Molecular Correlates Of Drug Abuse Comorbidity
•
2 likes•260 views
My 2007 poster presentation to the Society for Neuroscience entitled Molecular Correlates of Drug Abuse Comorbidity in Schizophrenia
![Molecular Correlates of Drug Abuse Comorbidity in Schizophrenia Alan Lesselyong, M.S.; Subroto Ghose, M.D., Ph.D.; Xue-Min Gao, M.D.; Carol Tamminga, M.D. University of Texas Southwestern Medical Center INTRODUCTION RESULTS FUTURE DIRECTIONS DISCUSSION METHODS PRELIMINARY FINDINGS HYPOTHESES Because drug abuse adversely affects the clinical course of schizophrenia, our initial hypothesis is that the changes in molecular neurobiology seen in cases of schizophrenia will be magnified in those cases comorbid for drug abuse. Alternatively, because illicit drug use is so high within this population, the possibility exists that people with schizophrenia are attempting a type of ‘self medication’ in order to treat certain aspects of the illness or side-effects of their antipsychotic medication. Figure 1: Using non-parametric tests, we find that NR1 mRNA is differentially expressed in the pyramidal layer of the DG and CA3 between the three groups. NR1 expression in the DG is significantly higher in control (62.1 19.8 nCi/g) than in schizophrenic cases with (37.6 24.0 nCi/g; p=0.04) but not without (48.8 18.0 nCi/g; p=0.16) a history of drug abuse. In the CA3, however, NR1 levels were significantly higher in control (42.0 19.8 nCi/g) than in schizophrenic cases without substance abuse (20.0 14.3 nCi/g, p = 0.028). Most interestingly, cases of schizophrenia with substance abuse showed CA3 NR1 levels similar to controls (47.3 28.2 nCi/g, p=0.73). Parametric tests indicated a trend towards significance with a p=.0588. Figure 2: There were no changes in NR1 mRNA expression in the posterior hippocampus. These data suggest that there are significant molecular differences in the neurobiology of cases of schizophrenia with and without comorbid drug abuse. The decrease in the NR1 subunit in the dentate is consistent with the glutamate hypothesis as this change from control is exacerbated by drug abuse. It is possible then that reduced NR1 signaling causes the induction of a compensatory mechanism in the CA3 pyramidal cells via changes in signaling along the mossy fiber pathway. These changes may account for an indirect type of ‘self medication’ since the CA3 is thought to contribute more to the psychotic functions of schizophrenia. However, these implications may be misleading due to insufficient data presented here. Increase subject numbers for schizophrenics with and without substance abuse to match those of controls, contrasting the use of opiates (morphine, heroin) and stimulants (cocaine, amphetamines) with legal drugs of abuse (nicotine, caffeine, alcohol) and marijuana. Continue to test for differences in glutamate signaling between schizophrenics with and without drug abuse in the different subfields of the hippocampus, expanding the number of downstream molecular targets. Continue to examine anterior/posterior differences in hippocampal metaplasticity in response to environmental stimuli using both in vitro and in vivo models of developing hippocampal neurons. Schizophrenia affects more than 2.2 million Americans and manifests itself in positive (hallucinations, delusions), negative (anhedonia, asociality), and cognitive (attention, working memory) domains. One widely recognized, but poorly understood characteristic of the illness is the high prevalence of drug abuse, including widespread use of legal drugs such as nicotine (>85%), caffeine (>90%), and alcohol (>40%), narcotic stimulants such as cocaine (>50%), and amphetamines (>20%), and a lifetime prevalence of marijuana use (>70%). The molecular basis for the illness has remained elusive. We and others have found evidence to support the glutamate hypothesis, which states that diminished glutamatergic signaling in discrete regions of the brain is responsible, in part, for many of the symptoms of schizophrenia, including the high prevalence of drug abuse. The hippocampus is a region of particular interest in these studies because of it’s almost exclusively excitatory neural circuits. REFERENCES Coyle, JT. Neurotoxicity Research 10 (3), 221-233, (2006) Chambers, RA; Krystal, JH; Self, DW. Biol. Psychiatry 50, 71-83, (2001) Gao, X., Sakai, K., Roberts, R., Conley, R., Dean, B., Tamminga, C., Am J Psychiatry 157 (7), 1141-1149 (2000) Holcomb, H., Lahti, A., Medoff, D., Cullen, T., Tamminga, C., Neuropsychopharmacology 30 (12), 2275-2282 (2005) Medoff, D., Holcomb, H., Lahti, A., Tamminga, C., Hippocampus 11 (5), 543-550 (2001) Snyder, SH. American Journal of Psychiatry 130 (1), 61-67, (1973) Tamminga, C. Critical Reviews in Neurobiology 12, 1-2 (1998) Tamminga, C., British Journal of Psychiatry Supplement 37, 12-15 (1998) Tamminga, C., Lahti, A., Medoff, D., Gao, X., Holcomb, H., Ann. N.Y. Acad. Sci. 1003, 113-118 (2003) In order to better understand the contribution of altered glutamatergic signaling to schizophrenic symptomology, our current experiments focus on the distribution of N-methyl-D-aspartate receptors (NMDARs) and their obligate subunit, NR1. Changes in NR1 expression are contrasted with the production of Brain-Derived Neurotrophic Factor (BDNF) and GAD-67, the synthetic enzyme for gamma-amino butyric acid (GABA). Comparison of mRNA production between cases of schizophrenia with and without comorbid drug abuse adds a unique dimension to the fields of schizophrenia and drug abuse research and provides hints at the underlying molecular correlates of drug abuse comorbidity in schizophrenia. We have previously conducted a series of in situ hybridization studies using S 35 -UTP labeled probes for NR1, GAD-67 and BDNF exon 5 in serial sections of the hippocampus from age-matched human post mortem tissue in 22 cases with schizophrenia individuals and 22 normal cases according to the following protocol: Antisense Oligonucleotid probes BDNF: Exon 5-specfic: AGTTCCAGTGCCTTTTGTCTATGCCCCTGCAGCCTTCCTTGGTGTAACCC NR1: (compl to bp 566 to 580) TTCCTCCTCCTCCTCACT GTTCACCTTGAATC GGCCAAA GGGACT Riboprobe: GAD 67: human cDNA clone encoding 2.7 kb GAD67. In situ hybridization : For oligo probes: Briefly, the probes labeled with S 35 dATP, Tissue sections were hybridized overnight at 37°C with the labeled probe in hybridization buffer. Sections were rinsed 4-5 min each in 2xSSc containing 50% formamide at 46°C and for 2x30 min in 1xSSc at room temperature, then 2 min each in 70%, 90% and 100% ethanol and air dried. For GAD 67 cRNA probe: cRNA probes were labeled with S 35 -dUTP using a transcription kit (MAXiscript, Ambion). Labeled transcripts were shortened to 100-200 bp by limited alkaline hydrolysis. Sections were incubated with hybridization buffer (50 % formamide, 4×SSC, 1×Denhardt's solution, 10 % dextran sulfate, 250 µg/ml yeast tRNA, 500 µg/ml single-strand salmon DNA and 100 mM DTT) containing cRNA probes for overnight at 50 °C. After hybridization, non-specific binding was reduced by washing in 2×SSC containing 50 % formamide at 52 °C and treated with RNAse A. Sections were then washed overnight in 2×SSC/0.05 % Triton X-100, dehydrated in graded ethanol and air dried. No specific labeling was observed from the sense cRNA. Autoradiograms were generated by exposing Amersham Hyperfilm-$max to the slide-mounted tissue sections along with Amersham[C 14 ]microscales standards for 14 days. Densities of hybridization are measured from film autoradiograms relative to C 14 –labeled tissue paste standards. Local tissue concentrations of radioactivity were determined by quantitative densitometry with MCID densitometer and image system (Imaging Research Inc. St. Catharine’s, Ontario, Canada). In this study, we contrasted gene expression profiles in schizophrenia cases with (n=7) and without (n=6) comorbid drug abuse and compared them to normal cases. For our purposes, substance abuse is defined as any history of substance use causing problems (familial, psycho-social, legal) or a positive toxicology report at the time of death. Schizophrenia is diagnosed post-mortem by a licensed medical doctor according to DSM-IV criteria, all medical records and interviews with family members. Table 2: A breakdown of the densitometry values across the 3 layers of the hippocampus and between groups for BDNF exon 5 and GAD-67 mRNA. Numbers = nCi/g+-SD(valid n). A = anterior, P = posterior. Analysis was done using parametric tests. ,[object Object],[object Object],[object Object],[object Object],[object Object],Sample image from anterior hippocampus using NR1 probe Sample image from posterior hippocampus using NR1 probe Table 1: The three diagnostic groups were matched on demographic variables age, pH, RIN (RNA Integrity Number) and PMI (Post-Mortem Interval). The Spearman Rank Order correlation was run to examine correlations between mRNA levels with age, RIN and PMI on all cases. Data for our mRNA measurements were found not to be normally distributed by the Kolmogorov Smirnov D statistic, so we employed the non-parametric tests (Mann Whitney or Kruskal Wallis) to determine the effect of diagnosis on expression levels of each mRNA species. Cases of schizophrenia comorbid for drug abuse consisted mainly of cannabis use (71.4%), high rates of alcohol abuse (57.1%), a high rate of hallucinogen use (42.9%), a relatively small rate history of narcotic stimulant abuse (cocaine + amphetaming = 28.6%), and a very small prevalence of opiates (14.3%). P A P A P A P A P A P A P A P A 25.5 15.0(6) 29.7 26.7(5) 21.8 28.4(13) 86.1 77.0(4) 23.7 26.3(20) 43.1 35.2(12) Molecular 88.8 40.7(7) 94.3 77.3(5) 57.3 35.4(12) 110.4 59.6(4) 62.9 36.2(21) 104.2 63.7(13) Granular DG 46.6 30.1(5) 86.4 100.8(4) 57.5 51.4(10) 69.7 36.3(4) 57.4 52.8(18) 65.6 45.6(11) Molecular 74.2 52.5(5) 100.9 123.3(4) 81.8 67.8(9) 87.8 43.9(4) 45.6 40.9(18) 76.4 57.7(11) Polymorphic 84.5 28.9(5) 74.3 75.2(4) 67.7 46.0(10) 86.1 38.1(4) 72.1 52.0(18) 91.9 52.5(11) Pyramidal CA3 65.7 44.8(5) 102.4 86.8(5) 92.1 83.2(10) 87.2 44.3(4) 68.4 51.2(17) 81.8 46.2(10) Molecular 106.7 78.3(5) 126.9 99.8(4) 83.3 75.2(10) 100.2 50.8(4) 60.0 50.8(17) 89.1 52.5(11) Polymorphic 92.7 37.7(5) 89.7 89.8(5) 83.8 48.8(10) 107.0 49.7(4) 81.4 62.7(17) 90.3 54.6(12) Pyramidal CA1 Schizophrenia w/Drug Abuse Schizophrenia Control BDNF exon 5 P A P A P A P A P A P A P A P A 20.7 13.0(5) 17.1 10.8(5) 14.1 14.6(4) 19.0 15.7(4) 14.7 6.0(11) 14.1 8.8(10) Molecular 104.6 58.8(5) 91.9 48.0(5) 46.5 70.8(10) 36.7 49.9(12) 64.1 62.4(18) 64.2 58.8(15) Granular DG 20.0 7.9(4) 12.7 7.9(4) 13.2 8.2(7) 13.6 6.4(11) 19.4 15.0(15) 13.9 8.4(12) Molecular 27.1 16.2(4) 16.0 11.4(4) 16.28 9.7(6) 15.1 9.4(11) 20.0 14.7(15) 14.5 9.0(12) Polymorphic 31.9 21.9(4) 23.3 16.8(4) 17.1 13.3(7) 19.5 12.9(11) 24.2 16.2(15) 21.6 15.8(12) Pyramidal CA3 21.3 6.4(4) 22.6 11.5(5) 14.0 7.7(9) 12.9 6.9(11) 19.7 11.3(14) 16.5 12.7(12) Molecular 10.1 12.2(4) 18.2 4.5(4) 11.8 7.3(9) 13.3 6.0(11) 16.6 10.7(14) 13.7 7.4(13) Polymorphic 34.3 17.6(4) 30.6 19.3(5) 17.9 15.1(9) 20.6 15.3(11) 27.4 19.0(14) 23.7 20.2(13) Pyramidal CA1 Schizophrenia w/Drug.Abuse Schizophrenia Control GAD-67 5.8±0.2 6.8±1.7 14.6±6.9 47.1±13.5 N=7(1F,6M ) SCHZIO SA 6.7±0.2 6.7±1.6 14.5±6.6 43.1 17.3 N=14(2F,12M) SCHIZO 6.6±0.3 7.7±1.5 16.3±4.7 44.9±13.6 N=22(6F,16M) CONTROLS pH RIN PMI Age Sex Ave.±S.D. DEMOGRAPHICS](https://image.slidesharecdn.com/molecularcorrelatesofdrugabusecomorbidity-090409184432-phpapp01/85/molecular-correlates-of-drug-abuse-comorbidity-1-320.jpg)
My 2007 poster presentation to the Society for Neuroscience entitled Molecular Correlates of Drug Abuse Comorbidity in Schizophrenia
