industry's Preeminent Event on Novel Drug Targets
 
Microbial Genomics and Surveillance: An Overview Snapshot for a Layman’s Unde...
Microbial Genomics and Surveillance: An Overview Snapshot for a Layman’s Unde...Microbial Genomics and Surveillance: An Overview Snapshot for a Layman’s Unde...
Microbial Genomics and Surveillance: An Overview Snapshot for a Layman’s Unde...
 
Big Data Analytics in the Health Domain
Big Data Analytics in the Health DomainBig Data Analytics in the Health Domain
Big Data Analytics in the Health Domain
 
INBIOMEDvision Workshop at MIE 2011. Victoria López
INBIOMEDvision Workshop at MIE 2011. Victoria LópezINBIOMEDvision Workshop at MIE 2011. Victoria López
INBIOMEDvision Workshop at MIE 2011. Victoria López
 
Biostatistics and Statistical Bioinformatics
Biostatistics and Statistical BioinformaticsBiostatistics and Statistical Bioinformatics
Biostatistics and Statistical Bioinformatics
 
Research trends in different pharmaceutical areas.docx
Research trends in different pharmaceutical areas.docxResearch trends in different pharmaceutical areas.docx
Research trends in different pharmaceutical areas.docx
 
Quantifying the content of biomedical semantic resources as a core for drug d...
Quantifying the content of biomedical semantic resources as a core for drug d...Quantifying the content of biomedical semantic resources as a core for drug d...
Quantifying the content of biomedical semantic resources as a core for drug d...
 
Big Data and Analytic Strategy for Clinical Research
Big Data and Analytic Strategy for Clinical ResearchBig Data and Analytic Strategy for Clinical Research
Big Data and Analytic Strategy for Clinical Research
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 

Mais de Flávio Codeço Coelho

Sistema de Alerta de Dengue Utilizando Dados Hbridos de Redes Sociais, Moni...
Sistema de Alerta de Dengue Utilizando Dados Hbridos de Redes Sociais, Moni...Sistema de Alerta de Dengue Utilizando Dados Hbridos de Redes Sociais, Moni...
Sistema de Alerta de Dengue Utilizando Dados Hbridos de Redes Sociais, Moni...Flávio Codeço Coelho
 
Alerta dengue: Sistema de alertas de surtos usando dados híbridos
Alerta dengue: Sistema de alertas de surtos usando dados híbridosAlerta dengue: Sistema de alertas de surtos usando dados híbridos
Alerta dengue: Sistema de alertas de surtos usando dados híbridosFlávio Codeço Coelho
 
Mauricio barreto:Big data: how can it help to expand epidemiological investig...
Mauricio barreto:Big data: how can it help to expand epidemiological investig...Mauricio barreto:Big data: how can it help to expand epidemiological investig...
Mauricio barreto:Big data: how can it help to expand epidemiological investig...Flávio Codeço Coelho
 
Fabricio Silva: Cloud Computing Technologies for Genomic Big Data Analysis
Fabricio  Silva: Cloud Computing Technologies for Genomic Big Data AnalysisFabricio  Silva: Cloud Computing Technologies for Genomic Big Data Analysis
Fabricio Silva: Cloud Computing Technologies for Genomic Big Data AnalysisFlávio Codeço Coelho
 
Gabriela gomes: Mathematical Modeling and Data Needs
Gabriela gomes: Mathematical Modeling and Data NeedsGabriela gomes: Mathematical Modeling and Data Needs
Gabriela gomes: Mathematical Modeling and Data NeedsFlávio Codeço Coelho
 
Carl koppeschaar: Disease Radar: Measuring and Forecasting the Spread of Infe...
Carl koppeschaar: Disease Radar: Measuring and Forecasting the Spread of Infe...Carl koppeschaar: Disease Radar: Measuring and Forecasting the Spread of Infe...
Carl koppeschaar: Disease Radar: Measuring and Forecasting the Spread of Infe...Flávio Codeço Coelho
 
Gabriel laporta: Biodiversity can help prevent malaria outbreaks in tropical ...
Gabriel laporta: Biodiversity can help prevent malaria outbreaks in tropical ...Gabriel laporta: Biodiversity can help prevent malaria outbreaks in tropical ...
Gabriel laporta: Biodiversity can help prevent malaria outbreaks in tropical ...Flávio Codeço Coelho
 
Sander van noort: Influenzanet: self-reporting of influenza-like illness in c...
Sander van noort: Influenzanet: self-reporting of influenza-like illness in c...Sander van noort: Influenzanet: self-reporting of influenza-like illness in c...
Sander van noort: Influenzanet: self-reporting of influenza-like illness in c...Flávio Codeço Coelho
 
Mark smolinski big data and public health
Mark smolinski   big data and public healthMark smolinski   big data and public health
Mark smolinski big data and public healthFlávio Codeço Coelho
 
Haroldo lopes datasus - Informações em Saúde: história, uso e desafios
Haroldo lopes   datasus - Informações em Saúde: história, uso e desafiosHaroldo lopes   datasus - Informações em Saúde: história, uso e desafios
Haroldo lopes datasus - Informações em Saúde: história, uso e desafiosFlávio Codeço Coelho
 
Marco Andreazzi: IBGE research and data collection on health related issues.
Marco Andreazzi: IBGE research and data collection on health related issues.Marco Andreazzi: IBGE research and data collection on health related issues.
Marco Andreazzi: IBGE research and data collection on health related issues.Flávio Codeço Coelho
 
Access to Information, privacy, and health research in Brazil
Access to Information, privacy, and health research in BrazilAccess to Information, privacy, and health research in Brazil
Access to Information, privacy, and health research in BrazilFlávio Codeço Coelho
 

Mais de Flávio Codeço Coelho (20)

Big dengue
Big dengueBig dengue
Big dengue
 
Alerta_Dengue simplified english
Alerta_Dengue simplified englishAlerta_Dengue simplified english
Alerta_Dengue simplified english
 
dengueARS0
dengueARS0dengueARS0
dengueARS0
 
Alerta dengue expo epi out2014
Alerta dengue expo epi out2014Alerta dengue expo epi out2014
Alerta dengue expo epi out2014
 
Alerta dengue abrasco 2014
Alerta dengue   abrasco 2014Alerta dengue   abrasco 2014
Alerta dengue abrasco 2014
 
Sistema de Alerta de Dengue Utilizando Dados Hbridos de Redes Sociais, Moni...
Sistema de Alerta de Dengue Utilizando Dados Hbridos de Redes Sociais, Moni...Sistema de Alerta de Dengue Utilizando Dados Hbridos de Redes Sociais, Moni...
Sistema de Alerta de Dengue Utilizando Dados Hbridos de Redes Sociais, Moni...
 
Alerta dengue: Sistema de alertas de surtos usando dados híbridos
Alerta dengue: Sistema de alertas de surtos usando dados híbridosAlerta dengue: Sistema de alertas de surtos usando dados híbridos
Alerta dengue: Sistema de alertas de surtos usando dados híbridos
 
Mauricio barreto:Big data: how can it help to expand epidemiological investig...
Mauricio barreto:Big data: how can it help to expand epidemiological investig...Mauricio barreto:Big data: how can it help to expand epidemiological investig...
Mauricio barreto:Big data: how can it help to expand epidemiological investig...
 
Fabricio Silva: Cloud Computing Technologies for Genomic Big Data Analysis
Fabricio  Silva: Cloud Computing Technologies for Genomic Big Data AnalysisFabricio  Silva: Cloud Computing Technologies for Genomic Big Data Analysis
Fabricio Silva: Cloud Computing Technologies for Genomic Big Data Analysis
 
Gabriela gomes: Mathematical Modeling and Data Needs
Gabriela gomes: Mathematical Modeling and Data NeedsGabriela gomes: Mathematical Modeling and Data Needs
Gabriela gomes: Mathematical Modeling and Data Needs
 
Carl koppeschaar: Disease Radar: Measuring and Forecasting the Spread of Infe...
Carl koppeschaar: Disease Radar: Measuring and Forecasting the Spread of Infe...Carl koppeschaar: Disease Radar: Measuring and Forecasting the Spread of Infe...
Carl koppeschaar: Disease Radar: Measuring and Forecasting the Spread of Infe...
 
Gabriel laporta: Biodiversity can help prevent malaria outbreaks in tropical ...
Gabriel laporta: Biodiversity can help prevent malaria outbreaks in tropical ...Gabriel laporta: Biodiversity can help prevent malaria outbreaks in tropical ...
Gabriel laporta: Biodiversity can help prevent malaria outbreaks in tropical ...
 
Sander van noort: Influenzanet: self-reporting of influenza-like illness in c...
Sander van noort: Influenzanet: self-reporting of influenza-like illness in c...Sander van noort: Influenzanet: self-reporting of influenza-like illness in c...
Sander van noort: Influenzanet: self-reporting of influenza-like illness in c...
 
Mark smolinski big data and public health
Mark smolinski   big data and public healthMark smolinski   big data and public health
Mark smolinski big data and public health
 
Haroldo lopes datasus - Informações em Saúde: história, uso e desafios
Haroldo lopes   datasus - Informações em Saúde: história, uso e desafiosHaroldo lopes   datasus - Informações em Saúde: história, uso e desafios
Haroldo lopes datasus - Informações em Saúde: história, uso e desafios
 
Marco Andreazzi: IBGE research and data collection on health related issues.
Marco Andreazzi: IBGE research and data collection on health related issues.Marco Andreazzi: IBGE research and data collection on health related issues.
Marco Andreazzi: IBGE research and data collection on health related issues.
 
Access to Information, privacy, and health research in Brazil
Access to Information, privacy, and health research in BrazilAccess to Information, privacy, and health research in Brazil
Access to Information, privacy, and health research in Brazil
 
Mining legal texts with Python
Mining legal texts with PythonMining legal texts with Python
Mining legal texts with Python
 
Causal Bayesian Networks
Causal Bayesian NetworksCausal Bayesian Networks
Causal Bayesian Networks
 
In trodução ao Epigrass
In trodução ao EpigrassIn trodução ao Epigrass
In trodução ao Epigrass
 

Último

A Framework for Development in the AI Age
A Framework for Development in the AI AgeA Framework for Development in the AI Age
A Framework for Development in the AI AgeCprime
 
The State of Passkeys with FIDO Alliance.pptx
The State of Passkeys with FIDO Alliance.pptxThe State of Passkeys with FIDO Alliance.pptx
The State of Passkeys with FIDO Alliance.pptxLoriGlavin3
 
From Family Reminiscence to Scholarly Archive .
From Family Reminiscence to Scholarly Archive .From Family Reminiscence to Scholarly Archive .
From Family Reminiscence to Scholarly Archive .Alan Dix
 
A Deep Dive on Passkeys: FIDO Paris Seminar.pptx
A Deep Dive on Passkeys: FIDO Paris Seminar.pptxA Deep Dive on Passkeys: FIDO Paris Seminar.pptx
A Deep Dive on Passkeys: FIDO Paris Seminar.pptxLoriGlavin3
 
What is DBT - The Ultimate Data Build Tool.pdf
What is DBT - The Ultimate Data Build Tool.pdfWhat is DBT - The Ultimate Data Build Tool.pdf
What is DBT - The Ultimate Data Build Tool.pdfMounikaPolabathina
 
Why device, WIFI, and ISP insights are crucial to supporting remote Microsoft...
Why device, WIFI, and ISP insights are crucial to supporting remote Microsoft...Why device, WIFI, and ISP insights are crucial to supporting remote Microsoft...
Why device, WIFI, and ISP insights are crucial to supporting remote Microsoft...panagenda
 
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024BookNet Canada
 
Take control of your SAP testing with UiPath Test Suite
Take control of your SAP testing with UiPath Test SuiteTake control of your SAP testing with UiPath Test Suite
Take control of your SAP testing with UiPath Test SuiteDianaGray10
 
Assure Ecommerce and Retail Operations Uptime with ThousandEyes
Assure Ecommerce and Retail Operations Uptime with ThousandEyesAssure Ecommerce and Retail Operations Uptime with ThousandEyes
Assure Ecommerce and Retail Operations Uptime with ThousandEyesThousandEyes
 
Long journey of Ruby standard library at RubyConf AU 2024
Long journey of Ruby standard library at RubyConf AU 2024Long journey of Ruby standard library at RubyConf AU 2024
Long journey of Ruby standard library at RubyConf AU 2024Hiroshi SHIBATA
 
Moving Beyond Passwords: FIDO Paris Seminar.pdf
Moving Beyond Passwords: FIDO Paris Seminar.pdfMoving Beyond Passwords: FIDO Paris Seminar.pdf
Moving Beyond Passwords: FIDO Paris Seminar.pdfLoriGlavin3
 
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptxMerck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptxLoriGlavin3
 
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024BookNet Canada
 
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyes
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyesHow to Effectively Monitor SD-WAN and SASE Environments with ThousandEyes
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyesThousandEyes
 
So einfach geht modernes Roaming fuer Notes und Nomad.pdf
So einfach geht modernes Roaming fuer Notes und Nomad.pdfSo einfach geht modernes Roaming fuer Notes und Nomad.pdf
So einfach geht modernes Roaming fuer Notes und Nomad.pdfpanagenda
 
Scale your database traffic with Read & Write split using MySQL Router
Scale your database traffic with Read & Write split using MySQL RouterScale your database traffic with Read & Write split using MySQL Router
Scale your database traffic with Read & Write split using MySQL RouterMydbops
 
DevEX - reference for building teams, processes, and platforms
DevEX - reference for building teams, processes, and platformsDevEX - reference for building teams, processes, and platforms
DevEX - reference for building teams, processes, and platformsSergiu Bodiu
 
Emixa Mendix Meetup 11 April 2024 about Mendix Native development
Emixa Mendix Meetup 11 April 2024 about Mendix Native developmentEmixa Mendix Meetup 11 April 2024 about Mendix Native development
Emixa Mendix Meetup 11 April 2024 about Mendix Native developmentPim van der Noll
 
A Journey Into the Emotions of Software Developers
A Journey Into the Emotions of Software DevelopersA Journey Into the Emotions of Software Developers
A Journey Into the Emotions of Software DevelopersNicole Novielli
 
The Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptx
The Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptxThe Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptx
The Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptxLoriGlavin3
 

Último (20)

A Framework for Development in the AI Age
A Framework for Development in the AI AgeA Framework for Development in the AI Age
A Framework for Development in the AI Age
 
The State of Passkeys with FIDO Alliance.pptx
The State of Passkeys with FIDO Alliance.pptxThe State of Passkeys with FIDO Alliance.pptx
The State of Passkeys with FIDO Alliance.pptx
 
From Family Reminiscence to Scholarly Archive .
From Family Reminiscence to Scholarly Archive .From Family Reminiscence to Scholarly Archive .
From Family Reminiscence to Scholarly Archive .
 
A Deep Dive on Passkeys: FIDO Paris Seminar.pptx
A Deep Dive on Passkeys: FIDO Paris Seminar.pptxA Deep Dive on Passkeys: FIDO Paris Seminar.pptx
A Deep Dive on Passkeys: FIDO Paris Seminar.pptx
 
What is DBT - The Ultimate Data Build Tool.pdf
What is DBT - The Ultimate Data Build Tool.pdfWhat is DBT - The Ultimate Data Build Tool.pdf
What is DBT - The Ultimate Data Build Tool.pdf
 
Why device, WIFI, and ISP insights are crucial to supporting remote Microsoft...
Why device, WIFI, and ISP insights are crucial to supporting remote Microsoft...Why device, WIFI, and ISP insights are crucial to supporting remote Microsoft...
Why device, WIFI, and ISP insights are crucial to supporting remote Microsoft...
 
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
 
Take control of your SAP testing with UiPath Test Suite
Take control of your SAP testing with UiPath Test SuiteTake control of your SAP testing with UiPath Test Suite
Take control of your SAP testing with UiPath Test Suite
 
Assure Ecommerce and Retail Operations Uptime with ThousandEyes
Assure Ecommerce and Retail Operations Uptime with ThousandEyesAssure Ecommerce and Retail Operations Uptime with ThousandEyes
Assure Ecommerce and Retail Operations Uptime with ThousandEyes
 
Long journey of Ruby standard library at RubyConf AU 2024
Long journey of Ruby standard library at RubyConf AU 2024Long journey of Ruby standard library at RubyConf AU 2024
Long journey of Ruby standard library at RubyConf AU 2024
 
Moving Beyond Passwords: FIDO Paris Seminar.pdf
Moving Beyond Passwords: FIDO Paris Seminar.pdfMoving Beyond Passwords: FIDO Paris Seminar.pdf
Moving Beyond Passwords: FIDO Paris Seminar.pdf
 
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptxMerck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptx
 
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
 
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyes
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyesHow to Effectively Monitor SD-WAN and SASE Environments with ThousandEyes
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyes
 
So einfach geht modernes Roaming fuer Notes und Nomad.pdf
So einfach geht modernes Roaming fuer Notes und Nomad.pdfSo einfach geht modernes Roaming fuer Notes und Nomad.pdf
So einfach geht modernes Roaming fuer Notes und Nomad.pdf
 
Scale your database traffic with Read & Write split using MySQL Router
Scale your database traffic with Read & Write split using MySQL RouterScale your database traffic with Read & Write split using MySQL Router
Scale your database traffic with Read & Write split using MySQL Router
 
DevEX - reference for building teams, processes, and platforms
DevEX - reference for building teams, processes, and platformsDevEX - reference for building teams, processes, and platforms
DevEX - reference for building teams, processes, and platforms
 
Emixa Mendix Meetup 11 April 2024 about Mendix Native development
Emixa Mendix Meetup 11 April 2024 about Mendix Native developmentEmixa Mendix Meetup 11 April 2024 about Mendix Native development
Emixa Mendix Meetup 11 April 2024 about Mendix Native development
 
A Journey Into the Emotions of Software Developers
A Journey Into the Emotions of Software DevelopersA Journey Into the Emotions of Software Developers
A Journey Into the Emotions of Software Developers
 
The Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptx
The Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptxThe Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptx
The Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptx
 

Wim de Grave: Big Data in life sciences