SlideShare a Scribd company logo

B I O I N F O R M A T I C S An Intro

•Download as PPT, PDF•
•
Dr. Paulsharma Chakravarthy
Dr. Paulsharma Chakravarthy
TechnologyBusiness
1 of 16
Bioinformatics – an Introduction
 
“ Bioinformatics addresses problems related to the storage, retrieval and analysis of information about biological structure, sequence and function. - National Institute of Health Definition
Bioinformatics deals with ,[object Object],[object Object],[object Object]
Bioinformatics and Human Genome Project ,[object Object],[object Object]
Necessary Skill Sets ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Specialized fields ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Applications ,[object Object],[object Object],[object Object],[object Object]
Sequence Analysis and Similarity Searches ,[object Object]
Finding the (protein-coding) gene? CCTGAGCCAACTATTGATGAA P E P T I D E CCU GAG CCA ACU AUU GAU GAA Protein mRNA DNA transcription translation
Pairwise Sequence Alignment
Multiple Sequence Alignment
Pfam analysis
Structure Prediction
Molecular Docking
Thanks You Mail: [email_address] Tel: +91-9884042119

Recommended

Project report-on-bio-informatics
Project report-on-bio-informaticsProject report-on-bio-informatics
Project report-on-bio-informaticsDaniela Rotariu
 
Bioinformatics Applications in Biotechnology
Bioinformatics Applications in BiotechnologyBioinformatics Applications in Biotechnology
Bioinformatics Applications in BiotechnologyUshanandini Mohanraj
 
Bioinformatics Projects And Applications
Bioinformatics Projects And ApplicationsBioinformatics Projects And Applications
Bioinformatics Projects And ApplicationsDr. Paulsharma Chakravarthy
 
Career oppurtunities in the field of Bioinformatics
Career oppurtunities in the field of BioinformaticsCareer oppurtunities in the field of Bioinformatics
Career oppurtunities in the field of BioinformaticsShikha Thakur
 
Recent trends in bioinformatics
Recent trends in bioinformaticsRecent trends in bioinformatics
Recent trends in bioinformaticsZeeshan Hanjra
 
Bioinformatics
BioinformaticsBioinformatics
BioinformaticsAkanshaChauhan15
 
Bioinformatics introduction
Bioinformatics introductionBioinformatics introduction
Bioinformatics introductionHafiz Muhammad Zeeshan Raza
 
Bioinformatics
BioinformaticsBioinformatics
BioinformaticsScitechnol International Publishers
 

Recommended

Project report-on-bio-informatics
Project report-on-bio-informaticsProject report-on-bio-informatics
Project report-on-bio-informaticsDaniela Rotariu
 
Bioinformatics Applications in Biotechnology
Bioinformatics Applications in BiotechnologyBioinformatics Applications in Biotechnology
Bioinformatics Applications in BiotechnologyUshanandini Mohanraj
 
Bioinformatics Projects And Applications
Bioinformatics Projects And ApplicationsBioinformatics Projects And Applications
Bioinformatics Projects And ApplicationsDr. Paulsharma Chakravarthy
 
Career oppurtunities in the field of Bioinformatics
Career oppurtunities in the field of BioinformaticsCareer oppurtunities in the field of Bioinformatics
Career oppurtunities in the field of BioinformaticsShikha Thakur
 
Recent trends in bioinformatics
Recent trends in bioinformaticsRecent trends in bioinformatics
Recent trends in bioinformaticsZeeshan Hanjra
 
Bioinformatics
BioinformaticsBioinformatics
BioinformaticsAkanshaChauhan15
 
Bioinformatics introduction
Bioinformatics introductionBioinformatics introduction
Bioinformatics introductionHafiz Muhammad Zeeshan Raza
 
Bioinformatics
BioinformaticsBioinformatics
BioinformaticsScitechnol International Publishers
 
Bioinformatics Software
Bioinformatics SoftwareBioinformatics Software
Bioinformatics Softwareuniversity of education,Lahore
 
LECTURE NOTES ON BIOINFORMATICS
LECTURE NOTES ON BIOINFORMATICSLECTURE NOTES ON BIOINFORMATICS
LECTURE NOTES ON BIOINFORMATICSMSCW Mysore
 
Data mining ppt
Data mining pptData mining ppt
Data mining pptsai krishna
 
Basics in bioinformatics
Basics in bioinformaticsBasics in bioinformatics
Basics in bioinformaticsMamun Billah
 
Genome Database Systems
Genome Database Systems Genome Database Systems
Genome Database Systems Harindu Chathuranga Korala
 
Basics of Data Analysis in Bioinformatics
Basics of Data Analysis in BioinformaticsBasics of Data Analysis in Bioinformatics
Basics of Data Analysis in BioinformaticsElena Sügis
 
Bioinformatics-General_Intro
Bioinformatics-General_IntroBioinformatics-General_Intro
Bioinformatics-General_IntroAbhiroop Ghatak
 
Bioinformatics
BioinformaticsBioinformatics
BioinformaticsHemantAlhat1
 
Bioinformatics for beginners (exam point of view)
Bioinformatics for beginners (exam point of view)Bioinformatics for beginners (exam point of view)
Bioinformatics for beginners (exam point of view)Sijo A
 
Bioinformatics, application by kk sahu sir
Bioinformatics, application by kk sahu sirBioinformatics, application by kk sahu sir
Bioinformatics, application by kk sahu sirKAUSHAL SAHU
 
Bioinformatic, and tools by kk sahu
Bioinformatic, and tools by kk sahuBioinformatic, and tools by kk sahu
Bioinformatic, and tools by kk sahuKAUSHAL SAHU
 
Biological Database
Biological DatabaseBiological Database
Biological DatabaseSombir Kashyap
 
Bioinformatics ppt
Bioinformatics pptBioinformatics ppt
Bioinformatics pptSai Tharun Kumar Guttikonda
 
GENOMICS
GENOMICSGENOMICS
GENOMICSresgmasheikh
 
Chapter - 8.4 Data Mining Concepts and Techniques 2nd Ed slides Han & Kamber
Chapter - 8.4 Data Mining Concepts and Techniques 2nd Ed slides Han & KamberChapter - 8.4 Data Mining Concepts and Techniques 2nd Ed slides Han & Kamber
Chapter - 8.4 Data Mining Concepts and Techniques 2nd Ed slides Han & Kambererror007
 
Computational biology
Computational biologyComputational biology
Computational biologyZeina Abdelmoez
 
Current Trends & Developments of Bioinformatics
Current Trends & Developments of BioinformaticsCurrent Trends & Developments of Bioinformatics
Current Trends & Developments of BioinformaticsYousif A. Algabri
 
Data Mining
Data Mining Data Mining
Data Mining Neethu Devasia
 
Introduction to bioinformatics
Introduction to bioinformaticsIntroduction to bioinformatics
Introduction to bioinformaticsphilmaweb
 
Uses of Artificial Intelligence in Bioinformatics
Uses of Artificial Intelligence in BioinformaticsUses of Artificial Intelligence in Bioinformatics
Uses of Artificial Intelligence in BioinformaticsPragya Pai
 
TIGR Matrix Synthetic Long Term Resorbable Surgical mesh
TIGR Matrix Synthetic Long Term Resorbable Surgical meshTIGR Matrix Synthetic Long Term Resorbable Surgical mesh
TIGR Matrix Synthetic Long Term Resorbable Surgical meshNovusScientific
 
Approaches to introduce gamification @ ur workplace
Approaches to introduce gamification @ ur workplaceApproaches to introduce gamification @ ur workplace
Approaches to introduce gamification @ ur workplaceDr. Paulsharma Chakravarthy
 

More Related Content

What's hot

LECTURE NOTES ON BIOINFORMATICS
LECTURE NOTES ON BIOINFORMATICSLECTURE NOTES ON BIOINFORMATICS
LECTURE NOTES ON BIOINFORMATICSMSCW Mysore
 
Basics in bioinformatics
Basics in bioinformaticsBasics in bioinformatics
Basics in bioinformaticsMamun Billah
 
Basics of Data Analysis in Bioinformatics
Basics of Data Analysis in BioinformaticsBasics of Data Analysis in Bioinformatics
Basics of Data Analysis in BioinformaticsElena Sügis
 
Bioinformatics-General_Intro
Bioinformatics-General_IntroBioinformatics-General_Intro
Bioinformatics-General_IntroAbhiroop Ghatak
 
Bioinformatics for beginners (exam point of view)
Bioinformatics for beginners (exam point of view)Bioinformatics for beginners (exam point of view)
Bioinformatics for beginners (exam point of view)Sijo A
 
Bioinformatics, application by kk sahu sir
Bioinformatics, application by kk sahu sirBioinformatics, application by kk sahu sir
Bioinformatics, application by kk sahu sirKAUSHAL SAHU
 
Bioinformatic, and tools by kk sahu
Bioinformatic, and tools by kk sahuBioinformatic, and tools by kk sahu
Bioinformatic, and tools by kk sahuKAUSHAL SAHU
 
Chapter - 8.4 Data Mining Concepts and Techniques 2nd Ed slides Han & Kamber
Chapter - 8.4 Data Mining Concepts and Techniques 2nd Ed slides Han & KamberChapter - 8.4 Data Mining Concepts and Techniques 2nd Ed slides Han & Kamber
Chapter - 8.4 Data Mining Concepts and Techniques 2nd Ed slides Han & Kambererror007
 
Current Trends & Developments of Bioinformatics
Current Trends & Developments of BioinformaticsCurrent Trends & Developments of Bioinformatics
Current Trends & Developments of BioinformaticsYousif A. Algabri
 
Introduction to bioinformatics
Introduction to bioinformaticsIntroduction to bioinformatics
Introduction to bioinformaticsphilmaweb
 
Uses of Artificial Intelligence in Bioinformatics
Uses of Artificial Intelligence in BioinformaticsUses of Artificial Intelligence in Bioinformatics
Uses of Artificial Intelligence in BioinformaticsPragya Pai
 

What's hot (20)

Bioinformatics Software
Bioinformatics SoftwareBioinformatics Software
Bioinformatics Software
 
LECTURE NOTES ON BIOINFORMATICS
LECTURE NOTES ON BIOINFORMATICSLECTURE NOTES ON BIOINFORMATICS
LECTURE NOTES ON BIOINFORMATICS
 
Data mining ppt
Data mining pptData mining ppt
Data mining ppt
 
Basics in bioinformatics
Basics in bioinformaticsBasics in bioinformatics
Basics in bioinformatics
 
Genome Database Systems
Genome Database Systems Genome Database Systems
Genome Database Systems
 
Basics of Data Analysis in Bioinformatics
Basics of Data Analysis in BioinformaticsBasics of Data Analysis in Bioinformatics
Basics of Data Analysis in Bioinformatics
 
Bioinformatics-General_Intro
Bioinformatics-General_IntroBioinformatics-General_Intro
Bioinformatics-General_Intro
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
Bioinformatics for beginners (exam point of view)
Bioinformatics for beginners (exam point of view)Bioinformatics for beginners (exam point of view)
Bioinformatics for beginners (exam point of view)
 
Bioinformatics, application by kk sahu sir
Bioinformatics, application by kk sahu sirBioinformatics, application by kk sahu sir
Bioinformatics, application by kk sahu sir
 
Bioinformatic, and tools by kk sahu
Bioinformatic, and tools by kk sahuBioinformatic, and tools by kk sahu
Bioinformatic, and tools by kk sahu
 
Biological Database
Biological DatabaseBiological Database
Biological Database
 
Bioinformatics ppt
Bioinformatics pptBioinformatics ppt
Bioinformatics ppt
 
GENOMICS
GENOMICSGENOMICS
GENOMICS
 
Chapter - 8.4 Data Mining Concepts and Techniques 2nd Ed slides Han & Kamber
Chapter - 8.4 Data Mining Concepts and Techniques 2nd Ed slides Han & KamberChapter - 8.4 Data Mining Concepts and Techniques 2nd Ed slides Han & Kamber
Chapter - 8.4 Data Mining Concepts and Techniques 2nd Ed slides Han & Kamber
 
Computational biology
Computational biologyComputational biology
Computational biology
 
Current Trends & Developments of Bioinformatics
Current Trends & Developments of BioinformaticsCurrent Trends & Developments of Bioinformatics
Current Trends & Developments of Bioinformatics
 
Data Mining
Data Mining Data Mining
Data Mining
 
Introduction to bioinformatics
Introduction to bioinformaticsIntroduction to bioinformatics
Introduction to bioinformatics
 
Uses of Artificial Intelligence in Bioinformatics
Uses of Artificial Intelligence in BioinformaticsUses of Artificial Intelligence in Bioinformatics
Uses of Artificial Intelligence in Bioinformatics
 

Viewers also liked

TIGR Matrix Synthetic Long Term Resorbable Surgical mesh
TIGR Matrix Synthetic Long Term Resorbable Surgical meshTIGR Matrix Synthetic Long Term Resorbable Surgical mesh
TIGR Matrix Synthetic Long Term Resorbable Surgical meshNovusScientific
 
Approaches to introduce gamification @ ur workplace
Approaches to introduce gamification @ ur workplaceApproaches to introduce gamification @ ur workplace
Approaches to introduce gamification @ ur workplaceDr. Paulsharma Chakravarthy
 
Approaches to introduce gamification @ ur workplace
Approaches to introduce gamification @ ur workplaceApproaches to introduce gamification @ ur workplace
Approaches to introduce gamification @ ur workplaceDr. Paulsharma Chakravarthy
 
Biological literature mining - from information retrieval to biological disco...
Biological literature mining - from information retrieval to biological disco...Biological literature mining - from information retrieval to biological disco...
Biological literature mining - from information retrieval to biological disco...Lars Juhl Jensen
 
Biochemistry Bioenergetics
Biochemistry BioenergeticsBiochemistry Bioenergetics
Biochemistry BioenergeticsOlena Rodina
 
Bioenergetics (biochemistry)
Bioenergetics (biochemistry)Bioenergetics (biochemistry)
Bioenergetics (biochemistry)Thonylet Lee
 

Viewers also liked (8)

TIGR Matrix Synthetic Long Term Resorbable Surgical mesh
TIGR Matrix Synthetic Long Term Resorbable Surgical meshTIGR Matrix Synthetic Long Term Resorbable Surgical mesh
TIGR Matrix Synthetic Long Term Resorbable Surgical mesh
 
Approaches to introduce gamification @ ur workplace
Approaches to introduce gamification @ ur workplaceApproaches to introduce gamification @ ur workplace
Approaches to introduce gamification @ ur workplace
 
Approaches to introduce gamification @ ur workplace
Approaches to introduce gamification @ ur workplaceApproaches to introduce gamification @ ur workplace
Approaches to introduce gamification @ ur workplace
 
Databases ii
Databases iiDatabases ii
Databases ii
 
Biological literature mining - from information retrieval to biological disco...
Biological literature mining - from information retrieval to biological disco...Biological literature mining - from information retrieval to biological disco...
Biological literature mining - from information retrieval to biological disco...
 
Data Retrieval Systems
Data Retrieval SystemsData Retrieval Systems
Data Retrieval Systems
 
Biochemistry Bioenergetics
Biochemistry BioenergeticsBiochemistry Bioenergetics
Biochemistry Bioenergetics
 
Bioenergetics (biochemistry)
Bioenergetics (biochemistry)Bioenergetics (biochemistry)
Bioenergetics (biochemistry)
 

Similar to B I O I N F O R M A T I C S An Intro

Introduction to Bioinformatics-1.pdf
Introduction to Bioinformatics-1.pdfIntroduction to Bioinformatics-1.pdf
Introduction to Bioinformatics-1.pdfkigaruantony
 
Bioinformatics
BioinformaticsBioinformatics
BioinformaticsAmna Jalil
 
SooryaKiran Bioinformatics
SooryaKiran BioinformaticsSooryaKiran Bioinformatics
SooryaKiran Bioinformaticscontactsoorya
 
Pcmd bioinformatics-lecture i
Pcmd bioinformatics-lecture iPcmd bioinformatics-lecture i
Pcmd bioinformatics-lecture iMuhammad Younis
 
Informal presentation on bioinformatics
Informal presentation on bioinformaticsInformal presentation on bioinformatics
Informal presentation on bioinformaticsAtai Rabby
 
bioinformatics simple
bioinformatics simple bioinformatics simple
bioinformatics simple nadeem akhter
 
Bioinformatics Introduction and Use of BLAST Tool
Bioinformatics Introduction and Use of BLAST ToolBioinformatics Introduction and Use of BLAST Tool
Bioinformatics Introduction and Use of BLAST ToolJesminBinti
 
introduction of Bioinformatics
introduction of Bioinformaticsintroduction of Bioinformatics
introduction of BioinformaticsVinaKhan1
 
Bioinformatics and functional genomics
Bioinformatics and functional genomicsBioinformatics and functional genomics
Bioinformatics and functional genomicsAisha Kalsoom
 
IRJET- Disease Identification using Proteins Values and Regulatory Modules
IRJET- Disease Identification using Proteins Values and Regulatory ModulesIRJET- Disease Identification using Proteins Values and Regulatory Modules
IRJET- Disease Identification using Proteins Values and Regulatory ModulesIRJET Journal
 
GENOME DATA ANALYSIS
GENOME DATA ANALYSISGENOME DATA ANALYSIS
GENOME DATA ANALYSISAmeldaAkoijam
 
Bioinformatics مي.pdf
Bioinformatics مي.pdfBioinformatics مي.pdf
Bioinformatics مي.pdfnedalalazzwy
 

Similar to B I O I N F O R M A T I C S An Intro (20)

Introduction to Bioinformatics-1.pdf
Introduction to Bioinformatics-1.pdfIntroduction to Bioinformatics-1.pdf
Introduction to Bioinformatics-1.pdf
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
SooryaKiran Bioinformatics
SooryaKiran BioinformaticsSooryaKiran Bioinformatics
SooryaKiran Bioinformatics
 
Pcmd bioinformatics-lecture i
Pcmd bioinformatics-lecture iPcmd bioinformatics-lecture i
Pcmd bioinformatics-lecture i
 
Informal presentation on bioinformatics
Informal presentation on bioinformaticsInformal presentation on bioinformatics
Informal presentation on bioinformatics
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
MoM2010: Bioinformatics
MoM2010: BioinformaticsMoM2010: Bioinformatics
MoM2010: Bioinformatics
 
Bioinformatics .pptx
Bioinformatics .pptxBioinformatics .pptx
Bioinformatics .pptx
 
Bioinformatics.pptx
Bioinformatics.pptxBioinformatics.pptx
Bioinformatics.pptx
 
bioinformatics simple
bioinformatics simple bioinformatics simple
bioinformatics simple
 
Bioinformatics Introduction and Use of BLAST Tool
Bioinformatics Introduction and Use of BLAST ToolBioinformatics Introduction and Use of BLAST Tool
Bioinformatics Introduction and Use of BLAST Tool
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
introduction of Bioinformatics
introduction of Bioinformaticsintroduction of Bioinformatics
introduction of Bioinformatics
 
Bioinformatics and functional genomics
Bioinformatics and functional genomicsBioinformatics and functional genomics
Bioinformatics and functional genomics
 
IRJET- Disease Identification using Proteins Values and Regulatory Modules
IRJET- Disease Identification using Proteins Values and Regulatory ModulesIRJET- Disease Identification using Proteins Values and Regulatory Modules
IRJET- Disease Identification using Proteins Values and Regulatory Modules
 
bioinformatic.pptx
bioinformatic.pptxbioinformatic.pptx
bioinformatic.pptx
 
GENOME DATA ANALYSIS
GENOME DATA ANALYSISGENOME DATA ANALYSIS
GENOME DATA ANALYSIS
 
D1803012022
D1803012022D1803012022
D1803012022
 
Bioinformatics مي.pdf
Bioinformatics مي.pdfBioinformatics مي.pdf
Bioinformatics مي.pdf
 
Bioinformatics principles and applications
Bioinformatics principles and applicationsBioinformatics principles and applications
Bioinformatics principles and applications
 

More from Dr. Paulsharma Chakravarthy

In the beginning, GOD created the heavens and earth...
In the beginning, GOD created the heavens and earth...In the beginning, GOD created the heavens and earth...
In the beginning, GOD created the heavens and earth...Dr. Paulsharma Chakravarthy
 
Title - Identification of Drug Targets from Bacterial Genome
Title - Identification of Drug Targets from Bacterial GenomeTitle - Identification of Drug Targets from Bacterial Genome
Title - Identification of Drug Targets from Bacterial GenomeDr. Paulsharma Chakravarthy
 
Bibliography for the Drug Target Identification from Microbial Genomes
Bibliography for the Drug Target Identification from Microbial GenomesBibliography for the Drug Target Identification from Microbial Genomes
Bibliography for the Drug Target Identification from Microbial GenomesDr. Paulsharma Chakravarthy
 
No. of drug Targets Identified from Various Microbes
No. of drug Targets Identified from Various MicrobesNo. of drug Targets Identified from Various Microbes
No. of drug Targets Identified from Various MicrobesDr. Paulsharma Chakravarthy
 
Summary of the Research Study - Identification of Drug Targets
Summary of the Research Study - Identification of Drug TargetsSummary of the Research Study - Identification of Drug Targets
Summary of the Research Study - Identification of Drug TargetsDr. Paulsharma Chakravarthy
 
Results and Discussion - Identification of Drug Targets from Bacterial Genomoe
Results and Discussion - Identification of Drug Targets from Bacterial GenomoeResults and Discussion - Identification of Drug Targets from Bacterial Genomoe
Results and Discussion - Identification of Drug Targets from Bacterial GenomoeDr. Paulsharma Chakravarthy
 

More from Dr. Paulsharma Chakravarthy (20)

Origins of life
Origins of lifeOrigins of life
Origins of life
 
Linkedin Profile - Biblical Personalities
Linkedin Profile - Biblical PersonalitiesLinkedin Profile - Biblical Personalities
Linkedin Profile - Biblical Personalities
 
Netvidya mobile learning_slideshare
Netvidya mobile learning_slideshareNetvidya mobile learning_slideshare
Netvidya mobile learning_slideshare
 
Mobile Learning in India
Mobile Learning in IndiaMobile Learning in India
Mobile Learning in India
 
How Learning has Changed
How Learning has ChangedHow Learning has Changed
How Learning has Changed
 
In the beginning, GOD created the heavens and earth...
In the beginning, GOD created the heavens and earth...In the beginning, GOD created the heavens and earth...
In the beginning, GOD created the heavens and earth...
 
Research Methodology - Target Discovery
Research Methodology - Target DiscoveryResearch Methodology - Target Discovery
Research Methodology - Target Discovery
 
Title - Identification of Drug Targets from Bacterial Genome
Title - Identification of Drug Targets from Bacterial GenomeTitle - Identification of Drug Targets from Bacterial Genome
Title - Identification of Drug Targets from Bacterial Genome
 
Bibliography for the Drug Target Identification from Microbial Genomes
Bibliography for the Drug Target Identification from Microbial GenomesBibliography for the Drug Target Identification from Microbial Genomes
Bibliography for the Drug Target Identification from Microbial Genomes
 
No. of drug Targets Identified from Various Microbes
No. of drug Targets Identified from Various MicrobesNo. of drug Targets Identified from Various Microbes
No. of drug Targets Identified from Various Microbes
 
Annexure - List of Pathogenic Microbes
Annexure - List of Pathogenic MicrobesAnnexure - List of Pathogenic Microbes
Annexure - List of Pathogenic Microbes
 
Summary of the Research Study - Identification of Drug Targets
Summary of the Research Study - Identification of Drug TargetsSummary of the Research Study - Identification of Drug Targets
Summary of the Research Study - Identification of Drug Targets
 
Scope of Investigation
Scope of InvestigationScope of Investigation
Scope of Investigation
 
Results and Discussion - Identification of Drug Targets from Bacterial Genomoe
Results and Discussion - Identification of Drug Targets from Bacterial GenomoeResults and Discussion - Identification of Drug Targets from Bacterial Genomoe
Results and Discussion - Identification of Drug Targets from Bacterial Genomoe
 
Acknowledgements
AcknowledgementsAcknowledgements
Acknowledgements
 
Literature Review
Literature ReviewLiterature Review
Literature Review
 
Introduction to Drug Target Identification
Introduction to Drug Target IdentificationIntroduction to Drug Target Identification
Introduction to Drug Target Identification
 
Table of Content - Thesis
Table of Content - ThesisTable of Content - Thesis
Table of Content - Thesis
 
Preparing students for_future
Preparing students for_futurePreparing students for_future
Preparing students for_future
 
Bioinformatics and Drug Discovery
Bioinformatics and Drug DiscoveryBioinformatics and Drug Discovery
Bioinformatics and Drug Discovery
 

Recently uploaded

Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024Victor Rentea
 
Vector Search -An Introduction in Oracle Database 23ai.pptx
Vector Search -An Introduction in Oracle Database 23ai.pptxVector Search -An Introduction in Oracle Database 23ai.pptx
Vector Search -An Introduction in Oracle Database 23ai.pptxRemote DBA Services
 
Finding Java's Hidden Performance Traps @ DevoxxUK 2024
Finding Java's Hidden Performance Traps @ DevoxxUK 2024Finding Java's Hidden Performance Traps @ DevoxxUK 2024
Finding Java's Hidden Performance Traps @ DevoxxUK 2024Victor Rentea
 
Artificial Intelligence Chap.5 : Uncertainty
Artificial Intelligence Chap.5 : UncertaintyArtificial Intelligence Chap.5 : Uncertainty
Artificial Intelligence Chap.5 : UncertaintyKhushali Kathiriya
 
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data DiscoveryTrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data DiscoveryTrustArc
 
MS Copilot expands with MS Graph connectors
MS Copilot expands with MS Graph connectorsMS Copilot expands with MS Graph connectors
MS Copilot expands with MS Graph connectorsNanddeep Nachan
 
DEV meet-up UiPath Document Understanding May 7 2024 Amsterdam
DEV meet-up UiPath Document Understanding May 7 2024 AmsterdamDEV meet-up UiPath Document Understanding May 7 2024 Amsterdam
DEV meet-up UiPath Document Understanding May 7 2024 AmsterdamUiPathCommunity
 
Biography Of Angeliki Cooney | Senior Vice President Life Sciences | Albany, ...
Biography Of Angeliki Cooney | Senior Vice President Life Sciences | Albany, ...Biography Of Angeliki Cooney | Senior Vice President Life Sciences | Albany, ...
Biography Of Angeliki Cooney | Senior Vice President Life Sciences | Albany, ...Angeliki Cooney
 
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost SavingRepurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost SavingEdi Saputra
 
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FMECloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FMESafe Software
 
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot TakeoffStrategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoffsammart93
 
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FMECloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FMESafe Software
 
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...DianaGray10
 
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin WoodPolkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin WoodJuan lago vázquez
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerThousandEyes
 
AWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of TerraformAWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of TerraformAndrey Devyatkin
 
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...apidays
 
Exploring Multimodal Embeddings with Milvus
Exploring Multimodal Embeddings with MilvusExploring Multimodal Embeddings with Milvus
Exploring Multimodal Embeddings with MilvusZilliz
 
Mcleodganj Call Girls 🥰 8617370543 Service Offer VIP Hot Model
Mcleodganj Call Girls 🥰 8617370543 Service Offer VIP Hot ModelMcleodganj Call Girls 🥰 8617370543 Service Offer VIP Hot Model
Mcleodganj Call Girls 🥰 8617370543 Service Offer VIP Hot ModelDeepika Singh
 
Architecting Cloud Native Applications
Architecting Cloud Native ApplicationsArchitecting Cloud Native Applications
Architecting Cloud Native ApplicationsWSO2
 

Recently uploaded (20)

Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
 
Vector Search -An Introduction in Oracle Database 23ai.pptx
Vector Search -An Introduction in Oracle Database 23ai.pptxVector Search -An Introduction in Oracle Database 23ai.pptx
Vector Search -An Introduction in Oracle Database 23ai.pptx
 
Finding Java's Hidden Performance Traps @ DevoxxUK 2024
Finding Java's Hidden Performance Traps @ DevoxxUK 2024Finding Java's Hidden Performance Traps @ DevoxxUK 2024
Finding Java's Hidden Performance Traps @ DevoxxUK 2024
 
Artificial Intelligence Chap.5 : Uncertainty
Artificial Intelligence Chap.5 : UncertaintyArtificial Intelligence Chap.5 : Uncertainty
Artificial Intelligence Chap.5 : Uncertainty
 
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data DiscoveryTrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
 
MS Copilot expands with MS Graph connectors
MS Copilot expands with MS Graph connectorsMS Copilot expands with MS Graph connectors
MS Copilot expands with MS Graph connectors
 
DEV meet-up UiPath Document Understanding May 7 2024 Amsterdam
DEV meet-up UiPath Document Understanding May 7 2024 AmsterdamDEV meet-up UiPath Document Understanding May 7 2024 Amsterdam
DEV meet-up UiPath Document Understanding May 7 2024 Amsterdam
 
Biography Of Angeliki Cooney | Senior Vice President Life Sciences | Albany, ...
Biography Of Angeliki Cooney | Senior Vice President Life Sciences | Albany, ...Biography Of Angeliki Cooney | Senior Vice President Life Sciences | Albany, ...
Biography Of Angeliki Cooney | Senior Vice President Life Sciences | Albany, ...
 
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost SavingRepurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
 
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FMECloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
 
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot TakeoffStrategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
 
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FMECloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
 
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
 
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin WoodPolkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected Worker
 
AWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of TerraformAWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of Terraform
 
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...
 
Exploring Multimodal Embeddings with Milvus
Exploring Multimodal Embeddings with MilvusExploring Multimodal Embeddings with Milvus
Exploring Multimodal Embeddings with Milvus
 
Mcleodganj Call Girls 🥰 8617370543 Service Offer VIP Hot Model
Mcleodganj Call Girls 🥰 8617370543 Service Offer VIP Hot ModelMcleodganj Call Girls 🥰 8617370543 Service Offer VIP Hot Model
Mcleodganj Call Girls 🥰 8617370543 Service Offer VIP Hot Model
 
Architecting Cloud Native Applications
Architecting Cloud Native ApplicationsArchitecting Cloud Native Applications
Architecting Cloud Native Applications
 

B I O I N F O R M A T I C S An Intro