Recomendados
Mais conteúdo relacionado
Semelhante a Church nhgri 2012
Semelhante a Church nhgri 2012 (20)
Mais de Deanna Church
Mais de Deanna Church (16)
Último
Último (20)
Church nhgri 2012
- 1. The Evolution of Genome Data Deanna M. Church, NCBI @deannachurch
- 2. Collins FS et al, 1998 Throughput: 500 Mb/year Cost: < $0.25 per base Variation: 100,000 SNPs mapped
- 3. ClinVar 140,000 2,500,000 GTR Twenty Two Years of Growth: Genome Remapping Service PubMed Health CloneDB 120,000 NCBI Data and User Services Public Access Genome Decoration Page Influenza Seqs. GenBank Base Pairs GenSAT 2,000,000 Users (Average) GeneTests PubChem Peptidome 100,000 Trace Archive BioSystems CCDS Flu H1N1 Cancer Chromosomes Environmental Samples Discovery Initiative 1,500,000 Base Pairs (Millions) 80,000 PubMed Central Entrez Genes Entrez Sensors Users/Weekday BLINK Mouse Composite Primer BLAST MapViewer Genome GEO Gnomon Seq Read Archive GeneRIFs UniSTS WGS RefSeqGene 60,000 HLA Haplotypes Human Genome Human Genome-TPA Genome Reference LinkOut Consortium 1,000,000 dbMHC dbVar PubMed LocusLink Epigenomics BookShelf PSI-BLAST RefSeq MyNCBI BankIt Human Genome- VAST dbSNP 1000 Genomes 40,000 Genomes Transcripts Alignments ePCR Project Taxonomy Microbial Genomes Genome-Wide PHI-BLAST Association Studies 3D Structure OMIM CGAP dbGap 500,000 Network Entrez GeneMap Entrez Portal 20,000 Cn3D WWW GenBank UniGene dbSTS Entrez at NCBI BLAST dbEST 0 0 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011
- 4. Steve Sherry, NCBI 60 Millions NCBI dbSNP database growth of rs-ids human variations 50 40 30 20 Non-redundant STR & Indel 10 SNP annotations Ambiguous mapping 1999 2000 2005 2011 2010 Millions Submissions of submissions 25 by project 50 75 100 1000 Genomes 125 Other projects HapMap 150 TSC dbSNP build 135. November 2011 175
- 5. Kidd et al, 2007 APOBEC cluster BLACK: Deletion White: Insertion
- 8. Church et al., 2011 PLoS http://genomereference.org
- 9. GRC Beginnings Distributed data Old Assembly Model Genome not in INSDC Database
- 10. Build sequence contigs based on contigs defined in TPF. Check for orientation consistencies Select switch points Instantiate sequence for further analysis Switch point Consensus sequence
- 14. Community Input
- 15. Distributed data Centralized Data Old Assembly Model Genome not in INSDC Database
- 16. Large-Scale Variation Complicates Genome Assembly Sequences from haplotype 1 Sequences from haplotype 2 Old Assembly model: compress into a consensus New Assembly model: represent both haplotypes
- 18. UGT2B17 Region NCBI36 NC_000004.10 (chr4) Tiling Path AC079749.5 AC147055.2 AC019173.4 AC021146.7 AC074378.4 AC134921.2 AC140484.1 AC093720.2 TMPRSS11E TMPRSS11E2 GRCh37 NC_000004.11 (chr4) Tiling Path AC079749.5 AC147055.2 AC021146.7 AC074378.4 AC134921.1 AC093720.2 TMPRSS11E GRCh37: NT_167250.1 (UGT2B17 alternate locus) AC019173.4 AC021146.7 AC074378.4 AC226496.2 AC140484.1 TMPRSS11E2 Xue Y et al, 2008
- 19. UGT2B17 MHC MAPT GRCh37 (hg19) 7 alternate haplotypes at the MHC Alternate loci released as: FASTA AGP Alignment to chromosome http://genomereference.org
- 21. Assembly (e.g. GRCh37) PAR Non-nuclear Primary assembly unit Assembly (e.g. MT) ALT ALT ALT Genomic 1 2 3 Region (MHC) Genomic ALT ALT ALT Region 4 5 6 (UGT2B17) Genomic Region ALT ALT (MAPT) 7 8 ALT 9
- 22. Richa Agarwala MHC Alternate locus Alignment to chr6
- 24. Oh No! Not a new version of the human genome! http://genomereference.org
- 26. Assembly (e.g. GRCh37.p5) PAR Non-nuclear Primary assembly unit Assembly (e.g. MT) ALT ALT ALT Genomic 1 2 3 Region (MHC) Genomic ALT ALT ALT Region 4 5 6 (UGT2B17) Genomic Region ALT ALT (MAPT) 7 Genomic 8 Region (ABO) Genomic ALT Region 9 (SMA) Genomic Region (PECAM1) Patches …
- 27. TBC1D3C TBC1D3 TBC1D3H TBC1D3C Myo19 region (17q21)
- 28. 70 Fix PATCHES: Chromosome will update in GRCh38 (adds >1 Mb of novel sequence to the assembly) 71 Novel PATCHES: Additional sequence added (adds >800K of novel sequence to the assembly) Releasing patches quarterly
- 29. Distributed data Centralized Data Old Assembly Model Updated Assembly Model Genome not in INSDC Database Genome in INSDC Database
- 30. Data Archives GenBank Data in a common format Data in a single location (and mirrored) Most quality checked prior to deposition Robust data tracking mechanism (accession.version) Data owned by submitter
- 31. Data tracking ABC14-1065514J1 Date Phase Gaps Length FP565796.1 21-Oct-2009 1 1 FP565796.2 14-Oct-2010 1 0 FP565796.3 07-Nov-2010 3 0
- 32. Mouse chrX: 34,800,000-34,890,000 NC_000086.1 2 4 3 6 5 7 CM001013.1 2
- 33. Mouse chrX: 35,000,000-36,000000 MGSCv3 MGSCv36 X
- 34. What’s in a name? GRCh37 hg19 Zv7 danRer5 MGSCv37 mm8 NCBIM37
- 35. By any other name… chr21:8,913,216-9,246,964
- 36. By any other name… Zv7 chr21:8,913,216-9,246,964 X Mouse Build 36 chrX
- 37. hg19 GRCh37 http://www.ncbi.nlm.nih.gov/genome/assembly
- 39. Assembly (e.g. GRCh37.p5) GCA_000001405.6 /GCF_000001405.17 ALT GCA_000001345.1/ Primary GCA_000001305.1/ 4 GCF_000001345.1 Assembly GCF_000001305.13 ALT GCA_000001355.1/ 5 GCF_000001355.1 Non-nuclear GCA_000006015.1/ ALT GCA_000001365.1/ assembly unit GCF_000006015.1 6 GCF_000001365.2 (e.g. MT) ALT GCA_000001375.1/ 7 GCF_000001375.1 ALT GCA_000001315.1/ 1 GCF_000001315.1 ALT GCA_000001385.1/ 8 GCF_000001385.1 ALT GCA_000001325.1/ 2 GCF_000001325.2 ALT GCA_000001395.1/ 9 GCF_000001395.1 ALT GCA_000001335.1/ 3 GCF_000001335.1 GCA_000005045.5 Patches GCF_000005045.4
- 40. GenBank vs RefSeq Submitter Owned RefSeq Owned Redundancy Non-Redundant Updated rarely Curated INSDC Not INSDC BRCA1 83 genomic records 3 genomic records 31 mRNA records 5 mRNA records 27 protein records 1 RNA record 5 protein records
- 42. RefSeq for Assemblies Typical assembly edits Addition of non-nuclear (e.g. MT) assembly units Removal of contamination Drop unlocalized/unplaced scaffolds Mask contamination that is placed on chromosome
- 44. Understanding relationships between assemblies using alignments First Pass Reciprocal best hit Second Pass Non-reciprocal, duplicative hits
- 46. NCBI36 GRCh37.p5 No second pass alignments in GRCh37.p5 http://www.ncbi.nlm.nih.gov/tools/gbench/
- 47. Genome Data is MORE than just the Genome
- 48. Genome Data is MORE than just the Genome ATGCGTGCAAAATGCAGTGAGT ATGCGTGCAAAATGCAGTGAGT ATGCGTGCAAAATGCAGTGAGT ATGCGTGCAAAATGCAGTGAGT NM_000336.2:c.800C>T
- 49. ATGCGTGCAAAATGCAGTGAGT ATGCGTGCAAAATGCAGTGAGT ATGCGTGCAAAATGCAGTGAGT ATGCGTGCAAAATGCAGTGAGT NM_000336.2:c.800C>T NC_000001.10:g.(?_20700513)_(21062644_?)del
- 51. http://www.youtube.com/NCBINLM @NCBI http://www.facebook.com/ncbi.nlm http://www.ncbi.nlm.nih.gov/education/
- 52. Thanks! The Genome Reference Consortium The Genome Center at Washington University The Wellcome Trust Sanger Institute The European Bioinformatics Institute The National Center for Biotechnology Information Church group at NCBI For Slides: Valerie Schneider Francoise Thibaud-Nissen Nathan Bouk Evan Eichler Hsiu-Chuan Chen Steve Sherry Peter Meric Victor Ananiev Chao Chen John Lopez John Garner Tim Hefferon NCBI Cliff Clausen
Notas do Editor
- Alignments refer to pairs of sequence. Once you know how a pair of sequences go together, you can look at stringing the pairs along into a contig. The contig is essentially the consensus sequence that is produced from the components.To create a contig, we use the steps shown on this slide.What are switch points? As you create the consensus sequence of the contig, the switch points tell you where to stop using the sequence from one component and begin using the sequence from the next.
- Show alignment of a feature from first slide to show how far down the chromosome it has moved…
- Keeping track of people is way easier than keeping track of assemblies.