SlideShare uma empresa Scribd logo
1 de 29
Center for Clinical Genomics and
Personalized Medicine

2014

Bálint L. Bálint MD, PhD
Head of Laboratory
Center for Clinical Genomics and Personalized Medicine
IVDI Building 3-d floor
http://genomics.med.unideb.hu
Our Team
Our Infrastructure
Biobanking

Microarays

NG-Sequencing

Bioinformatics
Students coming from
Medical Centre service area

1.45 hours
Facts about the University of
Debrecen
 33000

students

 Teaching
 More

in Hungarian and English

than 1500 faculty members

 15

branches

 21

Doctoral Schools

 15%

of Hungarian RnD is located here
Brief overview of the region:
Underdeveloped region with large Regional Developmental Funds
University City with long history
Medical Centre that serves 2 mil people
Pharmapolis Cluster:
TEVA (Biogal)
Richter Gedeon new Pharma Plant for Biological drugs (recombinant proteins and
antibodies)
Cell Therapy Unit (already performing clinical studies)
Stem Cell Research Unit (starts 2010)
RCMM twinning with EMBL
Several EMBO members locally
Personalized Health Care Unit (from 2011)
Well organized Medical Centre open to patients from foreign countries
SAP and ISO implementation at the Medical Centre level
Our vision is to channel the advances in
genomics towards medical research for the
benefit of the patients in the form of
Personalized Medicine
Goals:
 Leader

in the Personalized Medicine in the region

 Implementation

of novel research tools for the benefit
of the patients through clinical research

 Take

the opportunity of the regional grants and use
them to develop tools that can be used on a global
scale

 Taking

care of every spent pence in a very
conservative way
Activities to implement our Goals:
 Activities


in two directions:

Clinical Research





Common projects with clinicians
Infrastructure for clinical research

Regional training


From PCR oligo design through Study design till Data analysis



Global gene expression and functional genomics, Epigenetics

01/22/14

11
Activities in the field of Clinical Research:
 Genomics
 National

Genomics Technological Platform

 Biomarker

discovery and Biobanking



Partners: Pfizer, Astra Zeneca, Richter Gedeon, Biosystems International,
Roche Hungary



Biobanking: COPD, Schizophrenia, Lung cancer, Leukemias
Tools for Biomarker discovery: UPL based miRNA measurement
(Roche Hungary and Astrid Research)



 Epigenetics



Partners: Diagenode Belgium and Millipore USA
Areas: developing of standards for epigenetic studies and protocols for
HTS and clinical research in the field of epigenetics

01/22/14

12
Coordinated from the University of Debrecen:
1. Genomic Research for Human Health Consortium
(GRHH) 2002-2008- FP6 (www.humangenom.hu)
2. National Genomic Technological Platform (NGTP) 2009-2011National Grant

www.genomika.net
Core facility:
 Implementation

of novel technologies require expensive infrastructure

 Expensive

infrastructure can be best used if shared by several
research groups and operated by dedicated staff

 Without

streets

knowledge dissemination core facilities are like dead end
Detailed Infrastructure
 Laboratories
 Biobank

depositories

 Offices
 QPCR

Instruments

 QPCR

assays (hundreds)

 Capillary
 Deep

sequencer (4 chanell ABI)

Sequencing System (Illumina HiScan SQ)

 Pipetting

robots (4)

 Microarray
 DNA/RNA

systems (1)

QC instruments (Agilent Bioanalyzer, Nanodrop, Qubit)
Relevant output

Lifecycles of technologies
Additional
developments

Original
innovation

Distinctive technology / development phase/
time
Both instrument and reagent costs are high
Peak technology / penetretion phase/
Instrument price is high, reagent price is decreasing
Basic technology / spreading phase/
Both instrument and reagent costs are rapidly decreasing
Based on: „Pataki Béla: Technológia menedzsment”
Relevant output

Lifecycles of technologies

Distinctive technology / development phase/
time
Both instrument and reagent costs are high
Peak technology / penetretion phase/
Instrument price is high, reagent price is decreasing
Basic technology / spreading phase/
Both instrument and reagent costs are rapidly decreasing
Based on: „Pataki Béla: Technológia menedzsment”
L ab
RE
CO

Sequencing and
genomics unit

Epigenetic unit
b
D La
Rn

Se

b
e La
rvic

Biobanking unit

Protein and cell
engeneereing unit
b
D La
Rn
Sequencing and genomics unit

Instruments:
•Capillary sequencer
•Affymetrix
•Illumina NGS
•Server system

La b
RE
CO

Wet lab people:
Post docs:

•Beata Scholtz
•Szilárd Póliska

Technicians:

•Sipos Lilla
•Erzsébet Mátyás

Bioinformatics support team:
Endre Barta (leader)
Attila Horvath (system administrator)
Laszlo Steiner (biomathematics and bio statistics)
Gergely Nagy (bioinformatics)
NGS Sequencing
Illumina Sequencing System HiScan SQ-

Szilárd Póliska
Automatic Chromatin IP for maximal
reproducibility

Diagenode IP-Star Magnetic ChIP
Affymetrix Systems
GeneChip® 3000 platform

•

•

Hybridisation Oven

Delivers precise
temperature control
during hybridization

• Fluidics stations
• Washing and staining
of hybridized target
probe complexes

• Scanner
• High resolution
scanner for fast
image acquisition
• Autoloader
including barcode
reader for sample
tracking
Bioinformatics

Endre Barta
NGS software installed on ngsdeb
Programs used for ChIP-seq,
GRO-seq and RNA-seq analysis
•

HOMER

•

SAMTOOLS

•

BOWTIE

•

ChIPSEEQER

•

BEDTOOLS

•

BAMTOOLS

•

TOPHAT

•

TRINITYRNASEQ

•

BWA

•

MEME

•

MACS

•

FASTX-TOOLKIT

•

PICARD

25

Head Node: 2x6 core, 144GB RAM, 20 Tbyte disk
6x computing nodes: 2x6 core, 48GB RAM 600GB
disk
2012.05.16.
ChIP-seq analyze script
•

Aim: To have a simple script that can be used either to analyze local
ChIP-seq sequencing data or to do meta-analysis of ChIP-seq
experiments stored on the NCBI SRA database

•

Command line tool

•

Input: SRA (NCBI reads), fastq (reads), bam (alignments)
•
•
•
•
•
•
•

Downloads SRA format files NCBI
Maps fastq format reads
Peak calling by HOMER and MACS
Peak annotation by HOMER
Known and denovo motif finding by HOMER
GO enrichment analysis by HOMER
Generates bedgraph and bed files for visualization

Barta E
Command line analysis of ChIP-seq results.
EMBNET JOURNAL 17:(1) pp. 13-17. (2011)
UPL based miRNS detection system

Czimmerer Zsolt

Astrid
Research

http://genomics.dote.hu:8080/mirnadesigntool/
High sensitivity e.g on hsa-mir-181 miRNA gen
family
Hsa-mir-181a:
AACAUUCAACGCUGUCGGUGAGU

Hsa-mir-181b:
AACAUUCAUUGCUGUCGGUGGGU

Hsa-mir-181c:
AACAUUCAAC*CUGUCGGUGAGU

http://genomics.dote.hu:8080/mirnadesigntool/
More info:
Balint L. Balint , Head of
Laboratory

Lbalint@med.unideb.hu
http://genomics.med.unideb.hu

Mais conteúdo relacionado

Mais procurados

B I O Booth Pres For Website S D7 S L I D E S O N L Y
B I O  Booth  Pres For Website  S D7  S L I D E S  O N L YB I O  Booth  Pres For Website  S D7  S L I D E S  O N L Y
B I O Booth Pres For Website S D7 S L I D E S O N L Yguest93170a
 
How bioinformatic and sequencing data might inform the regulatory process - O...
How bioinformatic and sequencing data might inform the regulatory process - O...How bioinformatic and sequencing data might inform the regulatory process - O...
How bioinformatic and sequencing data might inform the regulatory process - O...OECD Environment
 
Sequence analysis in the regulated domain - A Pistoia Alliance Debates webina...
Sequence analysis in the regulated domain - A Pistoia Alliance Debates webina...Sequence analysis in the regulated domain - A Pistoia Alliance Debates webina...
Sequence analysis in the regulated domain - A Pistoia Alliance Debates webina...Pistoia Alliance
 
2015 06-12-beiko-irida-big data
2015 06-12-beiko-irida-big data2015 06-12-beiko-irida-big data
2015 06-12-beiko-irida-big databeiko
 
Introduction to Bioinformatics Slides
Introduction to Bioinformatics SlidesIntroduction to Bioinformatics Slides
Introduction to Bioinformatics SlidesSaide OER Africa
 
Nanosensors and printed electronics integration in future lab on a chip biose...
Nanosensors and printed electronics integration in future lab on a chip biose...Nanosensors and printed electronics integration in future lab on a chip biose...
Nanosensors and printed electronics integration in future lab on a chip biose...Daniel Thomas
 
IRJET- Biochips Technology
IRJET-  	  Biochips TechnologyIRJET-  	  Biochips Technology
IRJET- Biochips TechnologyIRJET Journal
 
Bioinformatics introduction
Bioinformatics introductionBioinformatics introduction
Bioinformatics introductionBiotech Online
 
Candidate 113701 (srg) senior biologist
Candidate 113701 (srg) senior biologistCandidate 113701 (srg) senior biologist
Candidate 113701 (srg) senior biologistJonathan Duckworth
 
Fda phacilitate2010final
Fda phacilitate2010finalFda phacilitate2010final
Fda phacilitate2010finalisoasp
 
Potential value of bioinformatic analysis in regulatory process - OECD Bioinf...
Potential value of bioinformatic analysis in regulatory process - OECD Bioinf...Potential value of bioinformatic analysis in regulatory process - OECD Bioinf...
Potential value of bioinformatic analysis in regulatory process - OECD Bioinf...OECD Environment
 
BIOINFORMATICS Applications And Challenges
BIOINFORMATICS Applications And ChallengesBIOINFORMATICS Applications And Challenges
BIOINFORMATICS Applications And ChallengesAmos Watentena
 
In motion vitals proactive-monitoring and diagnostics support
In motion vitals proactive-monitoring and diagnostics supportIn motion vitals proactive-monitoring and diagnostics support
In motion vitals proactive-monitoring and diagnostics supportAnton Panfilov
 
Informal presentation on bioinformatics
Informal presentation on bioinformaticsInformal presentation on bioinformatics
Informal presentation on bioinformaticsAtai Rabby
 
QPS LC-MS MS of Small & Large Molecules
QPS LC-MS MS of Small & Large MoleculesQPS LC-MS MS of Small & Large Molecules
QPS LC-MS MS of Small & Large MoleculesQPS Holdings, LLC
 
US Perspective on use of bioinformatics in microbial pesticide regulation - O...
US Perspective on use of bioinformatics in microbial pesticide regulation - O...US Perspective on use of bioinformatics in microbial pesticide regulation - O...
US Perspective on use of bioinformatics in microbial pesticide regulation - O...OECD Environment
 

Mais procurados (20)

Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
B I O Booth Pres For Website S D7 S L I D E S O N L Y
B I O  Booth  Pres For Website  S D7  S L I D E S  O N L YB I O  Booth  Pres For Website  S D7  S L I D E S  O N L Y
B I O Booth Pres For Website S D7 S L I D E S O N L Y
 
How bioinformatic and sequencing data might inform the regulatory process - O...
How bioinformatic and sequencing data might inform the regulatory process - O...How bioinformatic and sequencing data might inform the regulatory process - O...
How bioinformatic and sequencing data might inform the regulatory process - O...
 
Sequence analysis in the regulated domain - A Pistoia Alliance Debates webina...
Sequence analysis in the regulated domain - A Pistoia Alliance Debates webina...Sequence analysis in the regulated domain - A Pistoia Alliance Debates webina...
Sequence analysis in the regulated domain - A Pistoia Alliance Debates webina...
 
2015 06-12-beiko-irida-big data
2015 06-12-beiko-irida-big data2015 06-12-beiko-irida-big data
2015 06-12-beiko-irida-big data
 
Introduction to Bioinformatics Slides
Introduction to Bioinformatics SlidesIntroduction to Bioinformatics Slides
Introduction to Bioinformatics Slides
 
Vitek MS Brochure
Vitek MS BrochureVitek MS Brochure
Vitek MS Brochure
 
Nanosensors and printed electronics integration in future lab on a chip biose...
Nanosensors and printed electronics integration in future lab on a chip biose...Nanosensors and printed electronics integration in future lab on a chip biose...
Nanosensors and printed electronics integration in future lab on a chip biose...
 
IRJET- Biochips Technology
IRJET-  	  Biochips TechnologyIRJET-  	  Biochips Technology
IRJET- Biochips Technology
 
Bioinformatics introduction
Bioinformatics introductionBioinformatics introduction
Bioinformatics introduction
 
Candidate 113701 (srg) senior biologist
Candidate 113701 (srg) senior biologistCandidate 113701 (srg) senior biologist
Candidate 113701 (srg) senior biologist
 
Fda phacilitate2010final
Fda phacilitate2010finalFda phacilitate2010final
Fda phacilitate2010final
 
Potential value of bioinformatic analysis in regulatory process - OECD Bioinf...
Potential value of bioinformatic analysis in regulatory process - OECD Bioinf...Potential value of bioinformatic analysis in regulatory process - OECD Bioinf...
Potential value of bioinformatic analysis in regulatory process - OECD Bioinf...
 
BIOINFORMATICS Applications And Challenges
BIOINFORMATICS Applications And ChallengesBIOINFORMATICS Applications And Challenges
BIOINFORMATICS Applications And Challenges
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
In motion vitals proactive-monitoring and diagnostics support
In motion vitals proactive-monitoring and diagnostics supportIn motion vitals proactive-monitoring and diagnostics support
In motion vitals proactive-monitoring and diagnostics support
 
Informal presentation on bioinformatics
Informal presentation on bioinformaticsInformal presentation on bioinformatics
Informal presentation on bioinformatics
 
QPS LC-MS MS of Small & Large Molecules
QPS LC-MS MS of Small & Large MoleculesQPS LC-MS MS of Small & Large Molecules
QPS LC-MS MS of Small & Large Molecules
 
US Perspective on use of bioinformatics in microbial pesticide regulation - O...
US Perspective on use of bioinformatics in microbial pesticide regulation - O...US Perspective on use of bioinformatics in microbial pesticide regulation - O...
US Perspective on use of bioinformatics in microbial pesticide regulation - O...
 

Semelhante a Center for Clinical Genomics and Personalized Medicine, Hungary

2014 11-26 EATRIS biomarkers platform meeting, Amsterdam, Organising technolo...
2014 11-26 EATRIS biomarkers platform meeting, Amsterdam, Organising technolo...2014 11-26 EATRIS biomarkers platform meeting, Amsterdam, Organising technolo...
2014 11-26 EATRIS biomarkers platform meeting, Amsterdam, Organising technolo...Alain van Gool
 
2013-10-23 DTL Next Generation Life Sciences Event, Utrecht
2013-10-23 DTL Next Generation Life Sciences Event, Utrecht2013-10-23 DTL Next Generation Life Sciences Event, Utrecht
2013-10-23 DTL Next Generation Life Sciences Event, UtrechtAlain van Gool
 
Pistoia Alliance USA Conference 2016
Pistoia Alliance USA Conference 2016Pistoia Alliance USA Conference 2016
Pistoia Alliance USA Conference 2016Pistoia Alliance
 
2010 06 07 - LOINC Introduction
2010 06 07 - LOINC Introduction2010 06 07 - LOINC Introduction
2010 06 07 - LOINC Introductiondvreeman
 
Dr. Nanyingi Technology Keynote
Dr. Nanyingi Technology KeynoteDr. Nanyingi Technology Keynote
Dr. Nanyingi Technology KeynoteNanyingi Mark
 
Overview Radboudumc Center for Proteomics, Glycomics and Metabolomics april 2015
Overview Radboudumc Center for Proteomics, Glycomics and Metabolomics april 2015Overview Radboudumc Center for Proteomics, Glycomics and Metabolomics april 2015
Overview Radboudumc Center for Proteomics, Glycomics and Metabolomics april 2015Alain van Gool
 
Advanced Bioinformatics for Genomics and BioData Driven Research
Advanced Bioinformatics for Genomics and BioData Driven ResearchAdvanced Bioinformatics for Genomics and BioData Driven Research
Advanced Bioinformatics for Genomics and BioData Driven ResearchEuropean Bioinformatics Institute
 
Trans disciplinary research is a must for excellence in science by Prof. Moha...
Trans disciplinary research is a must for excellence in science by Prof. Moha...Trans disciplinary research is a must for excellence in science by Prof. Moha...
Trans disciplinary research is a must for excellence in science by Prof. Moha...Prof. Mohamed Labib Salem
 
Laboratory Equipment | Lab Equipment - BD Biosciences
Laboratory Equipment | Lab Equipment - BD BiosciencesLaboratory Equipment | Lab Equipment - BD Biosciences
Laboratory Equipment | Lab Equipment - BD BiosciencesBecton Dickinson India
 
LIMS in Modern Molecular Pathology by Dr. Perry Maxwell
LIMS in Modern Molecular Pathology by Dr. Perry MaxwellLIMS in Modern Molecular Pathology by Dr. Perry Maxwell
LIMS in Modern Molecular Pathology by Dr. Perry MaxwellCirdan
 
Grand round whsiao_may2015
Grand round whsiao_may2015Grand round whsiao_may2015
Grand round whsiao_may2015IRIDA_community
 
How Can We Make Genomic Epidemiology a Widespread Reality? - William Hsiao
How Can We Make Genomic Epidemiology a Widespread Reality?  - William HsiaoHow Can We Make Genomic Epidemiology a Widespread Reality?  - William Hsiao
How Can We Make Genomic Epidemiology a Widespread Reality? - William HsiaoWilliam Hsiao
 
Forum on Personalized Medicine: Challenges for the next decade
Forum on Personalized Medicine: Challenges for the next decadeForum on Personalized Medicine: Challenges for the next decade
Forum on Personalized Medicine: Challenges for the next decadeJoaquin Dopazo
 
Supporting high throughput high-biotechnologies in today’s research environme...
Supporting high throughput high-biotechnologies in today’s research environme...Supporting high throughput high-biotechnologies in today’s research environme...
Supporting high throughput high-biotechnologies in today’s research environme...Ed Dodds
 
Marcos J. Araúzo Bravo
Marcos J. Araúzo BravoMarcos J. Araúzo Bravo
Marcos J. Araúzo BravoEmilia Ventel
 
Workshop 4 - "Presentation of the RD Platform fact finding study on the trend...
Workshop 4 - "Presentation of the RD Platform fact finding study on the trend...Workshop 4 - "Presentation of the RD Platform fact finding study on the trend...
Workshop 4 - "Presentation of the RD Platform fact finding study on the trend...EURORDIS - Rare Diseases Europe
 
2023-11-09 HealthRI Biobanking day_Amsterdam_Alain van Gool.pdf
2023-11-09 HealthRI Biobanking day_Amsterdam_Alain van Gool.pdf2023-11-09 HealthRI Biobanking day_Amsterdam_Alain van Gool.pdf
2023-11-09 HealthRI Biobanking day_Amsterdam_Alain van Gool.pdfAlain van Gool
 

Semelhante a Center for Clinical Genomics and Personalized Medicine, Hungary (20)

2014 11-26 EATRIS biomarkers platform meeting, Amsterdam, Organising technolo...
2014 11-26 EATRIS biomarkers platform meeting, Amsterdam, Organising technolo...2014 11-26 EATRIS biomarkers platform meeting, Amsterdam, Organising technolo...
2014 11-26 EATRIS biomarkers platform meeting, Amsterdam, Organising technolo...
 
NGS and the molecular basis of disease: a practical view
NGS and the molecular basis of disease: a practical viewNGS and the molecular basis of disease: a practical view
NGS and the molecular basis of disease: a practical view
 
2013-10-23 DTL Next Generation Life Sciences Event, Utrecht
2013-10-23 DTL Next Generation Life Sciences Event, Utrecht2013-10-23 DTL Next Generation Life Sciences Event, Utrecht
2013-10-23 DTL Next Generation Life Sciences Event, Utrecht
 
Pistoia Alliance USA Conference 2016
Pistoia Alliance USA Conference 2016Pistoia Alliance USA Conference 2016
Pistoia Alliance USA Conference 2016
 
2010 06 07 - LOINC Introduction
2010 06 07 - LOINC Introduction2010 06 07 - LOINC Introduction
2010 06 07 - LOINC Introduction
 
Dr. Nanyingi Technology Keynote
Dr. Nanyingi Technology KeynoteDr. Nanyingi Technology Keynote
Dr. Nanyingi Technology Keynote
 
Overview Radboudumc Center for Proteomics, Glycomics and Metabolomics april 2015
Overview Radboudumc Center for Proteomics, Glycomics and Metabolomics april 2015Overview Radboudumc Center for Proteomics, Glycomics and Metabolomics april 2015
Overview Radboudumc Center for Proteomics, Glycomics and Metabolomics april 2015
 
Advanced Bioinformatics for Genomics and BioData Driven Research
Advanced Bioinformatics for Genomics and BioData Driven ResearchAdvanced Bioinformatics for Genomics and BioData Driven Research
Advanced Bioinformatics for Genomics and BioData Driven Research
 
Trans disciplinary research is a must for excellence in science by Prof. Moha...
Trans disciplinary research is a must for excellence in science by Prof. Moha...Trans disciplinary research is a must for excellence in science by Prof. Moha...
Trans disciplinary research is a must for excellence in science by Prof. Moha...
 
Laboratory Equipment | Lab Equipment - BD Biosciences
Laboratory Equipment | Lab Equipment - BD BiosciencesLaboratory Equipment | Lab Equipment - BD Biosciences
Laboratory Equipment | Lab Equipment - BD Biosciences
 
Data sharing and analysis
Data sharing and analysisData sharing and analysis
Data sharing and analysis
 
LIMS in Modern Molecular Pathology by Dr. Perry Maxwell
LIMS in Modern Molecular Pathology by Dr. Perry MaxwellLIMS in Modern Molecular Pathology by Dr. Perry Maxwell
LIMS in Modern Molecular Pathology by Dr. Perry Maxwell
 
Grand round whsiao_may2015
Grand round whsiao_may2015Grand round whsiao_may2015
Grand round whsiao_may2015
 
How Can We Make Genomic Epidemiology a Widespread Reality? - William Hsiao
How Can We Make Genomic Epidemiology a Widespread Reality?  - William HsiaoHow Can We Make Genomic Epidemiology a Widespread Reality?  - William Hsiao
How Can We Make Genomic Epidemiology a Widespread Reality? - William Hsiao
 
Forum on Personalized Medicine: Challenges for the next decade
Forum on Personalized Medicine: Challenges for the next decadeForum on Personalized Medicine: Challenges for the next decade
Forum on Personalized Medicine: Challenges for the next decade
 
NAACCR June 2020
NAACCR June 2020NAACCR June 2020
NAACCR June 2020
 
Supporting high throughput high-biotechnologies in today’s research environme...
Supporting high throughput high-biotechnologies in today’s research environme...Supporting high throughput high-biotechnologies in today’s research environme...
Supporting high throughput high-biotechnologies in today’s research environme...
 
Marcos J. Araúzo Bravo
Marcos J. Araúzo BravoMarcos J. Araúzo Bravo
Marcos J. Araúzo Bravo
 
Workshop 4 - "Presentation of the RD Platform fact finding study on the trend...
Workshop 4 - "Presentation of the RD Platform fact finding study on the trend...Workshop 4 - "Presentation of the RD Platform fact finding study on the trend...
Workshop 4 - "Presentation of the RD Platform fact finding study on the trend...
 
2023-11-09 HealthRI Biobanking day_Amsterdam_Alain van Gool.pdf
2023-11-09 HealthRI Biobanking day_Amsterdam_Alain van Gool.pdf2023-11-09 HealthRI Biobanking day_Amsterdam_Alain van Gool.pdf
2023-11-09 HealthRI Biobanking day_Amsterdam_Alain van Gool.pdf
 

Último

Call Girls Service Jaipur {9521753030} ❤️VVIP RIDDHI Call Girl in Jaipur Raja...
Call Girls Service Jaipur {9521753030} ❤️VVIP RIDDHI Call Girl in Jaipur Raja...Call Girls Service Jaipur {9521753030} ❤️VVIP RIDDHI Call Girl in Jaipur Raja...
Call Girls Service Jaipur {9521753030} ❤️VVIP RIDDHI Call Girl in Jaipur Raja...Sheetaleventcompany
 
Call Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls ServiceGENUINE ESCORT AGENCY
 
Call Girls Raipur Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Raipur Just Call 9630942363 Top Class Call Girl Service AvailableCall Girls Raipur Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Raipur Just Call 9630942363 Top Class Call Girl Service AvailableGENUINE ESCORT AGENCY
 
Call Girls Madurai Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Madurai Just Call 9630942363 Top Class Call Girl Service AvailableCall Girls Madurai Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Madurai Just Call 9630942363 Top Class Call Girl Service AvailableGENUINE ESCORT AGENCY
 
Call Girls Jaipur Just Call 9521753030 Top Class Call Girl Service Available
Call Girls Jaipur Just Call 9521753030 Top Class Call Girl Service AvailableCall Girls Jaipur Just Call 9521753030 Top Class Call Girl Service Available
Call Girls Jaipur Just Call 9521753030 Top Class Call Girl Service AvailableJanvi Singh
 
Saket * Call Girls in Delhi - Phone 9711199012 Escorts Service at 6k to 50k a...
Saket * Call Girls in Delhi - Phone 9711199012 Escorts Service at 6k to 50k a...Saket * Call Girls in Delhi - Phone 9711199012 Escorts Service at 6k to 50k a...
Saket * Call Girls in Delhi - Phone 9711199012 Escorts Service at 6k to 50k a...BhumiSaxena1
 
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426jennyeacort
 
8980367676 Call Girls In Ahmedabad Escort Service Available 24×7 In Ahmedabad
8980367676 Call Girls In Ahmedabad Escort Service Available 24×7 In Ahmedabad8980367676 Call Girls In Ahmedabad Escort Service Available 24×7 In Ahmedabad
8980367676 Call Girls In Ahmedabad Escort Service Available 24×7 In AhmedabadGENUINE ESCORT AGENCY
 
Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...
Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...
Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...Dipal Arora
 
Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...
Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...
Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...GENUINE ESCORT AGENCY
 
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...adilkhan87451
 
Call Girls Service Jaipur {9521753030 } ❤️VVIP BHAWNA Call Girl in Jaipur Raj...
Call Girls Service Jaipur {9521753030 } ❤️VVIP BHAWNA Call Girl in Jaipur Raj...Call Girls Service Jaipur {9521753030 } ❤️VVIP BHAWNA Call Girl in Jaipur Raj...
Call Girls Service Jaipur {9521753030 } ❤️VVIP BHAWNA Call Girl in Jaipur Raj...khalifaescort01
 
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...parulsinha
 
Trichy Call Girls Book Now 9630942363 Top Class Trichy Escort Service Available
Trichy Call Girls Book Now 9630942363 Top Class Trichy Escort Service AvailableTrichy Call Girls Book Now 9630942363 Top Class Trichy Escort Service Available
Trichy Call Girls Book Now 9630942363 Top Class Trichy Escort Service AvailableGENUINE ESCORT AGENCY
 
Russian Call Girls Service Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
Russian Call Girls Service  Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...Russian Call Girls Service  Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
Russian Call Girls Service Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...parulsinha
 
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...tanya dube
 
Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...
Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...
Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...parulsinha
 
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋TANUJA PANDEY
 
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service AvailableCall Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Availableperfect solution
 

Último (20)

Call Girls Service Jaipur {9521753030} ❤️VVIP RIDDHI Call Girl in Jaipur Raja...
Call Girls Service Jaipur {9521753030} ❤️VVIP RIDDHI Call Girl in Jaipur Raja...Call Girls Service Jaipur {9521753030} ❤️VVIP RIDDHI Call Girl in Jaipur Raja...
Call Girls Service Jaipur {9521753030} ❤️VVIP RIDDHI Call Girl in Jaipur Raja...
 
Call Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service Available
 
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service
 
Call Girls Raipur Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Raipur Just Call 9630942363 Top Class Call Girl Service AvailableCall Girls Raipur Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Raipur Just Call 9630942363 Top Class Call Girl Service Available
 
Call Girls Madurai Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Madurai Just Call 9630942363 Top Class Call Girl Service AvailableCall Girls Madurai Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Madurai Just Call 9630942363 Top Class Call Girl Service Available
 
Call Girls Jaipur Just Call 9521753030 Top Class Call Girl Service Available
Call Girls Jaipur Just Call 9521753030 Top Class Call Girl Service AvailableCall Girls Jaipur Just Call 9521753030 Top Class Call Girl Service Available
Call Girls Jaipur Just Call 9521753030 Top Class Call Girl Service Available
 
Saket * Call Girls in Delhi - Phone 9711199012 Escorts Service at 6k to 50k a...
Saket * Call Girls in Delhi - Phone 9711199012 Escorts Service at 6k to 50k a...Saket * Call Girls in Delhi - Phone 9711199012 Escorts Service at 6k to 50k a...
Saket * Call Girls in Delhi - Phone 9711199012 Escorts Service at 6k to 50k a...
 
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
 
8980367676 Call Girls In Ahmedabad Escort Service Available 24×7 In Ahmedabad
8980367676 Call Girls In Ahmedabad Escort Service Available 24×7 In Ahmedabad8980367676 Call Girls In Ahmedabad Escort Service Available 24×7 In Ahmedabad
8980367676 Call Girls In Ahmedabad Escort Service Available 24×7 In Ahmedabad
 
Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...
Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...
Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...
 
Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...
Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...
Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...
 
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...
 
Call Girls Service Jaipur {9521753030 } ❤️VVIP BHAWNA Call Girl in Jaipur Raj...
Call Girls Service Jaipur {9521753030 } ❤️VVIP BHAWNA Call Girl in Jaipur Raj...Call Girls Service Jaipur {9521753030 } ❤️VVIP BHAWNA Call Girl in Jaipur Raj...
Call Girls Service Jaipur {9521753030 } ❤️VVIP BHAWNA Call Girl in Jaipur Raj...
 
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
 
Trichy Call Girls Book Now 9630942363 Top Class Trichy Escort Service Available
Trichy Call Girls Book Now 9630942363 Top Class Trichy Escort Service AvailableTrichy Call Girls Book Now 9630942363 Top Class Trichy Escort Service Available
Trichy Call Girls Book Now 9630942363 Top Class Trichy Escort Service Available
 
Russian Call Girls Service Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
Russian Call Girls Service  Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...Russian Call Girls Service  Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
Russian Call Girls Service Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
 
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
 
Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...
Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...
Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...
 
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
 
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service AvailableCall Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
 

Center for Clinical Genomics and Personalized Medicine, Hungary

  • 1. Center for Clinical Genomics and Personalized Medicine 2014 Bálint L. Bálint MD, PhD Head of Laboratory
  • 2. Center for Clinical Genomics and Personalized Medicine IVDI Building 3-d floor
  • 6. Students coming from Medical Centre service area 1.45 hours
  • 7. Facts about the University of Debrecen  33000 students  Teaching  More in Hungarian and English than 1500 faculty members  15 branches  21 Doctoral Schools  15% of Hungarian RnD is located here
  • 8. Brief overview of the region: Underdeveloped region with large Regional Developmental Funds University City with long history Medical Centre that serves 2 mil people Pharmapolis Cluster: TEVA (Biogal) Richter Gedeon new Pharma Plant for Biological drugs (recombinant proteins and antibodies) Cell Therapy Unit (already performing clinical studies) Stem Cell Research Unit (starts 2010) RCMM twinning with EMBL Several EMBO members locally Personalized Health Care Unit (from 2011) Well organized Medical Centre open to patients from foreign countries SAP and ISO implementation at the Medical Centre level
  • 9. Our vision is to channel the advances in genomics towards medical research for the benefit of the patients in the form of Personalized Medicine
  • 10. Goals:  Leader in the Personalized Medicine in the region  Implementation of novel research tools for the benefit of the patients through clinical research  Take the opportunity of the regional grants and use them to develop tools that can be used on a global scale  Taking care of every spent pence in a very conservative way
  • 11. Activities to implement our Goals:  Activities  in two directions: Clinical Research    Common projects with clinicians Infrastructure for clinical research Regional training  From PCR oligo design through Study design till Data analysis  Global gene expression and functional genomics, Epigenetics 01/22/14 11
  • 12. Activities in the field of Clinical Research:  Genomics  National Genomics Technological Platform  Biomarker discovery and Biobanking  Partners: Pfizer, Astra Zeneca, Richter Gedeon, Biosystems International, Roche Hungary  Biobanking: COPD, Schizophrenia, Lung cancer, Leukemias Tools for Biomarker discovery: UPL based miRNA measurement (Roche Hungary and Astrid Research)   Epigenetics   Partners: Diagenode Belgium and Millipore USA Areas: developing of standards for epigenetic studies and protocols for HTS and clinical research in the field of epigenetics 01/22/14 12
  • 13. Coordinated from the University of Debrecen: 1. Genomic Research for Human Health Consortium (GRHH) 2002-2008- FP6 (www.humangenom.hu) 2. National Genomic Technological Platform (NGTP) 2009-2011National Grant www.genomika.net
  • 14. Core facility:  Implementation of novel technologies require expensive infrastructure  Expensive infrastructure can be best used if shared by several research groups and operated by dedicated staff  Without streets knowledge dissemination core facilities are like dead end
  • 15. Detailed Infrastructure  Laboratories  Biobank depositories  Offices  QPCR Instruments  QPCR assays (hundreds)  Capillary  Deep sequencer (4 chanell ABI) Sequencing System (Illumina HiScan SQ)  Pipetting robots (4)  Microarray  DNA/RNA systems (1) QC instruments (Agilent Bioanalyzer, Nanodrop, Qubit)
  • 16. Relevant output Lifecycles of technologies Additional developments Original innovation Distinctive technology / development phase/ time Both instrument and reagent costs are high Peak technology / penetretion phase/ Instrument price is high, reagent price is decreasing Basic technology / spreading phase/ Both instrument and reagent costs are rapidly decreasing Based on: „Pataki Béla: Technológia menedzsment”
  • 17. Relevant output Lifecycles of technologies Distinctive technology / development phase/ time Both instrument and reagent costs are high Peak technology / penetretion phase/ Instrument price is high, reagent price is decreasing Basic technology / spreading phase/ Both instrument and reagent costs are rapidly decreasing Based on: „Pataki Béla: Technológia menedzsment”
  • 18. L ab RE CO Sequencing and genomics unit Epigenetic unit b D La Rn Se b e La rvic Biobanking unit Protein and cell engeneereing unit b D La Rn
  • 19. Sequencing and genomics unit Instruments: •Capillary sequencer •Affymetrix •Illumina NGS •Server system La b RE CO Wet lab people: Post docs: •Beata Scholtz •Szilárd Póliska Technicians: •Sipos Lilla •Erzsébet Mátyás Bioinformatics support team: Endre Barta (leader) Attila Horvath (system administrator) Laszlo Steiner (biomathematics and bio statistics) Gergely Nagy (bioinformatics)
  • 20. NGS Sequencing Illumina Sequencing System HiScan SQ- Szilárd Póliska
  • 21. Automatic Chromatin IP for maximal reproducibility Diagenode IP-Star Magnetic ChIP
  • 23. GeneChip® 3000 platform • • Hybridisation Oven Delivers precise temperature control during hybridization • Fluidics stations • Washing and staining of hybridized target probe complexes • Scanner • High resolution scanner for fast image acquisition • Autoloader including barcode reader for sample tracking
  • 25. NGS software installed on ngsdeb Programs used for ChIP-seq, GRO-seq and RNA-seq analysis • HOMER • SAMTOOLS • BOWTIE • ChIPSEEQER • BEDTOOLS • BAMTOOLS • TOPHAT • TRINITYRNASEQ • BWA • MEME • MACS • FASTX-TOOLKIT • PICARD 25 Head Node: 2x6 core, 144GB RAM, 20 Tbyte disk 6x computing nodes: 2x6 core, 48GB RAM 600GB disk 2012.05.16.
  • 26. ChIP-seq analyze script • Aim: To have a simple script that can be used either to analyze local ChIP-seq sequencing data or to do meta-analysis of ChIP-seq experiments stored on the NCBI SRA database • Command line tool • Input: SRA (NCBI reads), fastq (reads), bam (alignments) • • • • • • • Downloads SRA format files NCBI Maps fastq format reads Peak calling by HOMER and MACS Peak annotation by HOMER Known and denovo motif finding by HOMER GO enrichment analysis by HOMER Generates bedgraph and bed files for visualization Barta E Command line analysis of ChIP-seq results. EMBNET JOURNAL 17:(1) pp. 13-17. (2011)
  • 27. UPL based miRNS detection system Czimmerer Zsolt Astrid Research http://genomics.dote.hu:8080/mirnadesigntool/
  • 28. High sensitivity e.g on hsa-mir-181 miRNA gen family Hsa-mir-181a: AACAUUCAACGCUGUCGGUGAGU Hsa-mir-181b: AACAUUCAUUGCUGUCGGUGGGU Hsa-mir-181c: AACAUUCAAC*CUGUCGGUGAGU http://genomics.dote.hu:8080/mirnadesigntool/
  • 29. More info: Balint L. Balint , Head of Laboratory Lbalint@med.unideb.hu http://genomics.med.unideb.hu

Notas do Editor

  1. The „Standard“ System - every Affymetrix lab in the world uses the same instruments, with the same protocols => standardization of results, easy to compare - point out Fluidics Station is integral component: important for reduction of variability. Competitors dont have their own FS.