1.1 Generalidades 81.2 O genoma, o DNA e os genes 91.3 Ácidos nucleicos 91.3.1 Estrutura química 91.3.2 Estrutura molecula...
GenéticaHumana81.1 GeneralidadesTodo ser vivo é constituído de células, nas quais estásituado o material hereditário. O nú...
9AsBasesMolecularesdaHereditariedadeNa década de 1970, pesquisadores descobriram umtipo de microrganismo até então desconh...
GenéticaHumana10O conjunto de base + açúcar denomina-se nucleo-sídeo, chamando-se nucleotídeo ao conjunto de base+ açúcar ...
11AsBasesMolecularesdaHereditariedadeAO OOOOOPTN NCH3HOOOOOPOCH2HHHHHNNNO H NNOHHHNCONH NNNHH C2O OO OPCH2HNNHNGOH C2O OPO...
GenéticaHumana121.3.2 Estrutura molecularAlém das diferenças em sua composição química, o DNAe o RNA mostram diversidade q...
13AsBasesMolecularesdaHereditariedadeLegenda:hidrogêniooxigêniofosfatoaçúcaraçúcaraçúcaraçúcaraçúcaraçúcaraçúcaraçúcarfosf...
GenéticaHumana14de hélices dextrógiras, quando investigadas em condiçõeslaboratoriais variadas. Essas formas são denominad...
15AsBasesMolecularesdaHereditariedade1.4 O código genéticoO código para a produção dos diferentes tipos de proteí-nas que ...
GenéticaHumana16g. Há códons de iniciação e de finalização ou ter-minação. O início da síntese de um polipeptídeo,em proca...
17AsBasesMolecularesdaHereditariedadeteúdo de DNA que não faz parte dos genes nem das se-quências a eles relacionadas.A qu...
GenéticaHumana18somos e em certas regiões cromossômicas, dado queas regiões centroméricas e heterocromáticas contêmpoucos ...
19AsBasesMolecularesdaHereditariedadetaneamente ao longo de todo o genoma, de um cromos-somo para outro, tanto em plantas ...
GenéticaHumana20dutoras de energia localizadas no citoplasma de pratica-mente todas as células eucarióticas. Esse DNA não ...
21AsBasesMolecularesdaHereditariedadehaplogrupos, de acordo com sua distribuição geográfica.Os principais grupos são denom...
GenéticaHumana22possui número variável de nucleotídeos. Esse númeropode variar de 100 a 10 mil, considerando-se em conjunt...
23AsBasesMolecularesdaHereditariedadena à sua extremidade 3 (poliadenilação), após a trans-crição, constituindo a chamada ...
GenéticaHumana24ProcariotosRibossomo70S50S30S30SrRNA5S 23S 16Se 34 proteínas e 21 proteínasEucariotosRibossomo80S60S40S40S...
25AsBasesMolecularesdaHereditariedadede leitura, no qual um nucleotídeo recém-adicionado éconferido para que haja certeza ...
GenéticaHumana26primer deRNADNA--helicaseDNA DNA--polimeraseDNA-ligaseolho oubolhadereplicaçãomoldedo DNAparentaldesenrola...
27AsBasesMolecularesdaHereditariedadeEm geral, a replicação inicia-se em diferentes mo-mentos da fase S da interfase do ci...
GenéticaHumana28A Figura 1.15 mostra os quatro níveis estruturaisde uma proteína. A sequência de aminoácidos que formauma ...
29AsBasesMolecularesdaHereditariedadeTranscrição direta: DNA → RNA – A transcrição éo processo pelo qual a informação gené...
GenéticaHumana30nas de pares de bases do local de início da transcrição.Já foram identificadas diversas sequências específ...
31AsBasesMolecularesdaHereditariedadedando a este último a forma de laço ou alça; (c) a extre-midade 3 do éxon 1 reage com...
GenéticaHumana32A Figura 1.20 mostra a concepção atual dos papéisda replicação, transcrição e tradução do DNA no dogmada g...
33AsBasesMolecularesdaHereditariedadeporta o aminoácido metionina (met). Esse aminoáci-do, portanto, é o início da cadeia ...
Bases moleculares da hereditariedade - Leitura complementar
Bases moleculares da hereditariedade - Leitura complementar
Bases moleculares da hereditariedade - Leitura complementar
Bases moleculares da hereditariedade - Leitura complementar
Bases moleculares da hereditariedade - Leitura complementar
Bases moleculares da hereditariedade - Leitura complementar
Bases moleculares da hereditariedade - Leitura complementar
Bases moleculares da hereditariedade - Leitura complementar
Bases moleculares da hereditariedade - Leitura complementar
Bases moleculares da hereditariedade - Leitura complementar
Bases moleculares da hereditariedade - Leitura complementar
Bases moleculares da hereditariedade - Leitura complementar
Bases moleculares da hereditariedade - Leitura complementar
Próximos SlideShares
Carregando em…5
×

Bases moleculares da hereditariedade - Leitura complementar

11.264 visualizações

Publicada em

1 comentário
2 gostaram
Estatísticas
Notas
Sem downloads
Visualizações
Visualizações totais
11.264
No SlideShare
0
A partir de incorporações
0
Número de incorporações
9
Ações
Compartilhamentos
0
Downloads
262
Comentários
1
Gostaram
2
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Bases moleculares da hereditariedade - Leitura complementar

  1. 1. 1.1 Generalidades 81.2 O genoma, o DNA e os genes 91.3 Ácidos nucleicos 91.3.1 Estrutura química 91.3.2 Estrutura molecular 121.4 O código genético 151.5 DNA: nuclear e mitocondrial 161.5.1 DNA nuclear 161.5.1.1 Tipos de sequências 171.5.2 DNA mitocondrial (mtDNA) 191.6 RNA: tipos 211.6.1 RNA heterogêneo nuclear, pré-RNAmensageiro, RNA primário ou transcritoprimário 211.6.2 RNA mensageiro 211.6.3 RNA transportador ou RNA detransferência 231.6.4 RNA ribossômico 231.6.5 Outros RNAs 231.7 Funções do DNA 231.7.1 O DNA tem função autoduplicadora 231.7.2 DNA comanda a síntese de proteínas 271.7.2.1 Síntese proteica 281.7.2.2 Tradução: mRNA → cadeiapolipeptídica 321.8 Regulação gênica 351.8.1 Regulação gênica em procariotos 351.8.2 Regulação gênica em eucariotos 361.8.2.1 Regulação do remodelamento dacromatina 381.8.2.2 Regulação da transcrição 381.8.2.3 Regulação pós-transcricional 391.8.2.4 Regulação da tradução 411.8.2.5 Regulação pós-traducional 42Capítulo 1As Bases Molecularesda HereditariedadeBorges-Osorio_01.indd 7Borges-Osorio_01.indd 7 29/01/13 13:3529/01/13 13:35
  2. 2. GenéticaHumana81.1 GeneralidadesTodo ser vivo é constituído de células, nas quais estásituado o material hereditário. O número de células deum organismo pode variar de uma (como nas bactérias)a muitos milhões (como nos humanos). Nos organismospluricelulares, essas células podem apresentar-se nosmais variados tipos.De acordo com sua organização celular, os seres vi-vos são geralmente classificados em dois grupos: proca-riotos e eucariotos, cujas características constam naTabela 1.1.Caso clínicoFrancisco, 22 anos, era um eletricista que gostava muitode sair com seus amigos para beber cerveja nos fins desemana. Sempre teve boa visão, mas há algumas sema-nas percebeu que ela se tornou embaçada, e as cores dosfios elétricos com que trabalhava pareciam mais esmaeci-das do que de costume. Como o problema não melhorou,Francisco consultou um oftalmologista, que, durante oexame, percebeu alterações na retina do jovem: tumefaçãode disco (pseudoedema da camada de fibras nervosas daretina) e aumento da tortuosidade dos vasos sanguíneosretinianos. Gradualmente, sua visão central foi piorando,e o eletricista teve de abandonar seu emprego. Sua mãe,Terezinha, era uma mulher sadia de 49 anos, com dois ir-mãos: Antônio, 54 anos, que tinha cegueira decorrente deatrofia óptica, diagnosticada desde os 28 anos, e Dora, 50anos, que até sua quarta década de vida não apresentaraproblemas visuais, mas vinha perdendo lentamente sua vi-são central. Além disso, em um recente exame minucioso,Dora descobriu que tem um ritmo cardíaco raro que talvezpudesse estar relacionado a seus problemas oculares. Ooftalmologista aconselhou Francisco a procurar uma clí-nica de genética, para obtenção de diagnóstico e prognós-tico exatos, uma vez que o jovem deseja saber também seseus filhos terão risco de ser afetados como ele. Na históriafamiliar do probando, consta que seus avós maternos jáfaleceram; o avô aos 68 anos, por doença cardíaca corona-riana, e a avó aos 77 anos, por câncer de mama. O pai e airmã de Francisco, bem como o casal de filhos de Antônio ea filha de Dora, não apresentam problemas visuais.A natureza dos problemas oculares, o avanço rápidodos sintomas nos homens afetados, o início mais tardio edoença mais moderada em Dora, que também apresentaproblemas de ritmo cardíaco, levaram o geneticista con-sultado por Francisco a sugerir que sua condição poderiaser a neuropatia óptica hereditária de Leber (LHON), queapresenta amplo espectro de sintomas e início variável.Essa doença é causada por uma mutação no DNA mito-condrial (mtDNA). Se esse tipo de herança for confirma-do, Francisco e sua namorada poderão tranquilizar-sequanto a sua prole, uma vez que o homem não transmiteseu DNA mitocondrial aos filhos.ComentárioA escolha desse caso clínico ressalta a necessidade de seconhecer a existência do genoma mitocondrial, com suasparticularidades, e o impacto no organismo exercido pe-las mutações mitocondriais que porventura ocorram. Adisfunção mitocondrial parece estar envolvida na maioriadas principais doenças conhecidas, como diabetes tipoII, aterosclerose, câncer e doenças neurodegenerativas(doenças de Alzheimer, Huntington e Parkinson) e psi-quiátricas (esquizofrenia e transtornos bipolares), alémde suscitar até uma hipótese para o envelhecimento, combase no acúmulo progressivo de mutações no mtDNA eperda associada da função mitocondrial.As doenças mitocondriais humanas mostram grandevariabilidade nos seus quadros clínicos devido à grandequantidade de mutações no DNA mitocondrial. Os ór-gãos com alta demanda energética são, em geral, os maisafetados: cérebro, coração, músculos esqueléticos, olhos,orelhas, pâncreas e rins. Além disso, a interação entre osgenes mitocondriais e os nucleares pode sofrer distúrbiosvariados. A LHON (OMIM 535000) resulta do funciona-mento inadequado das mitocôndrias, já tendo sido asso-ciadas a essa doença 18 mutações pontuais, entre as quaiscinco têm um efeito suficientemente grave para causá-la.A maioria dos casos, pelo menos em pessoas de origemeuropeia, é causada pelas mutações G11778A (substi-tuição de G por A no nucleotídeo 11778 do gene ND4),G3460A (troca de G por A no gene ND1) e T14484C (tro-ca de T por C no gene ND6), que causam problemas nocomplexo I (NADH-desidrogenase) do sistema de fosfori-lação oxidativa, a via final da respiração celular. Em geral,são testadas essas três mutações específicas, mas, se ne-nhuma estiver presente, é necessária uma pesquisa maisampla, inclusive sequenciamento parcial do mtDNA. Osindivíduos podem ser homoplásmicos (moléculas idênti-cas de mtDNA) ou heteroplásmicos (moléculas diferentesde mtDNA) para as mutações mitocondriais, por isso atestagem completa de mutações inclui a verificação dasquantidades relativas de mitocôndrias normais e mutan-tes, pois a proporção de células heteroplásmicas aumentacom a idade. O resultado mostrou que Francisco era ho-moplásmico para a mutação G3460A, confirmando assimo diagnóstico de LHON. Nesse caso, sua prole não seráafetada, uma vez que a transmissão das mitocôndrias érealizada somente por intermédio do gameta feminino.Por outro lado, toda a prole de uma mulher afetada (p.ex., Dora, tia de Francisco) poderá ser também afetada,ainda que as condições mitocondriais sejam muito variá-veis em uma mesma família.Borges-Osorio_01.indd 8Borges-Osorio_01.indd 8 29/01/13 13:3529/01/13 13:35
  3. 3. 9AsBasesMolecularesdaHereditariedadeNa década de 1970, pesquisadores descobriram umtipo de microrganismo até então desconhecido, ao qualdenominaram Archaea pelo fato de pensarem que tal-vez pudesse ser o mais antigo tipo de célula existente,combinando características dos procariotos e eucario-tos, mas exibindo também características próprias. OsArchaea, inicialmente denominados Archaebactérias,são considerados uma subdivisão dos procariotos, mascolocados em um grupo separado das demais bactériaspor conta de suas características distintivas: os compo-nentes de suas membranas e paredes celulares e as dife-renças em bases raras encontradas em seus RNAs trans-portadores e em estruturas diferentes nas subunidadesda RNA-polimerase. Devido às diferenças molecularesque esses microrganismos apresentam em relação àsdemais bactérias, alguns cientistas tendem a chamá-lospreferencialmente de Archaea, colocando-os em umsubgrupo à parte dos procariotos.1.2 O genoma, o DNA eos genesO genoma contém o conjunto completo de informaçõeshereditárias de qualquer organismo, consistindo em umalonga sequência de um ácido nucleico, denominado ácidodesoxirribonucleico, ou DNA, composto de nucleotídeosformados por bases nitrogenadas, açúcar e fosfato. Ogrande desenvolvimento dos estudos dos genomas de vá-rios organismos levou à criação de um termo específico: agenômica, que será tratada no Capítulo 18.O DNA constitui a sequência de subunidades indi-viduais, denominadas genes pelo biólogo dinamarquêsWilhelm Johannsen, em 1909. A função dos genes é ar-mazenar e codificar as informações genéticas que serãoutilizadas para a produção das cadeias polipeptídicas dasproteínas que compõem as células, tecidos e órgãos dosorganismos.Os primeiros indícios de que o DNA é o material he-reditário surgiram de experiências realizadas com bacté-rias, sendo essas indicações estendidas posteriormenteaos organismos mais complexos.Os genes são sequências de DNA que contêm a in-formação para codificar as cadeias polipeptídicas de umaproteína, sendo os responsáveis pela transmissão here-ditária das características de uma geração para outra.Tais sequências nem sempre são contínuas, podendo serinterrompidas por segmentos de DNA não relacionadoscom a codificação de uma cadeia polipeptídica específica.Os genes estão organizados em um número relativa-mente pequeno de cromossomos. O material genético decada cromossomo consiste em uma fita muito longa deDNA, contendo muitos genes em uma ordem linear, em-bora nem sempre contínua.O conceito de gene modificou-se ao longo do tem-po; atualmente, o gene é definido como o segmentode DNA que codifica uma cadeia polipeptídicae inclui regiões flanqueadoras que antecedem(sequência-líder) e que seguem (cauda) a regiãocodificadora, bem como sequências que não sãotraduzidas (íntrons) e que se intercalam com assequências codificadoras individuais (éxons).1.3 Ácidos nucleicos1.3.1 Estrutura químicaA estrutura química dos ácidos nucleicos é simples e nãovaria entre os diversos organismos.Esses ácidos nucleicos são constituídos de sequên-cias de nucleotídeos. Cada nucleotídeo é formado por:uma base nitrogenada, que pode ser uma purina(adenina ou guanina) ou uma pirimidina (timinaou citosina, no DNA; uracil ou citosina, no RNA);um açúcar (pentose: desoxirribose, no DNA; ribose,no RNA);um grupo fosfato (PO4).Tabela 1.1 Caracterização de procariotos e eucariotosCaracterísticas Procariotos EucariotosNúcleo Não SimMembrana nuclear Não Sim“Corpo nucleoide” Sim NãoMaterial genético DNA, RNA DNACromossomos visíveis na divisão celular Não SimRibossomos Sim SimOutras organelas Não SimParede celular rígida Sim NãoExemplos Bactérias, cianobactérias Fungos, protozoários, algas superiores,vegetais e animais superioresBorges-Osorio_01.indd 9Borges-Osorio_01.indd 9 29/01/13 13:3529/01/13 13:35
  4. 4. GenéticaHumana10O conjunto de base + açúcar denomina-se nucleo-sídeo, chamando-se nucleotídeo ao conjunto de base+ açúcar + fosfato.De acordo com a pentose que apresentam, os ácidosnucleicos são de dois tipos: DNA (ácido desoxirribonu-cleico), que contém desoxirribose, e RNA (ácido ri-bonucleico), que contém ribose. Neste último não hátimina, e sim uracil. O grupo fosfato apresenta-se inva-riável, tanto no DNA quanto no RNA. O DNA encontra-seprincipalmente nos cromossomos; o RNA é encontradono nucléolo (estrutura nuclear) e no citoplasma, havendomuito pouco nos cromossomos.Na Figura 1.1 estão representadas as estruturas quí-micas dos componentes dos nucleotídeos (bases nitrogena-das, açúcares e grupo fosfato); a Figura 1.2 apresenta asestruturas química e molecular de uma sequência de DNA.PURINASguaninaadenina timinaPIRIMIDINASNUCLEOTÍDEO BASEFOSFATOAÇÚCARMONOFOSFATODIFOSFATOTRIFOSFATORIBOSEDESOXIRRIBOSEABCDuracilcitosinaONHNCCCCHCNHNH2NHNNNNCHCCCHCNH2NH2OOH C3 CCCHCNHNHNHHCHCCCOONHNHOHCHCCCNOOOOP ROOO OO OOP P ROOOOOOOOOOP P P ROOOOP CH2 OONNNH2OH HHHHHOH OHOH HHHOOHCH OH2 CH OH2OOHFigura 1.1Representação esquemá-tica das estruturas quí-micas dos componentesdos nucleotídeos, bemcomo de um nucleotídeo,mostrando as ligaçõesentre esses componen-tes. A – Bases nitroge-nadas (purinas: adeninae guanina; pirimidinas:timina, citosina e uracil).B – Grupo fosfato (mo-nofosfato, difosfato etrifosfato). C – Açúcares(desoxirribose e ribose).D – Nucleotídeo.Fonte: Azevedo e AstolfiFilho.1Borges-Osorio_01.indd 10Borges-Osorio_01.indd 10 29/01/13 13:3529/01/13 13:35
  5. 5. 11AsBasesMolecularesdaHereditariedadeAO OOOOOPTN NCH3HOOOOOPOCH2HHHHHNNNO H NNOHHHNCONH NNNHH C2O OO OPCH2HNNHNGOH C2O OPOOOOO OOOOOO OOH C2PHCH3OONNHHHHHHHHTAHHNNHNANHNOOO OPCH2OOOOOOOH NNNN NNNNCH2POHGPH C2C3’5’3’ 5’BHO CHC4’HO5’HOH3’COH HC2’HC1’HHFigura 1.2Representação esquemática das estruturas química e molecular do DNA e de seus nucleotídeos. A – Seg-mento de uma fita dupla de DNA, mostrando alguns pares de nucleotídeos adjacentes e considerando a lo-calização dos carbonos 5 e 3 no açúcar (desoxirribose); pode ser notada a orientação oposta das fitas, porisso denominadas antiparalelas. A fita da esquerda corre da direção 5 (acima) para a direção 3 (abaixo), afita da direita corre em direção oposta: de 5 (abaixo) para 3 (acima). Pode-se observar também a estruturaquímica dos componentes da molécula de DNA, bem como o pareamento entre as bases nitrogenadas ade-nina (A) e timina (T), ligadas por duas pontes de hidrogênio, e entre as bases nitrogenadas guanina (G) ecitosina (C), ligadas por três pontes de hidrogênio. B – Numeração dos carbonos do açúcar (desoxirribose)na estrutura açúcar-fosfato da molécula de DNA.Fonte: Lewis.2Borges-Osorio_01.indd 11Borges-Osorio_01.indd 11 29/01/13 13:3529/01/13 13:35
  6. 6. GenéticaHumana121.3.2 Estrutura molecularAlém das diferenças em sua composição química, o DNAe o RNA mostram diversidade quanto à sua estrutura mo-lecular.É necessário que o DNA tenha uma estrutura sufi-cientemente versátil para explicar a grande variedade degenes e, ao mesmo tempo, ser capaz de reproduzir-se detal maneira que se forme uma cópia idêntica em cada cé-lula com capacidade de se dividir.Em 1953, J. D. Watson e F. C. Crick, com base emestudos de difração aos raios X, propuseram um modelopara a estrutura molecular do DNA que atendia a essesrequisitos: (a) a molécula de DNA é uma longa fita ou fitade nucleotídeos, formando uma configuração semelhanteà de uma escada de corda, enrolada de forma helicoidal;(b) nessa escada, o açúcar e o fosfato são os componen-tes verticais (corrimãos) e as bases nitrogenadas são osdegraus: para que estes se formem, as ligações entre asbases são feitas por pontes de hidrogênio, sendo duplasentre as bases adenina e timina, e triplas entre guanina ecitosina; (c) tal modelo também requer que as duas fitaspolinucleotídicas sejam antiparalelas, isto é, corram emdireções opostas: uma na direção 5→3 e a outra na di-reção 3→5. Na Figura 1.3 está representado o modelooriginal da molécula de DNA. Por seu trabalho, Watson eCrick receberam o Prêmio Nobel de Medicina e Fisiolo-gia, em 1962.Desse modo, o DNA é formado por duas fitas po-linucleotídicas que se dispõem em espiral em torno deum mesmo eixo imaginário, mas com polaridades opos-tas. Cada fita de DNA tem sua polaridade determina-da pela orientação dos componentes açúcar e fosfato.Quando uma fita termina no átomo de carbono 5 damolécula de desoxirribose, que constitui sua extremi-dade 5, a fita oposta termina no carbono 3 do açúcar,denominando-se extremidade 3. Assim, a extremidade5 de uma fita tem orientação oposta à extremidade 3da outra, daí a denominação de fitas antiparalelas. A es-tabilização da dupla-hélice é dada pela interação entreas bases complementares oponentes e as bases que vãose superpondo. O espaço ocupado por duas bases opos-tas é pequeno, o que obriga a associação, por meio depontes de hidrogênio, entre uma base grande (púrica)e outra pequena (pirimídica); duas bases grandes nãocaberiam nesse espaço e duas pequenas não se aproxi-mariam o suficiente para interagir. Essas associaçõescomplementares ocorrem entre adenina e timinae entre guanina e citosina, por serem combinaçõesmais estáveis. Assim, as quantidades de bases púricase pirimídicas são iguais, de tal forma que A+G ϭ C+T.Verifica-se, igualmente, que as quantidades de adeni-na e timina são equivalentes e o mesmo ocorre com aguanina e a citosina, tendo-se, assim: AϭT e GϭC.Considerando-se uma fita hipotética, com a seguintecomposição: 5-ATGCGTCAG-3, sua fita complemen-tar deverá ser 3-TACGCAGTC-5, com a estrutura emdupla-hélice completa sendo assim representada:5-ATGCGTCAG-33-TACGCAGTC-5A relação G+C/A+T é igual em todos os indivíduosda mesma espécie, mas varia de uma espécie para outra.A estrutura molecular do DNA apresenta uma sériede vantagens: (a) possibilita o armazenamento e a codi-ficação de imensa quantidade de informação, tendo emvista as bases nela contidas; assim, para uma moléculacom N bases, há 4Nsequências possíveis; (b) sugere ummecanismo para sua replicação, já que cada fita contéma informação completa da molécula de DNA, podendoservir como molde para a síntese de uma nova fita com-plementar; (c) fornece um mecanismo de defesa contraa perda de informação genética causada por um dano aoDNA (p. ex., se uma base de uma das fitas for danificadaou perdida, poderá ser substituída, já que sua fita com-plementar orienta essa substituição); (d) permite que asfitas de DNA, com a sua complementaridade, se identifi-quem e se juntem em uma mistura complexa de molécu-las, configurando o que se denomina hibridização, pro-cesso utilizado em algumas situações pelos mecanismosnucleares de regulação da expressão gênica.A forma original da dupla-hélice do DNA, propostano modelo de Watson e Crick, é denominada B-DNA,mas ainda existem outras formas. A conformação que oDNA adota depende de vários fatores: nível de hidrata-ção, sequência de DNA, direção e grau do superenrola-mento, modificações químicas das bases, tipo e concen-tração de íons metálicos e presença de poliaminas emsolução. Em condições fisiológicas, a maior parte do DNAde procariotos e eucariotos aparece com a forma dessemodelo: uma hélice com giro para a direita (dextrógira) eentre 10 e 10,5 bases por giro, formando dois sulcos, umgrande e profundo (sulco maior), outro pequeno, estreitoou raso (sulco menor). Essa estrutura pode transformar--se no A-DNA, forma rara já conhecida quando surgiu omodelo de Watson e Crick, também dextrógira, que existesomente em condições salinas altas ou de desidratação,contendo 11 pares de bases por giro e diferindo do B-DNApor uma rotação de 20º em relação ao eixo perpendicularda hélice, o que causa mudança na aparência dos sulcosmaior e menor. Existe ainda o Z-DNA, que apresentainstabilidade termodinâmica e contém 12 pares de ba-ses por giro. Sua orientação para a esquerda (levógira)resulta em maior distância entre seus pares de bases doque no B-DNA e em uma molécula de DNA em forma dezigue-zague, daí sua denominação. Um giro de 180º podeconverter o B-DNA em Z-DNA com função biológica, masainda não se sabe exatamente se o Z-DNA ocorre in vivo.Segmentos de B-DNA cujas bases foram modificadas qui-micamente por metilação podem sofrer grande mudançaem sua conformação e adotar a forma Z. Essas estruturasraras podem ser reconhecidas por proteínas específicasde ligação ao Z-DNA e podem estar envolvidas na regula-ção da transcrição.A Figura 1.4 mostra essas três formas da dupla-hé-lice do DNA. Foram descobertas outras formas de DNABorges-Osorio_01.indd 12Borges-Osorio_01.indd 12 29/01/13 13:3529/01/13 13:35
  7. 7. 13AsBasesMolecularesdaHereditariedadeLegenda:hidrogêniooxigêniofosfatoaçúcaraçúcaraçúcaraçúcaraçúcaraçúcaraçúcaraçúcarfosfatofosfatofosfatofosfatofosfatofosfatofosfatofosfatoC DA Bsulco maiorsulco menorsulco maiorsulco menorcarbono na cadeia deaçúcar+fosfatocarbono e nitrogênionas basesFigura 1.3Modelo de Watson e Crick para a estrutura da molécula do DNA, em diferentes modos de representação. A– A dupla-hélice está desenrolada para mostrar os pares de bases (internamente, em laranja) e o esqueletode açúcar-fosfato (externamente, em preto). Sua largura mantém-se constante porque as purinas pareiamsempre com as pirimidinas: A com T, unidas por duas pontes de hidrogênio, G com C, unidas por três pon-tes de hidrogênio. B – A dupla-hélice assemelha-se a uma escada, na qual os degraus são os pares de bases,situados perpendicularmente aos corrimãos formados pela estrutura de açúcar e fosfato. As setas indicama orientação oposta das fitas. O enrolamento helicoidal das duas fitas faz surgir um sulco menor (~12Å dediâmetro) e um sulco maior (~22Å de diâmetro), assinalados na figura. C – Esta representação mostra asrelações entre os átomos da molécula de DNA. D – O esquema de um segmento desenrolado da dupla-hélicemostra a relação entre as bases complementares, que representam o conteúdo informativo variável do DNA,e o esqueleto de açúcar-fosfato, que é idêntico em todo o DNA.Fonte: Lewis.3Borges-Osorio_01.indd 13Borges-Osorio_01.indd 13 29/01/13 13:3529/01/13 13:35
  8. 8. GenéticaHumana14de hélices dextrógiras, quando investigadas em condiçõeslaboratoriais variadas. Essas formas são denominadasC-DNA, D-DNA, E-DNA e P-DNA. O C-DNA é encon-trado em condições de maior desidratação do que as ob-servadas durante o isolamento do A-DNA e do B-DNA.Apresenta somente 9,3 pares de bases por giro, por isso émenos compacto. Do mesmo modo que no A-DNA, os pa-res de bases do C-DNA não são planos, inclinando-se emrelação ao eixo da hélice. O D-DNA e o E-DNA ocorremem hélices que não contêm guanina em sua composiçãode bases e apresentam 8 e 7 pares de bases por giro, res-pectivamente. O P-DNA (denominação em homenagema Linus Pauling) é mais longo e mais estreito do que aforma B, e seus grupos fosfato e bases nitrogenadas têmlocalização inversa à encontrada no B-DNA, pois os pri-meiros se encontram no interior da molécula e as últimas,na sua superfície externa. Há aproximadamente 2,6 basespor giro, em contraste ao maior número de bases por giroencontrado no B-DNA.O interesse em formas alternativas de DNA, tal comoa forma Z e outras formas raras, decorre da possibilidadede que o DNA possa assumir uma estrutura diferente daexistente na forma B para facilitar algumas de suas fun-ções genéticas.Como já foi mencionado, o RNA difere do DNA emsua composição química quanto a dois aspectos: o RNApossui ribose, no lugar da desoxirribose, e uracil, em vezde timina.Quanto à estrutura molecular, o RNA apresenta ape-nas uma fita de nucleotídeos, cuja composição de basesnão está restrita às igualdades GϭC e AϭU. Em circuns-tâncias especiais, uma molécula de RNA pode formaruma fita dupla com outra parte de sua própria estrutura,como ocorre no RNA transportador, que será abordadomais adiante neste capítulo. Além disso, o DNA contéma informação que codifica uma cadeia polipeptídica, en-quanto o RNA utiliza essa informação.B-DNA A-DNA Z-DNAB-DNA A-DNAFigura 1.4Principais formas do DNA.A – Modelos tridimensio-nais computadorizados deB-DNA, A-DNA e Z-DNA.B – Representação es-quemática de B-DNA e deA-DNA, exemplificando aorientação dos seus paresde bases: no B-DNA, sãoperpendiculares à hélice,enquanto no A-DNA sãoinclinados e afastados dahélice.Borges-Osorio_01.indd 14Borges-Osorio_01.indd 14 29/01/13 13:3529/01/13 13:35
  9. 9. 15AsBasesMolecularesdaHereditariedade1.4 O código genéticoO código para a produção dos diferentes tipos de proteí-nas que o organismo deve formar ao longo de sua vidaestá contido no zigoto de cada indivíduo.Todas as células de um determinado organismo,em um dado momento de sua vida, contêm o mesmocódigo ou informação genética do zigoto que as origi-nou, porém nem todos os genes estão funcionando emtodas as células ao mesmo tempo e com a mesma inten-sidade. Isso varia com o tipo de célula e com a idade doindivíduo.O código genético descreve a relação entre a sequên-cia de bases nitrogenadas do DNA e a sequência de ami-noácidos na cadeia polipeptídica correspondente. Foielucidado em 1966, graças à descoberta de que o RNAmensageiro transmite a informação entre genes e pro-teínas. A palavra-chave do código para um aminoácidoconsiste em uma sequência de três bases nitrogenadasadjacentes, que formam a unidade de informaçãogenética ou códon. O código genético apresenta as se-guintes características:a. Sua leitura é feita em trincas de bases ou de nu-cleotídeos.b. É degenerado ou redundante. A sequência denucleotídeos deve conter o número suficiente deunidades codificadoras para representar 20 ami-noácidos. Como o DNA possui apenas quatro basesdistintas, são necessárias diversas combinaçõesdessas bases para codificar os diferentes tipos deaminoácidos. Se a combinação das bases fosse 2 a2 (42), haveria 16 arranjos; como são 20 os aminoá-cidos, essa combinação é, portanto, inadequada.Agrupando-se as bases 3 a 3 (43), resultam 64 ar-ranjos, número maior do que o necessário. Desdeque há 64 combinações possíveis e apenas 20 ami-noácidos diferentes, deduz-se que somente algu-mas das trincas especificam aminoácidos ou que al-guns deles devem ser especificados por mais de umtipo de trinca ou por mais de um códon. Por exem-plo, o aminoácido fenilalanina pode ser codificadopor dois códons diferentes: UUU e UUC. Os códonsque representam os mesmos aminoácidos são de-nominados códons sinônimos, relacionando-se, emgeral, por uma alteração de sua terceira base; a de-generação da terceira base minimiza os efeitos depossíveis mutações.c. É considerado não ambíguo, isto é, uma trinca sópode codificar um aminoácido. As trincas acima re-feridas só codificam a fenilalanina, e nenhum outroaminoácido.d. É um código sem superposição, ou seja, umadada base pertence a uma só trinca ou códon. Ex-ceções: bacteriófago ␾ X174 e outros vírus, em quehá pontos de iniciação múltiplos, criando genes su-perpostos.e. É, também, contínuo, não existindo espaçamentoentre os códons.f. É semiuniversal, ou seja, os mesmos aminoácidossão codificados pelos mesmos códons em quase to-dos os organismos, permitindo que um RNA mensa-geiro seja traduzido em uma célula de outra espécie,o que possibilitou a técnica do DNA recombinante(ver Cap. 17). Aparentemente, uma vez evoluído,o código genético vem mantendo-se quase intactoao longo da história evolutiva da vida na Terra. Noentanto, existem algumas exceções (certos genesda mitocôndria humana e de levedura, da bactériaMycoplasma capricolum e dos protozoários ciliadosParamecium, Tetrahymena e Stylonychia), comomostra a Tabela 1.2. Em genomas mitocondriais,essas alterações são mais comuns; em genomas nu-cleares, são esporádicas e afetam geralmente os có-dons de finalização ou terminação.Tabela 1.2 Algumas exceções ao código genético universalCódon No código normal No código alterado FonteUGA finalização trp Mitocôndria humana e de leveduraMycoplasma (bactéria)cys Euplotes (protozoário ciliado)sel Procariotos e eucariotosUAA finalização gln Paramecium, Tetrahymena,Stylonychia (protozoários ciliados)UAG finalização gln Tetrahymenapyr Archaea; bactériaAUA ile met Mitocôndria humanaAGA arg finalização Mitocôndria humanaAGG arg finalização Mitocôndria humanaCUA leu thr Mitocôndria de leveduraCUG leu ser Candida (levedura)Fonte: Klug e colaboradores4e Lewin.5Borges-Osorio_01.indd 15Borges-Osorio_01.indd 15 29/01/13 13:3529/01/13 13:35
  10. 10. GenéticaHumana16g. Há códons de iniciação e de finalização ou ter-minação. O início da síntese de um polipeptídeo,em procariotos, é assinalado pela presença de umcódon iniciador específico, que é AUG no RNA men-sageiro, correspondendo ao aminoácido metionina.Há, também, códons finalizadores ou terminado-res, que indicam o término da síntese polipeptídica,como UAA, UAG e UGA, e em geral não correspon-dem a aminoácidos em eucariotos.A Figura 1.5 mostra o código genético completo,que geralmente é representado pelas bases contidas noRNA mensageiro, com uracil (U) em lugar de timina (T).Os aminoácidos selenocisteína (sel) e pirroli-sina (pyr), codificados respectivamente pelas trincasUGA e UAG, que correspondem a códons finalizadoresna maioria dos organismos, são considerados os 21º e22º aminoácidos, embora o primeiro ocorra em proca-riotos e eucariotos e o último apenas em bactérias e emArchaea. Esses casos são interpretados como um meiode facilitar a decodificação de sequências situadas depoisdo códon finalizador.1.5 DNA: nuclear e mitocondrialO conteúdo de DNA das células humanas constitui o quese denomina de genoma humano. Esse genoma subdivi-de-se em duas partes: o genoma nuclear, que correspon-de à maior parte da informação genética total, e o geno-ma mitocondrial, que corresponde à informação genéticarestante (ver seção 1.5.2).1.5.1 DNA nuclearO genoma humano nuclear apresenta em torno de 33%do conteúdo de DNA na forma de genes estruturais e se-quências a eles relacionadas, enquanto sua maior parte(67%) é encontrada como DNA extragênico, isto é, o con-Código genético no mRNA para todos os aminoácidosCódigo alfabético abreviadoInício AUGFim UAAUAGUGAA (Ala) GCUGCCGCGGCAR (Arg) CGUCGCCGGCAAAGGAGAD (Asp) GAUGACN (Asn) AAUAACC (Cys) UGUUGCE (Glu) GAGGAAQ (Gln) CAGCAAG (Gly) GGUGGCGGGGGAH (His) CAUCACI (Ile) AUUAUCAUAL (Leu) CUUCUCCUGCUAUUGUUAK (Lis) AAGAAAM (Met) AUGF (Phe) UUUUUCP (Pro) CCUCCCCCGCCAS (Ser) UCUUCCUCGUCAAGUAGCT (Thr) ACUACCACGACAW (Trp) UGGY (Tyr) UAUUACV (Val) GUUGUCGUGGUAB (Asx) AsnouAspZ (Glx) GlnouGluPrimeiraBase nucleotídicaUracil (U) Citosina (C) Adenina (A) Guanina (G)TerceiraUracil(U)F Fenilalanina (Phe)F Fenilalanina (Phe)L Leucina (Leu)L Leucina (Leu)S Serina (Ser)S Serina (Ser)S Serina (Ser)S Serina (Ser)Y Tirosina (Tyr ou tyr)Y Tirosina (Tyr ou tyr)Códon finalizadorCódon finalizadorC Cisteína (Cys ou cys)C Cisteína (Cys ou cys)Códon finalizadorW Triptofano (Trp)UCAGCitosina(C)L Leucina (Leu)L Leucina (Leu)L Leucina (Leu)L Leucina (Leu)P Prolina (Pro)P Prolina (Pro)P Prolina (Pro)P Prolina (Pro)H Histidina (His)H Histidina (His)Q Glutamina (Gln)Q Glutamina (Gln)R Arginina (Arg)R Arginina (Arg)R Arginina (Arg)R Arginina (Arg)UCAGAdenina(A)I Isoleucina (Ile)I Isoleucina (Ile)I Isoleucina (Ile)Início (Metionina)T Treonina (Thr)T Treonina (Thr)T Treonina (Thr)T Treonina (Thr)N Asparagina (Asn)N Asparagina (Asn)K Lisina (Lys ou lys)K Lisina (Lys ou lys)S Serina (Ser)S Serina (Ser)R Arginina (Arg)R Arginina (Arg)UCAGGuanina(G)V Valina (Val)V Valina (Val)V Valina (Val)V Valina (Val)A Alanina (Ala)A Alanina (Ala)A Alanina (Ala)A Alanina (Ala)D Ácido aspártico (Asp)D Ácido aspártico (Asp)E Ácido glutâmico (Glu)E Ácido glutâmico (Glu)G Glicina (Gly)G Glicina (Gly)G Glicina (Gly)G Glicina (Gly)UCAGSegundaFigura 1.5O código genético. Além do códigogenético tradicional, representadopelas três primeiras letras de cadaaminoácido, também é usado o có-digo alfabético abreviado, em que osaminoácidos são representados ape-nas por uma letra do alfabeto.Fonte: Passarge.6Borges-Osorio_01.indd 16Borges-Osorio_01.indd 16 29/01/13 13:3529/01/13 13:35
  11. 11. 17AsBasesMolecularesdaHereditariedadeteúdo de DNA que não faz parte dos genes nem das se-quências a eles relacionadas.A quantidade do DNA de uma célula diploide hu-mana é de aproximadamente 6.000 Mb (megabases). Seesse DNA consistisse apenas em genes estruturais, isto é,genes que codificam cadeias polipeptídicas, existiria cer-ca de 6 a 7 milhões de genes no genoma humano, númerodemasiadamente alto, uma vez que a análise de genomaseucarióticos tem revelado que a relação entre o tamanhodo genoma e o número de genes não é linear. SegundoLewin,5estima-se que existam entre 20 e 25 mil genesestruturais, codificados por sequências de DNA não repe-titivo, sendo o restante do genoma constituído de outrostipos de DNA. De acordo com Passarge,6essa estimativaé de aproximadamente 22 mil genes, portanto dentro dointervalo citado.A maior parte do DNA do genoma de organismos su-periores consiste em sequências de DNA repetitivo, semfunção codificadora. Os genomas maiores, em um mesmofilo, não contêm mais genes, mas maiores quantidades deDNA repetitivo.1.5.1.1 Tipos de sequênciasA Figura 1.6 apresenta os principais tipos de sequên-cias de DNA e alguns tipos de sequências repetitivas dogenoma humano nuclear. O DNA nuclear dos eucariotosapresenta os seguintes tipos de sequências: DNA nãorepetitivo, que consiste em sequências individuais pre-sentes em apenas uma cópia no genoma haploide; e DNArepetitivo, que abrange sequências presentes em maisde uma cópia por genoma.DNA não repetitivo – Esse tipo de DNA consiste emsequências individuais presentes em apenas uma cópiapor genoma, contendo os genes estruturais (55 Mb)e sequências relacionadas (945 Mb). A distribuiçãodesses genes varia muito entre os diferentes cromos-Genes e sequênciasrelacionadas1.000 Mb55 Mb~22.000 genesSequênciasrelacionadasao gene 945 MbÍntronsUTRs~20.000pseudogenesDNA extragênico2.000 MbRepetiçõesdispersas1.400 MbMicrossatélites90 MbOutras regiões600 MbOutras 510 MbAP ORF 1 ORF 2 LINE-1LINE-2LINE-3~600.000 cópias~370.000 cópias~44.000 cópias6–8 kb100–300 pbFamília AluMIRMIR3~1.200.000 cópias~450.000 cópias~85.000 cópiasLTR gag pol (env) LTR6–11 kbPSequênciasretrovirais humanasendógenas (HERV)(várias classes;autônomas enão autônomas)~240.000 cópiasTransposase2–3 kbVárias classes(autônomas enão autônomas)~300.000 cópiasGenoma humano3.000 MbLINE 640 MbSINE 420 MbLTR 250 MbTransposons 90 MbElementos nuclearesintercalares longos(LINEs) (autônomos)Elementos nuclearesintercalares curtos(SINEs) (não autônomos)3 -2 -1 -Elementos similaresao retrovírus(transposons LTR)4 - Transposonsde DNAB(A)n(A)nFigura 1.6A – Principais tipos de sequên-cias do DNA. B – Alguns tiposde sequências repetitivas doDNA.Borges-Osorio_01.indd 17Borges-Osorio_01.indd 17 29/01/13 13:3529/01/13 13:35
  12. 12. GenéticaHumana18somos e em certas regiões cromossômicas, dado queas regiões centroméricas e heterocromáticas contêmpoucos genes estruturais, estando a maioria deles lo-calizada em regiões subteloméricas (regiões cromossô-micas situadas entre o centrômero e as extremidadesdos cromossomos; para mais detalhes, ver Cap. 4). Osgenes estruturais codificam polipeptídeos que integramenzimas, hormônios, receptores e proteínas estruturaise reguladoras.Entre as sequências relacionadas aos genes, encon-tram-se os íntrons e aproximadamente 20 mil pseudo-genes. Os íntrons (“int” de interveniente) são sequênciasinternas de DNA presentes entre as regiões codificadorasda maioria dos genes e no pré-mRNA, mas são removidosantes da tradução do mRNA maduro. Esses segmentosnucleotídicos são também chamados sequências interve-nientes, e os genes que as contêm são denominados genesinterrompidos.Os pseudogenes são genes não funcionais, com se-quências homólogas às de genes estruturais funcionais,mas diferindo desses por apresentarem inserções, dele-ções e sequências flanqueadoras de repetição direta com10 a 20 nucleotídeos, que impedem a sua expressão. Apa-rentemente, os pseudogenes surgiram por duplicação eaquisição de muitas mutações nos elementos codificado-res e reguladores, ou pela inserção de sequências de DNAcomplementares, às quais faltam as sequências promoto-ras necessárias para sua expressão.DNA repetitivo – Esse tipo de sequência constitui oDNA extragênico, que abrange 2.000 Mb sem informaçãogenética conhecida. Alguns autores costumam classificaro DNA repetitivo em duas classes:1a– DNA moderadamente repetitivo, que consisteem sequências relativamente pequenas que se repetem de10 a mil vezes e estão dispersas por todo o genoma; essesubtipo inclui as famílias multigênicas, formadas porgenes funcionais em múltiplas cópias, com funções simi-lares, tendo surgido por duplicação, com consequente di-vergência evolutiva. Alguns fazem parte de grupamentos,enquanto outros estão espalhados pelo genoma, consti-tuindo as referidas famílias multigênicas, que podem serde dois tipos: (a) famílias gênicas clássicas, que apresen-tam alto grau de homologia em suas sequências, tendose originado por duplicação. Exemplos: (1) os numerososgenes que codificam os diversos RNAs ribossômicos eagrupam-se nas regiões organizadoras de nucléolos, nosbraços curtos dos cinco cromossomos autossômicos acro-cêntricos (cromossomos 13, 14, 15, 21 e 22; ver Cap. 4);(2) as famílias gênicas que codificam os diferentes RNAstransportadores, localizadas em numerosos conjuntosdispersos por todo o genoma; (b) superfamílias gênicas,compostas por genes com funções muito semelhantes quese originaram por duplicação a partir de um gene precur-sor e posterior divergência. Os exemplos mais conhecidossão: (1) superfamília do sistema HLA, localizada no braçocurto do cromossomo 6; (2) superfamília dos receptoresdas células T, que têm homologia estrutural com os genespara as imunoglobulinas.2a– DNA altamente repetitivo, que consiste em se-quências muito curtas (geralmente com menos de 100pares de bases [pb]) presentes em milhares de vezes nogenoma e não transcritas. O DNA altamente repetitivoconsiste sobremaneira em sequências de DNA dispersaspor todo o genoma (cerca de 1.400 Mb) e outras, comoo DNA-satélite. Entre as repetições dispersas (nãoem tandem), muitas são elementos de transposição,que são móveis, podendo movimentar-se para diferentesregiões do genoma. A seguir, são descritos quatro tiposdessas repetições dispersas:1. Longos elementos nucleares dispersos ou ele-mentos intercalares longos (LINEs, do inglêslong interspread nuclear elements) – abrangendocerca de 640 Mb do genoma humano, consistem, emsua forma mais comum (LINE-1 ou elemento L1), emsequências repetitivas de aproximadamente 6.500 pb,presentes em até 100 mil cópias. Um módulo de 6 a8 kb de comprimento apresenta duas fases de leituraaberta, um promotor (P) na extremidade 5 e segmen-tos ricos em adenina na extremidade 3. Há três tiposde LINEs (L1, L2 e L3) que se encontram dispersosem grande quantidade no genoma, do qual perfaz 15 a20%. Uma pequena porção pode apresentar transpo-sição autônoma, cujo mecanismo já se conhece. A se-quência L1 é transcrita em uma molécula de RNA, queserve de molde para a síntese do DNA complementar,usando a enzima transcriptase reversa (enzima quetranscreve inversamente o RNA em DNA, codificadapor uma parte da sequência L1). A seguir, a nova có-pia de L1 é integrada ao DNA do cromossomo em umnovo sítio. Devido à semelhança desse mecanismo detransposição ao utilizado pelos retrovírus, os LINEssão referidos também como retrotransposons.2. Pequenos elementos nucleares dispersos ouelementos intercalares curtos (SINEs, do inglêsshort interspread nuclear elements) – abrangemcerca de 420 Mb, têm menos de 500 pb de extensão econsistem em mais de 500 mil cópias dispersas pelogenoma. Um dos tipos mais importantes de SINE é afamília Alu ou repetições Alu, cuja denominaçãose deve ao fato de que essas repetições, com cerca de300 pb de tamanho, contêm uma sequência de DNAque pode ser cortada pela enzima de restrição Alu I(ver Cap. 17). Uma característica importante das se-quências Alu é sua capacidade de autoduplicação,podendo inserir-se em outras regiões do genoma,interrompendo, às vezes, um gene que codifica umadada proteína e acarretando, assim, uma doença ge-nética. Seu mecanismo de transposição é semelhanteao dos LINEs.As funções do DNA disperso ainda não são total-mente conhecidas. Os membros da família Alu são flan-queados por pequenas sequências de repetição direta e,portanto, se assemelham a sequências de DNA instáveis,denominadas elementos de transposição, elemen-tos transponíveis ou transposons. Tais elementos,identificados primeiramente no milho, movem-se espon-Borges-Osorio_01.indd 18Borges-Osorio_01.indd 18 29/01/13 13:3529/01/13 13:35
  13. 13. 19AsBasesMolecularesdaHereditariedadetaneamente ao longo de todo o genoma, de um cromos-somo para outro, tanto em plantas quanto em animais.Postula-se que tanto as repetições Alu como os elementosL1 acarretariam mutações patogênicas, encontradas emvárias doenças humanas hereditárias, como, por exem-plo, a hipercolesterolemia familiar.3. Repetições terminais longas (LTRs, do inglêslong terminal repeats) – abrangem cerca de 250Mb do genoma e dispõem de repetições diretas emambas as extremidades. Como os retrovírus, as LTRsdos retrotransposons têm promotores para iniciar atranscrição da RNA-polimerase II e sinais de polia-denilação para processamento do mRNA.4. Transposons de DNA – abrangem cerca de 90 Mbdo genoma e apresentam várias classes (autônomas enão autônomas). Os transposons de DNA movem-sede uma parte a outra do genoma por meio de um me-canismo de corte-e-colagem, mediado pela enzimatransposase. Ao contrário das LTRs, esses elemen-tos contêm repetições terminais com extremidadesinvertidas.As repetições em tandem (nas quais o início deuma repetição ocorre imediatamente adjacente ao finalde outra) consistem em muitas repetições de sequênciasde DNA não codificadoras, que podem estar concentra-das em locais restritos ou muito dispersas no genoma.Podem dividir-se em três subgrupos:1. DNA-satélite – abrange uma proporção variável doDNA total dos eucariotos (inexistindo em procariotos)e consiste em repetições curtas em tandem, situadasnas regiões flanqueadoras dos centrômeros, conhe-cidas como regiões heterocromáticas, de alguns cro-mossomos (p. ex., 1, 9, 16, Y). Não deve ser confun-dido com o satélite dos cromossomos acrocêntricos(ver Cap. 4); sua denominação origina-se do fato de,na centrifugação em gradiente de densidade de cloretode césio, separar-se como um “satélite” do restante dogenoma. Em humanos, uma das sequências de DNA--satélite mais conhecidas é a família alfoide, com171 pb, que é encontrada em arranjos de repetições emtandem do início ao fim e chega a totalizar 1 milhãode pares de bases. Não se conhece o papel exato dessetipo de DNA altamente repetitivo na função centromé-rica, mas se sabe que ele não é transcrito.2. Minissatélites – consistem em duas famílias de re-petições curtas em tandem: (a) DNA telomérico,situado na porção terminal das extremidades cro-mossômicas (telômeros), consistindo em 10 a 15 kbde repetições em tandem de uma sequência de DNAde 6 pb (TTAGGG); esse DNA é necessário para a in-tegridade cromossômica na replicação e é adicionadoao cromossomo por uma enzima específica denomi-nada telomerase; (b) DNA minissatélite hiper-variável, que ocorre nas proximidades dos telôme-ros e em outros locais dos cromossomos. Um de seusexemplos é o DNA descrito como número variá-vel de repetições em tandem (VNTR, do inglêsvariable number tandem repeats), que consiste emrepetições curtas (15 a 100 pares de bases) encontra-das no interior dos genes e entre eles. É altamentepolimórfico, variando de um indivíduo para outro ecriando regiões localizadas de 1 a 20 kb de extensão.Muitos grupamentos desse tipo estão dispersos aolongo do genoma, sendo referidos também como mi-nissatélites. A variação em comprimento dessas re-giões entre os humanos serviu de base para a técnicadenominada impressões digitais de DNA (finger-printing), que se aplica à identificação de indivíduose à medicina forense (ver Cap. 17).3. Microssatélites – consistem em repetições cur-tas em tandem (< de 10 nucleotídeos, geralmente1 a 5 nucleotídeos), dispersas no genoma e com altograu de polimorfismo. São conhecidas também comoSTRs (do inglês short tandem repeats), utilizadascomo marcadores moleculares na análise genômi-ca. Raramente ocorrem no interior das sequênciascodificadoras, mas repetições de três nucleotídeospróximos aos genes estão associadas a certas doen-ças hereditárias, como a doença de Huntington,a deficiência mental ligada ao X frágil e a distrofiamiotônica (ver Cap. 5). Além dessas sequências,existem sequências de DNA com 1 a 4 pares de ba-ses, altamente polimórficas e de ampla distribuiçãono genoma, chamadas repetições de sequênciassimples e utilizadas como marcadores molecularesem diversos métodos.Essa terminologia, entretanto, não é precisamentedefinida. Por exemplo, a classificação em DNA modera-damente repetitivo e altamente repetitivo é variável naliteratura específica, e alguns autores usam uma classi-ficação híbrida para o DNA repetitivo (DNA moderada-mente a altamente repetitivo). Certos autores utilizam adenominação microssatélite quando o tamanho da unida-de repetitiva é inferior a 10 pb, chamando-a minissatélitequando esse tamanho está entre 10 e 100 pb.Até o presente momento, não há uma explicação in-teiramente satisfatória para a vasta quantidade de DNArepetitivo no genoma humano, parecendo ter pouca ounenhuma função e contribuindo pouco para o fenótipo.Daí sua denominação de “DNA egoísta”, que se preser-va a si próprio, com a autoperpetuação no genoma comosua única função, e contra o qual não agem as forças se-letivas. Outro termo utilizado para designar o aparenteexcesso de DNA é “DNA lixo”, que se refere a sequênciasgenômicas sem qualquer função aparente. É provável queexista um equilíbrio no genoma entre a criação de novassequências e a eliminação de sequências indesejadas, eque alguma proporção do DNA sem função aparente es-teja em processo de eliminação.1.5.2 DNA mitocondrial (mtDNA)O DNA mitocondrial é uma molécula circular de fitadupla, com 16.569 pares de bases, existente no interiordas mitocôndrias, organelas oriundas de bactérias e pro-Borges-Osorio_01.indd 19Borges-Osorio_01.indd 19 29/01/13 13:3529/01/13 13:35
  14. 14. GenéticaHumana20dutoras de energia localizadas no citoplasma de pratica-mente todas as células eucarióticas. Esse DNA não apre-senta íntrons (exceção: leveduras, que contêm grandesíntrons), nem crossing-over, arcabouço de histonas esistema de reparo eficiente; existe em muitas cópias pormitocôndria e por célula, é de herança materna e sofrealta exposição aos radicais livres de oxigênio.As células eucarióticas contêm um número variávelde mitocôndrias, dependendo da energia necessária paraa realização de suas funções: quanto maior essa neces-sidade, como nos músculos e no cérebro, por exemplo,maior a quantidade de mitocôndrias existente no cito-plasma celular.As mitocôndrias apresentam, via de regra, forma ci-líndrica alongada, com diâmetro de 0,5 a 1,0 m␮, mas sãoorganelas dotadas de grande mobilidade e plasticidade,mudando constantemente de forma e podendo fundir-seumas às outras e separar-se posteriormente.Cada mitocôndria é formada por uma matriz limi-tada por duas membranas, uma externa e outra in-terna. Esta última apresenta dobramentos para dentro,formando cristas que aumentam internamente sua super-fície total (Fig. 1.7A). O genoma mitocondrial humano ede outros mamíferos apresenta 13 genes codificadores deproteínas, 22 genes de tRNA e 2 genes de rRNA. Os genescodificadores de proteínas encontram-se no complexocitocromo-c-oxidase (subunidades 1, 2 e 3) e nas regiõesdo citocromo b e das subunidades 6 e 8 do complexo daATPase. Por meio de densidade, pode ser diferenciadauma fita simples leve (L) de uma pesada (H), na qual seencontra a maioria dos genes (Fig. 1.7B). Os genes mi-tocondriais utilizam um código genético diferente do usa-do pelos genes nucleares; em mamíferos, UGA para trp,AUA para met e AGA/AGG como códon de finalização.A taxa de mutação do mtDNA é quase 20 vezes maisalta do que a do DNA nuclear, provavelmente devido àgrande produção de radicais livres de oxigênio (mutagê-nicos) nas mitocôndrias e à sua limitada capacidade dereparo.O mtDNA atraiu a atenção de muitos pesquisado-res, quando foi publicado um artigo por Cann e colabo-radores,8em 1987, no qual era sugerido que a espéciehumana descenderia de uma única mulher africana queteria vivido há 200 mil anos. Tal hipótese baseava-se nofato de que as mitocôndrias são exclusivamente herançamaterna e o acúmulo de mutações no mtDNA pode serutilizado como um relógio evolutivo. Hoje, são conheci-das muitas variantes do mtDNA, atribuídas a diferentesA BMatrizMembranainternaMembranaexternaEspaçointermembranarThr-tRNAoriAlça DPhe-tRNA12S-rRNAVal-tRNA16S-rRNAND 5Fita HLeu-tRNASer-tRNAHis-tRNAND 4ND 4LArg-tRNAND 3Gly-tRNA Lys-tRNAAsp-tRNATrp-tRNAND 2f-Met-tRNAIle-tRNAND 1Leu-tRNAATP-sintetasesubunidade 6 ATP-sintetasesubunidade 8Fita LND 6Glu-tRNAPro-tRNAGln-tRNAAla-tRNAAsn-tRNACys-tRNATyr-tRNASer-tRNAori16.569pares de basesCitocromobCitocromo-c-oxidase 3Citocromo-c-oxidase1Citocromo-c-oxidase2Figura 1.7Representação esquemática de uma mitocôndria e do DNA mitocondrial (mtDNA). A – Mitocôndria e seus principaiscomponentes: matriz, membrana interna, membrana externa e espaço intermembranar. (Fonte: Alberts e colaborado-res.7) B – DNA mitocondrial (mtDNA) humano, mostrando os genes mitocondriais em seres humanos: 22 genes paratRNA, 2 para rRNA (12S rRNA e 16S rRNA) e 13 regiões codificadoras de proteínas relacionadas com a respiração (ND1, ND2, CO 1, CO2, ATPase 8, ATPase 6, CO3, ND3, ND4L, ND4, ND5, ND6 e Cyt b). Alça D ϭ região do mtDNA naqual um curto segmento de RNA pareia com uma das fitas de DNA; ND ϭ NADH desidrogenase.Borges-Osorio_01.indd 20Borges-Osorio_01.indd 20 29/01/13 13:3529/01/13 13:35
  15. 15. 21AsBasesMolecularesdaHereditariedadehaplogrupos, de acordo com sua distribuição geográfica.Os principais grupos são denominados L1, L2 e L3 (naÁfrica), M e N (na Ásia) e R (na Europa), cada uma comdiversos subgrupos, propiciando a reconstrução de suaárvore evolutiva.O mtDNA também é importante sob outros aspec-tos, como, por exemplo, o da sua relação com algumasdoenças. Os bilhões de moléculas do mtDNA de qualquerindivíduo são geralmente idênticos e de herança materna,pois o espermatozoide contém escasso citoplasma, compoucas mitocôndrias; portanto, uma doença causada pormutação no mtDNA é herdada exclusivamente da mãe.Apenas as mulheres podem transmitir as doenças mito-condriais, passando as mutações para toda a sua prole deambos os sexos. No entanto, essa transmissão não pareceser tão simples, pois a expressão de alguns genes mito-condriais depende da interação com genes nucleares. Ogenoma mitocondrial contém em torno de 1.500 genes,cuja maioria está distribuída no genoma nuclear. Muitasproteínas mitocondriais são agregadas de produtos gêni-cos nucleares e mitocondriais; esses produtos são trans-portados para as mitocôndrias após a transcrição nucleare a tradução citoplasmática, formando proteínas funcio-nais com subunidades de produtos gênicos nucleares emitocondriais. Portanto, algumas doenças genéticas deorigem mitocondrial seguem as leis de Mendel, enquan-to as doenças puramente mitocondriais seguem somen-te a herança materna. Dado que o mtDNA se replica deforma independente do DNA nuclear e as mitocôndriassegregam-se nas células-filhas também de forma inde-pendente dos cromossomos nucleares, a proporção demitocôndrias que porta uma mutação no mtDNA podediferir entre as células somáticas. Essa heterogeneidade édenominada heteroplasmia e tem importante papel nofenótipo variável das doenças mitocondriais.Além disso, os tecidos diferem em sua dependênciada fosforilação oxidativa, sendo mais dependentes o co-ração, os músculos esqueléticos e o sistema nervoso cen-tral. Portanto, as doenças mitocondriais caracterizam--se com mais frequência por miopatias e encefalopatias,problemas dos músculos e do encéfalo, respectivamente.Por fim, a fosforilação oxidativa declina com a idade, tal-vez devido ao acúmulo de mutações no mtDNA. Assim,o fenótipo clínico, nas doenças mitocondriais (comoLHON), cardiomiopatia hipertrófica com miopatia ediabetes com surdez de herança materna; ver Cap. 5),não está direta ou simplesmente relacionado ao genó-tipo do mtDNA, mas reflete vários fatores, como os jámencionados.1.6 RNA: tiposExistem quatro tipos principais de RNA, todos trans-critos de moldes de DNA por RNA-polimerases e com amesma estrutura química básica. Esses RNAs têm tama-nhos diferentes e possuem sequências de bases desiguaisque determinam funções específicas.1.6.1 RNA heterogêneo nuclear, pré-RNAmensageiro, RNA primário outranscrito primárioEsse tipo de RNA é encontrado apenas em eucario-tos e seu tamanho é variável, sendo sempre mais longodo que o RNA que é traduzido (mRNA) e praticamentecorrespondente à sequência do gene que é transcrito. Éo primeiro passo da transcrição (por isso também é de-nominado de transcrito primário), forma-se a partir doDNA e grande parte dele nunca sai do núcleo. Fisicamen-te, mantém-se ligado a proteínas, formando partículasde ribonucleoproteínas heterogêneas nucleares(hnRNPs); in vitro, essas partículas tomam a forma depequeninas contas ou glóbulos.O hnRNA é formado por regiões codificadoras quesão transcritas e traduzidas (éxons) e regiões não codifi-cadoras que são transcritas, mas que não são traduzidas(íntrons), por isso ele é muito mais longo do que a infor-mação que codifica. Os íntrons são segmentos de hnRNAeliminados ainda no núcleo, como parte do processa-mento do RNA mensageiro. Essa eliminação é realizadapor pequenas moléculas de RNA que funcionam comoenzimas, denominadas ribozimas. Após a excisão dosíntrons, os segmentos remanescentes (os éxons) reúnem--se para formar o RNA mensageiro. A excisão dos íntronse a reunião dos éxons fazem parte desse processamento,conforme mostrado na Figura 1.8.Entre 10 e 25% das moléculas de hnRNA são con-vertidos em RNA mensageiro, pois a maior parte dotranscrito primário, constituída de íntrons, é degrada-da durante esse evento. Ainda são ignoradas as funçõesdos íntrons e as razões pelas quais os genes não sãocontínuos. Uma hipótese é a de que os íntrons sirvamcomo espaçadores para facilitar a recombinação entre oséxons. Sabe-se que somente mutações nos éxons podemafetar a sequência proteica; no entanto, mutações em ín-trons podem afetar o processamento do RNA mensagei-ro, impedindo, assim, a síntese da cadeia polipeptídica.A maioria dos genes que codificam proteínas provavel-mente surgiu como sequências interrompidas e, certa-mente, a organização de éxons e íntrons foi importantenos primórdios evolutivos dos genes, supondo-se que assequências de íntrons tenham propiciado o surgimentode novas e úteis proteínas. O número de íntrons é alta-mente variável, mas nem todos os genes os possuem,como, por exemplo, os genes que codificam as histonas(proteínas básicas que, juntamente com o DNA e outroscomponentes, constituem os cromossomos).1.6.2 RNA mensageiroO RNA mensageiro transfere a informação contida nosgenes estruturais para as sequências de aminoácidos queformam os polipeptídeos. É responsável por aproximada-mente 5% do RNA total de uma célula.O mRNA, após ser processado a partir do pré-mRNA,constitui-se apenas de éxons, é relativamente estável eBorges-Osorio_01.indd 21Borges-Osorio_01.indd 21 29/01/13 13:3529/01/13 13:35
  16. 16. GenéticaHumana22possui número variável de nucleotídeos. Esse númeropode variar de 100 a 10 mil, considerando-se em conjuntoprocariotos e eucariotos.Durante seu processamento, pode ocorrer o cap-ping, isto é, a adição de um nucleotídeo específico mo-dificado (uma guanina metilada), denominado de 7-me-tilguanosina, trifosfato de guanosina ou cap (capuz), àextremidade 5 do mRNA, no núcleo. Esse evento pareceter grande efeito na tradução do mRNA, pois confere van-tagem ao seu transporte para o citoplasma e à sua ligaçãoaos ribossomos, além de protegê-lo da degradação pelasexonucleases celulares endógenas.Outra modificação pós-transcricional do mRNA é aadição de aproximadamente 200 nucleotídeos de adeni-CitoplasmamRNA cap 5’Núcleo3’ – AAAA... (cauda poli-A)splicing, emenda ou recomposiçãomRNA cap 5’modificação do mRNAtranscriçãomembrananucleartransporte do mRNA do núcleoao citoplasma, para a tradução3’ – AAAA...(cauda poli-A)pré-mRNAou hnRNA5’ sequêncianão codificadora3’ sequêncianão codificadoraDNAFigura 1.8Transcrição do DNA em RNA heterogêneo nuclear (hnRNA) e processamento do RNA mensageiro(mRNA).Fonte: Lewis.3Borges-Osorio_01.indd 22Borges-Osorio_01.indd 22 29/01/13 13:3529/01/13 13:35
  17. 17. 23AsBasesMolecularesdaHereditariedadena à sua extremidade 3 (poliadenilação), após a trans-crição, constituindo a chamada sequência poli-A oucauda poli-A. Tal adição ocorre na região flanqueadoranão traduzida, cerca de 15 a 20 pb a jusante de uma se-quência de seis nucleotídeos, denominada sinal AAUA-AA. Existe uma hipótese de que essa sequência tambémesteja associada à maior facilidade de transporte domRNA para o citoplasma e sua estabilidade no momentoem que chega ao citoplasma, dando-lhe mais resistênciaà digestão por exonucleases celulares endógenas, pois aperda da sequência poli-A pode desencadear a desestabi-lização desse mRNA. Esses eventos estão representadosna Figura 1.8.1.6.3 RNA transportador ou RNA detransferênciaEsse RNA é responsável por até 15% do RNA total deuma célula, sendo relativamente pequeno, com 70 a 90nucleotídeos. É estável, sendo uma molécula altamenteespecializada e importante para a síntese de proteínas;durante a tradução, sua configuração torna-o apto a re-conhecer e ligar-se a aminoácidos por uma de suas extre-midades, transportando-os para o ribossomo, e a códonsdeterminados no mRNA, pela outra extremidade. Algu-mas das bases do tRNA estabelecem ligações fracas entresi, fazendo com que esse tRNA forme alças, que lhe confe-rem um aspecto de folha de trevo. Cada aminoácido pos-sui um ou mais tRNAs que lhe são específicos. Tal espe-cificidade depende de uma série de enzimas complexas,as aminoacil-tRNA-sintetases, havendo uma dessaspara cada aminoácido. Em uma das alças do tRNA exis-te uma sequência de três bases que são complementaresa um conjunto de igual número de bases no mRNA. Asbases do mRNA denominam-se códon, enquanto as dotRNA, anticódon. Este último é o responsável pelo re-conhecimento do códon correto. O tRNA carregando umaminoácido é denominado aminoacil-tRNA (Fig. 1.9).1.6.4 RNA ribossômicoEsse tipo de RNA, que pode constituir cerca de 80% doRNA total da célula, é sintetizado nos nucléolos, asso-ciando-se a certas proteínas ribossômicas sintetizadas nocitoplasma e transportadas para os nucléolos, para for-mar os ribossomos, nos quais se dá a tradução genética,ou seja, a síntese proteica. Essas organelas celulares sãocompostas de mais de 50 proteínas diferentes e de diver-sas moléculas de rRNA, existindo milhões delas em umacélula viva típica.Os ribossomos são constituídos de duas subunidadesde tamanhos diferentes, produzidas no nucléolo, que es-tão comumente separadas no citoplasma, juntando-se nolocal da síntese proteica. Os tamanhos dessas subunida-des são determinados pelo coeficiente de sedimentação,que é a medida da velocidade com que uma partícula so-fre sedimentação, quando ultracentrifugada, expressa emunidades Svedberg (S). Quanto maior o valor de S, maiorserá a molécula.Os ribossomos dos procariotos consistem em partí-culas de 30 S e 50 S que, quando juntas, comportam-secomo uma partícula de 70 S. Os ribossomos dos euca-riotos são um pouco maiores, a subunidade maior apre-sentando 60 S e a menor, 40 S; quando unidas, compor-tam-se como uma partícula de 80 S (Fig. 1.10). Cercada metade do conteúdo ribossômico é constituído pelorRNA, que contém de 100 a 5 mil nucleotídeos, seu con-teúdo restante sendo proteínas ribossômicas específicas.O rRNA desempenha um papel ativo na função ri-bossômica, pois interage com o tRNA e o mRNA em cadaetapa da tradução, facilitando o reconhecimento entrecódons e anticódons e auxiliando na ligação desses RNAsaos ribossomos.1.6.5 Outros RNAsExistem outros tipos de RNAs, principalmente nos eu-cariotos, que não participam diretamente da tradução,mas têm papéis definidos. Por exemplo, o RNA da te-lomerase é envolvido na replicação do DNA nas extre-midades dos cromossomos, o RNA nuclear pequeno(snRNA) participa do processamento de mRNAs, e oRNA antissenso, o microRNA (miRNA), e o pe-queno RNA interferente (siRNA) estão envolvidosna regulação gênica de eucariotos. Os miRNAs são for-mados por longas moléculas de fita simples de RNA,codificados por mais de 200 genes e podem suprimir atradução; o siRNA resulta da clivagem de longas molécu-las de RNA de fita dupla em fragmentos menores que po-dem induzir a degradação de um mRNA complementar.Mais informações podem ser obtidas em Lewin5e Klug ecolaboradores.41.7 Funções do DNA1.7.1 O DNA tem função autoduplicadoraÉ de fundamental importância que o material genéticoseja capaz de autoduplicação ou autorreplicação, eque esta se dê corretamente a cada divisão celular.Como as fitas polinucleotídicas são unidas apenaspor pontes de hidrogênio, elas são facilmente separáveis.No momento da replicação, essas ligações se rompem ea dupla-hélice abre-se, com o auxílio de enzimas deno-minadas DNA-helicases, liberando seus terminais paraligarem-se a novos nucleotídeos específicos. Cada fitadirige e serve de molde para a síntese de uma nova fita,por complementaridade do pareamento de bases, a partirde nucleotídeos presentes no núcleo da célula. O prin-cípio do pareamento complementar de bases estabeleceque uma base não pareada atraia um nucleotídeo livresomente se ele lhe for complementar. Os nucleotídeossão unidos por ação da enzima DNA-polimerase, sen-do ligados à fita-molde por novas pontes de hidrogênio,com o auxílio de outra enzima, a DNA-ligase. A DNA--polimerase também faz um procedimento de revisãoBorges-Osorio_01.indd 23Borges-Osorio_01.indd 23 29/01/13 13:3529/01/13 13:35
  18. 18. GenéticaHumana24ProcariotosRibossomo70S50S30S30SrRNA5S 23S 16Se 34 proteínas e 21 proteínasEucariotosRibossomo80S60S40S40SrRNA5S 28S 18Se cerca de50 proteínase cerca de33 proteínas5,8SFigura 1.10Representação esquemática dosribossomos de procariotos eeucariotos.códonsanticódonmRNAbraço adicionalbraço do anticódonbraço Dbraço aceitadorbraço T ou T Cextremidade 5’extremidade 3’AMINOÁCIDOG G A U U U U A GA A AGACCCGTCPyA*PuU*PuPyAAG*G PyUPy*Pu*Figura 1.9Representação esquemática do RNA transportador. Asbases identificadas na figura são praticamente inva-riantes. As denominações dos braços D e T referem-seàs bases ␺ (pseudouridina) e D (di-hidrouridina), deri-vadas do uracil.Fonte: Modificada de Lewin.9Borges-Osorio_01.indd 24Borges-Osorio_01.indd 24 29/01/13 13:3529/01/13 13:35
  19. 19. 25AsBasesMolecularesdaHereditariedadede leitura, no qual um nucleotídeo recém-adicionado éconferido para que haja certeza de sua complementarida-de à base da fita-molde. Caso negativo, esse nucleotídeoé removido e substituído pelo nucleotídeo complementarcorreto. Tal procedimento reforça a precisão da replica-ção do DNA. No caso de não haver esse reparo, caracteri-za-se uma mutação.A duplicação do DNA é passível de se iniciar, aomesmo tempo, em vários pontos da fita, podendo ser uniou bidirecional. O ponto no qual ela se origina é denomi-nado forquilha de replicação, origem de replica-ção ou ponto de crescimento. O primeiro passo nareplicação do DNA ocorre quando uma helicase rompeas pontes de hidrogênio, mantendo junto um par de ba-ses, em um sítio de iniciação. Outra enzima, conheci-da como primase, atrai nucleotídeos de RNA comple-mentares para formar uma pequena sequência de RNAdenominada iniciador de RNA, desencadeador ouprimer, no início de cada segmento de DNA a ser du-plicado. Esse iniciador de RNA é necessário, pois o DNAnão pode iniciar uma nova fita de ácido nucleico por sipróprio. O iniciador de RNA atrai a DNA-polimerase,que então reúne os nucleotídeos complementares às ba-ses da fita-molde de DNA. A nova fita de DNA começa acrescer, à medida que se formam as ligações de hidrogê-nio entre as bases complementares. O iniciador de RNAé removido enzimaticamente, sendo substituído pelasbases corretas do DNA. As ligações necessárias entre osnucleotídeos da nova fita de DNA são realizadas cataliti-camente pelas ligases.Na forquilha de replicação, cada uma das fitas deDNA serve como molde para a síntese do novo DNA.Antes, nessa região, a dupla-hélice é desenrolada porum sistema enzimático. Como as fitas parentais não sãoparalelas, a replicação do DNA só pode prosseguir con-tinuamente em uma das fitas, na direção 5-3, denomi-nada fita de replicação contínua. Ao longo da fita 3-5, chamada fita de replicação descontínua, o novoDNA se forma por meio de pequenos segmentos de mil a2 mil bases em procariotos e de 200 bases em eucariotos,chamados fragmentos de Okazaki, em homenagem aoseu descobridor. Na fita de replicação descontínua, é ne-cessário um pequeno segmento de RNA como iniciador.Esse iniciador é produzido por uma RNA-polimerase, de-nominada primase. A seguir, uma exonuclease removeo iniciador de RNA, o DNA é inserido nessa lacuna pelaDNA-polimerase I e, finalmente, os segmentos de DNAsão unidos pela DNA-ligase. A enzima responsável pelasíntese de DNA (DNA-polimerase III) é complexa, com-preendendo diversas subunidades.Nos eucariotos, há diferentes enzimas para as fitasde replicação contínua e descontínua. Durante a replica-ção, os erros são eliminados por um complexo mecanis-mo de reparo: a revisão de leitura, em que as bases in-corporadas erroneamente são removidas e substituídaspelas corretas.Na replicação unidirecional, a forquilha de replica-ção parte da origem e prossegue ao longo do DNA. Nabidirecional, formam-se duas forquilhas de replicação eelas partem da origem, uma em direção à outra, até se en-contrarem (Figs. 1.11 e 1.12A). As forquilhas de repli-cação mais próximas entre si estão separadas por cerca de30 a 300 kb e ocorrem em unidades de replicação oureplicons que contêm entre 20 e 80 origens de replica-ção (ou forquilhas de replicação). Assim, a replicação doDNA realiza-se descontinuamente, com posterior uniãopela DNA-ligase entre os pequenos segmentos recém--formados. Os menores segmentos, com no máximo 150nucleotídeos, são os denominados fragmentos de Okazaki(Fig. 1.12B).Vista ao microscópio eletrônico, a região replicadaaparece como um olho ou uma bolha dentro do DNAnão duplicado. À medida que a replicação prossegue, umadeterminada bolha expande-se até encontrar outras bo-lhas, às quais se funde.Completadas as novas ligações, cada uma das molé-culas recém-formadas de DNA tem uma das fitas origi-nais e outra proveniente dos novos nucleotídeos. Por essarazão, a duplicação do DNA é chamada de semiconser-vativa (Fig. 1.13).REPLICAÇÃO UNIDIRECIONALREPLICAÇÃO BIDIRECIONALOlhos de replicação podem ser uni- ou bidirecionaisForquilha de replicaçãoDNAparentalDNA replicadoForquilha de replicaçãoForquilha de replicaçãoORIGEMORIGEMFigura 1.11Replicação do DNA. A – Forquilha de replicaçãoou ponto crescente: ponto de origem da repli-cação do DNA. B – A replicação pode ser uni oubidirecional, segundo se formem, na origem, umaou duas forquilhas de replicação.Fonte: Lewin.5Borges-Osorio_01.indd 25Borges-Osorio_01.indd 25 29/01/13 13:3529/01/13 13:35
  20. 20. GenéticaHumana26primer deRNADNA--helicaseDNA DNA--polimeraseDNA-ligaseolho oubolhadereplicaçãomoldedo DNAparentaldesenrolamentoinicial do DNA emvários pontos deorigem e síntesedos primers deRNAo DNAsubstitui osprimersde RNAextensãodos primersduas moléculas-filhasde DNA3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’3’5’5’3’5’3’5’fragmentosde Okazakiunidos pelaDNA-ligase3’ 5’ 3’ 5’ 3’ABFigura 1.12A – Etapas da replicação do DNA. As fitas parentais são mostradas em laranja-escuro paradistingui-las do novo DNA replicado, apresentado em laranja-claro. A replicação começa como desenrolamento da dupla-hélice, em vários pontos de origem, e a síntese dos iniciadores deRNA. A DNA-polimerase estende esses iniciadores, que são substituídos depois pelo DNA e aspequenas sequências replicadas são unidas pela DNA-ligase. B – Replicação do DNA mostrandoos fragmentos de Okazaki, que posteriormente são unidos pela DNA-ligase.Fonte: Lewis.3Borges-Osorio_01.indd 26Borges-Osorio_01.indd 26 29/01/13 13:3529/01/13 13:35
  21. 21. 27AsBasesMolecularesdaHereditariedadeEm geral, a replicação inicia-se em diferentes mo-mentos da fase S da interfase do ciclo celular, até quetodo o DNA se duplique, formando duas moléculas-filhascompletas. Ao fim dessa replicação é que tem início adivisão celular. É a autoduplicação que garante a trans-missão do material genético de uma célula para as suasdescendentes.1.7.2 DNA comanda a síntese de proteínasO DNA também é responsável pela síntese das proteínasnecessárias ao funcionamento celular. Essas proteínassão formadas por sequências de aminoácidos, e suascaracterísticas funcionais variam de acordo com o nú-mero e a posição desses aminoácidos em sua molécula.Existem proteínas estruturais (que conferem a forma aoorganismo, pois constroem as paredes celulares, mem-branas nucleares, conteúdo citoplasmático e organelas),enzimas (proteínas especializadas na catálise de reaçõesbiológicas, com extraordinária especificidade; estão en-volvidas nas atividades metabólicas celulares, controlan-do toda a fisiologia do organismo), anticorpos (proteínasresponsáveis pela defesa do organismo, eliminando es-truturas proteicas estranhas e desempenhando um papelimportante nas infecções e nos transplantes) e hormô-nios (proteínas formadas em órgãos específicos e trans-portadas pelo sangue para outras regiões do organismo,com a finalidade de regular o seu funcionamento nor-mal). Os aminoácidos possuem a composição químicabásica mostrada na Figura 1.14, em que –COOH é umgrupo ácido carboxílico e –NH2 é o grupo amino, básico.A diferença entre um aminoácido e outro está no radical(R) que se liga a esses grupos. Dois aminoácidos unem--se pelas ligações peptídicas, formadas pela reação de umgrupo amino de um aminoácido com o grupo carboxilado aminoácido seguinte.As sequências da proteína são convencionalmenteescritas na ordem do aminoácido com o grupo NH2 livre(N terminal), correspondendo à extremidade 5 da fita domRNA, para o aminoácido com o grupo COOH livre (Cterminal), correspondendo à extremidade 3 do mRNA.molécula originalmoléculas-filhas daprimeira geraçãomoléculas-filhas dasegunda geraçãoFigura 1.13Replicação semiconservativa doDNA. Cada uma das fitas de DNA éusada como molde para a formaçãode uma nova fita complementar; as-sim, cada molécula recém-formadade DNA conserva uma das fitas ori-ginais, unida a outra proveniente dosnovos nucleotídeos.Borges-Osorio_01.indd 27Borges-Osorio_01.indd 27 29/01/13 13:3529/01/13 13:35
  22. 22. GenéticaHumana28A Figura 1.15 mostra os quatro níveis estruturaisde uma proteína. A sequência de aminoácidos que formauma cadeia polipeptídica constitui a estrutura primária daproteína. A estrutura secundária é produzida por dobra-mentos da sequência primária, devido a ligações químicasentre aminoácidos muito próximos entre si, criando sítiosativos ou aspecto estrutural. Essa estrutura secundáriaconfere organização espacial ao esqueleto polipeptídico,dando funcionalidade à molécula. A estrutura terciáriaé a organização completa em três dimensões de todos osátomos na cadeia polipeptídica, em decorrência da intera-ção entre os aminoácidos e a água circulante, incluindo osgrupos laterais, bem como o esqueleto polipeptídico. Umgrau mais alto de organização é encontrado nas proteínasmultiméricas, formadas por agregados de mais de uma ca-deia polipeptídica. A conformação assumida pela proteínamultimérica é sua estrutura quaternária.A hemoglobina, por exemplo, uma proteína carrea-dora de oxigênio situada nas hemácias, apresenta quatrocadeias polipeptídicas; a ferritina, uma proteína do fíga-do, tem 20 polipeptídeos idênticos, com 200 aminoácidoscada um; em compensação, a mioglobina, uma proteínamuscular, apresenta uma única cadeia polipeptídica.1.7.2.1 Síntese proteicaA síntese proteica se dá em duas fases: transcrição etradução.C+H3NNH-CH-CO-NH-CH-COCOOHC+H3N COOHComuns a todos os␣-aminoácidos das proteínasGrupoaminoGrupocarboxila␣C COOHC COOHGrupocarboxila␣␣GrupoaminoA cadeialateral é distintapara cadaaminoácido.O carbono ␣encontra-seentre os gruposcarboxila e aminoAs cadeias lateraisdeterminam as propriedadesdas proteínasRR RHAminoácido livreAminoácidos combinadosem ligações peptídicasABFigura 1.14Características estruturais dos ami-noácidos. A – Aminoácido livre.B – Aminoácidos combinados emligações peptídicas.Fonte: Champe e colaboradores.10CN CHHCN CHCH3OHNHCOCOCNCNHHCOCCNH OCCOOHNCCNHNHRCRC RC REstruturaquaternária4Estruturaterciária32 EstruturasecundáriaEstruturaprimária1HFigura 1.15Os quatro níveis estruturais de umaproteína.Fonte: Champe e colaboradores.10Borges-Osorio_01.indd 28Borges-Osorio_01.indd 28 29/01/13 13:3529/01/13 13:35
  23. 23. 29AsBasesMolecularesdaHereditariedadeTranscrição direta: DNA → RNA – A transcrição éo processo pelo qual a informação genética é transmitidado DNA para o RNA.Para formar uma fita simples de RNA, a fita dupla deDNA abre-se no sentido longitudinal pela quebra das pon-tes de hidrogênio, deixando livres os terminais das bases.Os nucleotídeos do RNA pareiam-se com os do DNA, obe-decendo à mesma especificidade no pareamento das bases:Bases do DNA Bases do RNAG (guanina) C (citosina)C (citosina) G (guanina)T (timina) A (adenina)A (adenina) U (uracil)Essa nova fita que se forma usando uma das fitas doDNA como molde é o RNA, idêntico em sequência (excetopor ter uracil no lugar de timina) a uma das fitas do DNA,que se denomina fita codificadora, fita-sentido oufita com sentido, e é complementar à outra fita doDNA, a fita-molde ou fita antissentido, que fornece omolde para sua síntese. A Figura 1.16 mostra a relaçãoentre o DNA de fita dupla e o RNA de fita simples.Em procariotos, existe uma só RNA-polimerase(enzima que catalisa a síntese do RNA), mas em eucario-tos existem pelo menos três tipos: (a) RNA-polimeraseI, que transcreve os RNAs ribossômicos; (b) RNA-po-limerase II, que transcreve o RNA mensageiro e partedos pequenos RNAs nucleares; e (c) RNA-polimeraseIII, que transcreve o RNA transportador e alguns RNAsribossômicos e outros pequenos RNAs nucleares.A estrutura de um gene humano hipotético é mostra-da na Figura 1.17, na qual são vistos seus componentestípicos que interessam à transcrição.A transcrição inicia-se quando a enzima RNA-po-limerase II se liga ao promotor, sítio promotor ouregião promotora, que pode se situar a várias cente-TRANSCRIÇÃOFita moldeATGCGCCATGCCAGTTACGTAGATGGATACGCGGTACGGTCAATGCATCTACCTFita codificadoraTranscrito de RNAUACGCGGUACGGUCAAUGCAUCUACCUA sequência de RNA écomplementar à fita moldee idêntica à fita codificadoraUma fita do DNA é transcrita em RNA5Ј3Ј5Ј==Figura 1.16Relação entre o DNA defita dupla e o RNA de fitasimples. A função da RNA--polimerase é copiar umafita dupla de DNA em RNA.Fonte: Lewin.5boxeGC TATA boxéxon 1 éxon 2íntron 1 íntron 2éxon 33’Códon iniciador da transcrição Códon finalizador da transcriçãoboxeCAT5’ regiãoflanquea-dora regiãopromotorainício datraduçãofinalização datraduçãosinal para apoliadenilaçãodo mRNAregiãoflanquea-doraFigura 1.17Representação esquemática de um gene estrutural humano típico, mostrando a região flanqueadora an-tecedente – que constitui o sítio ou a região promotora da transcrição do gene –, o códon de iniciação ouiniciador da transcrição, os éxons e os íntrons, o códon de finalização ou finalizador, e a região flanquea-dora subsequente, com o sinal para a poliadenilação do RNA mensageiro (mRNA).Borges-Osorio_01.indd 29Borges-Osorio_01.indd 29 29/01/13 13:3529/01/13 13:35
  24. 24. GenéticaHumana30nas de pares de bases do local de início da transcrição.Já foram identificadas diversas sequências específicas dopromotor (denominadas boxes), sendo as seguintes asmais comuns: GC, TATA e CAAT. O promotor circunda oprimeiro par de bases que é transcrito em RNA, o códoniniciador, e a RNA-polimerase II move-se ao longo dafita-molde até atingir um códon finalizador. O produtoimediato da transcrição é denominado transcrito pri-mário, RNA primário, RNA heterogêneo nuclearou pré-mRNA, consistindo em um RNA que se estendedo códon iniciador ao códon finalizador, na direção 5-3. Entretanto, esse transcrito primário é quase sempreinstável: em procariotos, é rapidamente modificado emmRNA ou clivado em produtos maduros (rRNA e tRNA);em eucariotos, sofre várias modificações em suas extre-midades, dando origem ao mRNA.A transcrição é o primeiro estágio na expressão gêni-ca, sendo controlada por proteínas reguladoras que de-terminam se um gene específico está disponível para sertranscrito pela RNA-polimerase. O primeiro passo na re-gulação é o da decisão sobre transcrever ou não um gene.Durante a transcrição, distinguem-se as seguintesetapas:1. Reconhecimento do molde: começa com a liga-ção da RNA-polimerase II ao sítio promotor do gene.Nesse local, a dupla-hélice do DNA se desenrola e sesepara para constituir o molde, criando-se a bolha detranscrição.2. Início: nessa etapa, são sintetizadas e liberadas asprimeiras sequências, com dois a nove nucleotídeos,terminando quando a enzima se libera do promotor ea fita ultrapassa o comprimento mencionado; o pro-motor é caracterizado por uma sequência de DNAnecessária para que a RNA-polimerase II se ligue aomolde e realize a reação de início. Essa fase tambémé conhecida como iniciação.3. Alongamento: à medida que se move ao longo doDNA, a RNA-polimerase II alonga a fita de RNA;essa enzima desenrola a dupla-hélice de DNA, ex-pondo um novo segmento da fita-molde, com o qualpareiam os nucleotídeos da fita de RNA em cresci-mento e, atrás dessa região desenrolada, a fita-moldede DNA pareia com sua fita complementar, para res-tabelecer a dupla-hélice. Finalmente, o RNA emergecomo uma fita simples livre.4. Finalização ou terminação: consiste no reco-nhecimento do ponto a partir do qual nenhumabase mais é adicionada à fita de RNA. Quando a úl-tima base lhe é adicionada, tanto a RNA-polimeraseII quanto a fita de RNA são liberadas, esta últimapassando a se chamar RNA heterogêneo nuclear oupré-mRNA. A Figura 1.18 mostra a transcrição doRNA a partir do DNA.Antes de sair do núcleo como mRNA, o pré-mRNAsofre várias modificações, conjuntamente denominadasprocessamento pós-transcricional. A primeira de-las é o encadeamento (splicing) ou recomposiçãodo mRNA, que consiste na remoção de todos os íntronsdo pré-mRNA e junção dos éxons não contíguos, forman-do, ao fim dessa etapa, uma molécula de mRNA muitomenor, funcional, com uma sequência codificadora inin-terrupta composta só de éxons, que sai do núcleo pelosporos da membrana nuclear e se localiza junto aos ribos-somos, no citoplasma.Os íntrons podem ser classificados em diversos gru-pos, de acordo com os mecanismos de encadeamento. Osíntrons do grupo I, que fazem parte do transcrito primá-rio dos RNAs ribossômicos, não precisam de componentesadicionais para sua excisão, pois são dotados de autoexci-são. Os íntrons do grupo II, que fazem parte dos transcritosprimários dos mRNA e tRNA produzidos nas mitocôndrias,também são dotados de autoexcisão. Os íntrons do grupoIII, que fazem parte do transcrito primário do mRNA pro-veniente do núcleo, são maiores dos que os dos grupos an-teriores e são mais abundantes; sua remoção necessita deum mecanismo muito mais complexo, a seguir descrito.Como a célula reconhece os íntrons que devem serremovidos? Ainda que nos diferentes organismos existamvários tipos de encadeamento ou splicing, nos eucariotossuperiores os íntrons apresentam pequenas sequências denucleotídeos iguais ou muito semelhantes, situadas nassuas extremidades ou próximas a elas, denominadas pe-quenas sequências de consenso (assim chamadas por-que são comuns a todos os genes eucariotos), que atuamcomo sinal para a sua remoção. As extremidades dos ín-trons consistem em um sítio de splicing 5 (ou sequên-cia doadora), formado pelo dinucleotídeo GU (tambémrepresentado por GT, no DNA) e um sítio de splicing3 (ou sequência aceptora), formado pelo dinucleotídeoAG. A presença constante desses nucleotídeos nas duasprimeiras posições (GU no RNA, GT no DNA) e nas duasúltimas (AG em ambos) dos íntrons dos genes nuclearesé denominada regra GU-AG (originalmente chamadaregra GT-AG). Essas e outras sequências de consenso dosíntrons atraem moléculas específicas, que formam umcomplexo molecular essencial, denominado encadeosso-mo (ou spliceossomo). O encadeossomo contém cincopequenas ribonucleoproteínas nucleares (snRNPs, do in-glês small nuclear ribonucleoproteins, snurps), 70 fatoresde encadeamento necessários à montagem do complexo ecerca de 70 proteínas associadas, parte delas com ativida-des em outros estágios da expressão gênica.A função dos snRNPs é aproximar as duas extre-midades de um íntron, para removê-lo. Essa remoção émostrada na Figura 1.19 e ocorre da seguinte maneira:(a) em cada íntron, um grupo de snurps liga-se ao RNA ecorta o íntron na sua extremidade 5 (sequência doadora5), separando o éxon da esquerda (éxon 1) e o conjun-to íntron-éxon da direita (íntron-éxon 2); (b) o éxon 1mostra-se como uma molécula linear e o conjunto íntron--éxon 2 toma a forma de um laço ou alça; para tanto, umabase específica (adenina) situada no interior do íntron,na sequência denominada sítio ou ponto de ramifica-ção, une-se à extremidade 5 gerada pelo corte no íntron,Borges-Osorio_01.indd 30Borges-Osorio_01.indd 30 29/01/13 13:3529/01/13 13:35
  25. 25. 31AsBasesMolecularesdaHereditariedadedando a este último a forma de laço ou alça; (c) a extre-midade 3 do éxon 1 reage com a extremidade 5 do éxon2, cortando o íntron em sua extremidade 3 e liberandoesse íntron em forma de laço ou alça, ao mesmo tempoligando ambos os éxons; o laço é desfeito, dando origem aum íntron linear excisado, que é rapidamente degradado.O encadeamento assim descrito representa umadas formas de regulação potencial da expressão gênicaem eucariotos. Por exemplo, há outros casos em que oséxons derivados do mesmo gene são encadeados de ma-neiras diferentes, resultando em mRNAs com diferenteséxons. Esse tipo de encadeamento alternativo pro-duz mRNAs semelhantes, mas não idênticos, que apósa tradução resultam em proteínas relacionadas, chama-das isoformas. O encadeamento alternativo é abordadotambém na seção 1.8.2.3.Outra forma de processamento pós-transcricional doRNA é a chamada edição do RNA, em que a sequêncianucleotídica de um pré-mRNA é mudada antes da tra-dução, resultando um mRNA maduro com sequênciasdiferentes das sequências codificadas nos éxons do DNAdo qual esse RNA foi transcrito. A edição pode dar-se porsubstituição ou por deleção/inserção de nucleotídeos, aprimeira sendo mais encontrada entre os eucariotos. Umexemplo observado em humanos é o da apolipoproteínaB (apo B), que existe em uma forma longa e outra cur-ta, codificadas pelo mesmo gene. Em células intestinaishumanas, o mRNA da apo B é editado com uma simplestroca de C para U, convertendo um códon CAA (de gluta-mina) em um códon UAA (de finalização) e terminando opolipeptídeo com aproximadamente a metade do compri-mento codificado no genoma.As outras modificações que ocorrem no mRNA antesde sair do núcleo são o capping, na sua extremidade 5,e a poliadenilação na sua extremidade 3, já descritas.A Figura 1.18 mostra esquematicamente o processamentopós-transcricional do mRNA. A molécula desse ácido nu-cleico leva o código do DNA (a mensagem) até os ribosso-mos, no citoplasma.Transcrição reversa: RNA → DNA – Inicialmente,acreditava-se que a informação genética era transcritaapenas do DNA para o RNA e, então, traduzida em pro-teína. Entretanto, a partir do estudo de certos vírus cujomaterial genético é o RNA, denominados retrovírus,existem evidências de que estes últimos são capazes dereverter o fluxo no processo normal de informação doDNA para o RNA. Tal processo é feito graças à enzimatranscriptase reversa, que é capaz de sintetizar umafita dupla de DNA, copiando o RNA do cromossomo vi-ral. O DNA é chamado de provírus e incorporado aoDNA do hospedeiro, durante o ciclo vital do vírus. Esseprocesso é referido como transcrição reversa ousíntese de DNA dirigida pelo RNA. A homologiaentre sequências de oncogenes humanos e retrovirais(ver Cap. 12) poderia representar uma evidência dessemecanismo e constituir uma importante abordagem te-rapêutica no tratamento das doenças hereditárias emhumanos (ver Cap. 17).RNA--polimeraseSítiopromotorSequência--líder (emalguns genes)Códon iniciador(start of the gene)Sequência gênicaA. InícioB. AlongamentoC. Finalização ou terminaçãoRNAT TTC CCCCUCCUGGGGGGGAAAA3RNAFita-molde de DNARNA-polimeraseSentido datranscriçãoNucleotídeosdo RNACódon finalizadorGFigura 1.18Etapas da transcrição do RNA a partir do DNA. A – A RNA-polimerase liga-se à sequência de DNA em umsítio promotor. B – A RNA-polimerase adiciona nucleotídeos à fita de RNA em crescimento, à medida queo DNA se desenrola. C – A transcrição cessa e a nova molécula de RNA é separada de seu molde.Fonte: Lewis.2Borges-Osorio_01.indd 31Borges-Osorio_01.indd 31 29/01/13 13:3529/01/13 13:35
  26. 26. GenéticaHumana32A Figura 1.20 mostra a concepção atual dos papéisda replicação, transcrição e tradução do DNA no dogmada genética molecular.1.7.2.2 Tradução: mRNA → cadeia polipeptídicaA tradução é o segundo evento na síntese proteica, con-sistindo na transmissão da informação genética do mRNApara um polipeptídeo. A Figura 1.21 ilustra esquemati-camente esse processo, do qual participam muitos com-ponentes celulares: mRNA, tRNA, ribossomos (rRNA +proteínas), aminoácidos, moléculas de armazenamentode energia (ATP) e vários fatores proteicos. As etapas datradução podem ser resumidas do seguinte modo:1. Início: O mRNA leva a mensagem copiada do DNAaté os ribossomos, organelas citoplasmáticas situa-das nas paredes do retículo endoplasmático e localda síntese proteica. Uma curta sequência de basesno início de cada mRNA, denominada sequência--líder, habilita-o a ligar-se às pequenas subunidadesdos ribossomos por meio de pontes de hidrogênio. Oprimeiro códon do mRNA a especificar um aminoáci-do é AUG, que atrai um tRNA iniciador, o qual trans-sítio 5’ doador da emendaU1 snRNPéxon 1U2 snRNP sítio 3’ aceptor da emendasítio de ramificaçãoéxon 25’ 3’AAíntronGU AGU4/U6 snRNPU5 snRNPU4/U6 snRNPU5 snRNP5’ 3’A5’ 3’laço3’OH3’OHAéxon 1 éxon 25’ 3’parte do transcritoprimárioFormação de laço eclivagem do sítio 5’doador da emendaClivagem do sítio 3’ aceptor daemenda e união das duassequências de éxonsequência do íntron cortadana forma do laço(será degradada no núcleo)parte domRNAFigura 1.19Encadeamento, recom-posição ou splicing domRNA, que consiste na re-moção de todos os íntronsdo pré-mRNA e junção doséxons não contíguos. GU eAG, sequências de consen-so; snRNP, pequena ribo-nucleoproteína nuclear; A,adenina.Fonte: Modificada de Alberts ecolaboradores.7Borges-Osorio_01.indd 32Borges-Osorio_01.indd 32 29/01/13 13:3529/01/13 13:35
  27. 27. 33AsBasesMolecularesdaHereditariedadeporta o aminoácido metionina (met). Esse aminoáci-do, portanto, é o início da cadeia polipeptídica, sendogeralmente removido antes do término de sua sínte-se. A pequena subunidade do ribossomo, o mRNAa ela ligado e o tRNA iniciador com seu aminoácido(nos procariotos, N-formilmetionina, f-met; nos eu-cariotos, metionina ou met), auxiliados por fatoresproteicos de iniciação que reforçam a ligação desseselementos, formam o complexo de iniciação.Para que se incorporem à cadeia polipeptídica emformação, os aminoácidos devem ser primeiramente ati-vados, reagindo com moléculas de ATP. Cada aminoácidoassim ativado liga-se, então, a uma extremidade do tRNAespecífico, que é identificado pelo seu anticódon. Esteúltimo faz um pareamento complementar de bases comum códon adequado do mRNA. Assim, o mRNA especi-fica a sequência de aminoácidos, atuando por intermédiodo tRNA.2. Alongamento: Resumidamente, essa etapa pode-ria ser descrita em três passos: reconhecimento docódon, ligação peptídica ao aminoácido adjacente emovimentação do ribossomo na direção 3 do mRNA.Os tRNAs transportam os aminoácidos ativados atéo complexo de iniciação (ao qual se liga a grande subu-nidade do ribossomo). O tRNA que transporta o segundoaminoácido forma pontes de hidrogênio entre seu an-ticódon e o segundo códon do mRNA. A seguir, os doisprimeiros aminoácidos estabelecem ligações peptídicasentre eles, com o auxílio de uma ribozima. A parte doribossomo que mantém juntos o mRNA e o tRNA temdois sítios: o sítio P (de peptidil) mantém a cadeia poli-peptídica crescente e o sítio A (de aminoacil) mantém opróximo aminoácido a ser adicionado à cadeia. Na Figura1.21, met ocupa o sítio P e gly, o sítio A. Os ribossomos,por intermédio do rRNA, mantêm o controle da sínte-se, de tal forma que os aminoácidos sejam reunidos namesma ordem dos códons do RNA, transcritos do DNA.Assim, a pequena subunidade ribossômica está associadaao mRNA, e a grande subunidade, à cadeia polipeptídicarecém-iniciada. Nesse momento, o primeiro tRNA é libe-rado para buscar outra metionina, que poderá ser utili-zada ou não na cadeia polipeptídica. Durante a formaçãoda cadeia polipeptídica, os ribossomos, com o auxílio defatores de alongamento, movem-se ao longo do mRNA,traduzindo cada um dos códons. À medida que vão sendoliberados pelos ribossomos, os tRNAs podem ser reutili-zados no transporte de outros aminoácidos que lhes sãoespecíficos. E assim se processam os demais passos doalongamento da tradução.A tradução continua até que a mensagem seja lidapor inteiro, e o término da síntese se dá quando é encon-trado um dos códons finalizadores (UAG, UAA ou UGA)no mRNA.3. Finalização ou terminação: Assim que um có-don de finalização é alcançado, há fatores de libe-ração dependentes de GTP que auxiliam a cadeiapolipeptídica recém-formada a se desligar do ribos-somo, que se dissocia em suas subunidades. A cadeiapolipeptídica é utilizada na célula ou secretada. Seum códon de finalização surgir no meio de uma mo-lécula de mRNA em virtude de uma mutação, ocor-rerá o mesmo processo, e a cadeia polipeptídica seráterminada prematuramente.Durante a tradução, depois que um ribossomo per-correu certo trecho ao longo do mRNA, um segundo ri-bossomo pode se ligar ao primeiro, o que é possível ocor-rer em um espaço de cerca de 70 a 90 nucleotídeos entreos ribossomos. Assim, uma molécula de mRNA de 450nucleotídeos, como, por exemplo, um polipeptídeo da he-moglobina, pode ter cinco ou seis ribossomos unidos si-multaneamente durante a tradução, cada um sintetizandoum polipeptídeo separado. Esses grupos de ribossomossão denominados de polirribossomos ou polissomos.Nos eucariotos, a tradução é mais complexa: ocor-re em ribossomos maiores, com rRNA e proteínas maiscomplexas, e no citoplasma, separadamente da trans-crição, que ocorre no núcleo. Essa separação proporcio-na múltiplas ocasiões de regulação da expressão gênicanas células eucarióticas. Por ter cap na extremidade 5,o mRNA é traduzido de maneira eficiente. Além disso, amaioria dos mRNAs eucarióticos contém uma sequênciacurta de reconhecimento em torno do códon de inícioAUG, diferente da que se encontra na tradução em pro-cariotos (AGGAGG, antecedente ao códon iniciador AUGDNARNAProteínaReplicaçãoReplicaçãoTranscriçãoreversaTranscriçãoTraduçãoFigura 1.20Concepção atual dos papéis da replicação, trans-crição e tradução do DNA, no dogma central dagenética molecular. A replicação é responsávelpela herança da informação genética; a trans-crição e a tradução são responsáveis pela suaconversão em proteína. A transcrição do DNA emRNA pode ser reversível, mas a tradução do RNAem proteína é irreversível.Fonte: Lewin.5Borges-Osorio_01.indd 33Borges-Osorio_01.indd 33 29/01/13 13:3529/01/13 13:35

×