1. Insect Biochemistry and Molecular Biology 32 (2002) 247–253
www.elsevier.com/locate/ibmb
Rapid communication
3×P3-EGFP marker facilitates screening for transgenic silkworm
Bombyx mori L. from the embryonic stage onwards
J.-L. Thomas *
, M. Da Rocha, A. Besse, B. Mauchamp, G. Chavancy
Unite´ Nationale Se´ricicole, INRA, 25 quai J.J. Rousseau, 69350, La Mulatiere, France
Received 15 August 2001; received in revised form 1 October 2001; accepted 5 October 2001
Abstract
Transgenesis was recently achieved in Bombyx mori L., but it has proved difficult and time-consuming to screen the numerous
progeny to identify the transgenic individuals. As the 3×P3-EGFP marker has been shown to be a suitable universal marker for
transgenic insects (Nature 402 (1999) 370), we evaluated its use for embryonic-stage screening for B. mori L. germline transform-
ation. Using the piggyBac-derived vector pBac{3×P3-EGFPaf}, we were able to isolate four transgenic individuals from about
120,000 embryos (560 broods). The screening was straightforward due to EGFP production in the G1 embryonic stemmata, which
was visible through the translucent egg chorion. EGFP was produced in the stemmata and central and peripheral nervous systems
from the fifth day of embryonic development. It persisted at high levels in the stemmata throughout the larval stage, and was also
present in the compound eyes and nervous tissues of the pupae and the compound eyes of the moths.  2002 Elsevier Science
Ltd. All rights reserved.
Keywords: Bombyx mori; Transgenesis; piggyBac; Transposon; pBac{3×P3-EGFPaf}; Marker expression
1. Introduction
Germline transgenesis was recently achieved in Bom-
byx mori L. (Tamura et al., 2000) after many attempts
over a number of years (Ninaki et al., 1985; Tamura et
al., 1990; Coulon-Bublex et al., 1993; Nagaraju et al.,
1996). It was made possible by the use of a combination
of the EGFP marker gene cloned in the piggyBac trans-
poson under control of the Bm-Actin3 promoter (Cary
et al., 1989; Fraser et al., 1995). The resulting piggyBac-
derived vector, pPIGA3GFP, was useful for the screen-
ing of G1 individuals at the larval stage but necessitated
the rearing of numerous silkworms. This time-consum-
ing work is the main limitation of this promoter–marker
combination. With the Bm-Actin3GFP marker,
expression can be viewed in mosaic G0 larvae and in
the transgenic larvae of subsequent generations. The
expression of this marker is visible in the vitellophages
of the G0 eggs, but not in G0 embryonic tissues or in
the eggs of the later generations. It is therefore not poss-
* Corresponding author.
E-mail address: thomas@pop.univ-lyon1.fr (J.-L. Thomas).
0965-1748/02/$ - see front matter  2002 Elsevier Science Ltd. All rights reserved.
PII: S0965-1748(01)00150-3
ible, with this promoter, to screen transgenic individuals
before the G1 larval stage.
With a view to reducing the larval rearing effort
required, we investigated the universal 3×P3-EGFP
marker developed in Wimmer’s lab (Berghammer et al.,
1999; Horn et al., 2000; Horn and Wimmer, 2000). The
artificial 3×P3 promoter drives EGFP expression not
only in the ocelli and omatidia of adult Tribolium cas-
taneum and Drosophila melanogaster, but also in the
stemmata of beetle larvae and in the Bolwig organs and
nervous tissues of dipteran larvae, which start to fluor-
escence before hatching, at embryonic stages (Horn et
al., 2000; Hediger et al., 2001).
These data suggested that the 3×P3-EGFP marker was
very likely to be expressed in the stemmata of B. mori
L. embryos. In B. mori L. embryos, the stemmata are in
contact with the chorion, which is almost transparent.
This enabled us to use the 3×P3-EGFP marker to select
transgenic individuals as embryos, overcoming the
necessity to rear thousands of G1 larvae. EGFP
expression was detectable from the fifth day of embry-
onic development until the imago stage. This made it
possible to determine the precise expression pattern of
the 3×P3-EGFP marker in B. mori.

2. 248 J.-L. Thomas et al. / Insect Biochemistry and Molecular Biology 32 (2002) 247–253
2. Materials and methods
2.1. B. mori L. strain
The Indian polyvoltin strain Nistari was obtained from
a silkworm collection maintained at UNS/INRA
(France). Silkworms were reared at 25°C and fed with
mulberry leaves from spring to autumn and on an arti-
ficial diet during winter. After hatching from microin-
jected eggs, first instar larvae were fed an artificial diet
and reared in groups under standard conditions. G0
adults were mated together and G1 eggs were screened
for EGFP expression from the fifth day of incubation
onwards. The positive G1 eggs were isolated, hatched
and the larvae reared separately. Positive adult G1
were backcrossed.
2.2. Egg preparation for microinjection and screening
For egg collection, male and female moths were
allowed to mate overnight by artificial light. In the morn-
ing, the females were placed on a plastic sheet and
allowed to lay in the dark for one hour. The eggs were
disinfected with 4% formaldehyde solution for 5 min,
rinsed with distilled water and finally dried with absolute
ethanol. The piece of the plastic sheet on which the eggs
were laid was glued with cyanocrylate glue onto a
55 mm Petri dish.
Glass needles were pulled from 20 µl precalibrated
pipettes (Vitrex, ref 1264) and were sharpened to an
angle of 30°, using a Narishige EG4 grinder. Eggs were
microinjected as soon as possible, and in all cases were
injected no later than four hours after oviposition. Unless
otherwise specified, the injection was made into the dor-
sal posterior third of the egg, avoiding the ventral side,
where the germ band develops. We injected 5–10 nl of
a 1:1 mixture of vector and helper plasmids (0.5 µg/µl
total DNA concentration) in deionised water into the
eggs. The injection hole was then sealed with a small
drop of cyanocrylate glue. Throughout egg incubation,
a saturated atmosphere was maintained by placing two
wet pieces of GF/B glass filter paper (Whatman) on the
coverslip of the Petri dish. The Petri dish was placed
upside-down in a closed box kept at 25°C.
To make it easier to see the marker in the embryos,
we immersed the eggs in water or 90% ethanol. This
changed the refractive index of the surface of the chor-
ion, rendering it almost transparent, making it easier to
see the fluorescence in the stemmata.
2.3. DNA constructs
The transposon-encoding plasmid, pHA3pig (6.2 kb),
is described elsewhere (Tamura et al., 2000). The pig-
gyBac-derived vector pBac{3×P3-EGFPaf} (7.3 kb) was
generously provided by E.A. Wimmer and is described
in Horn and Wimmer (2000). Both DNA constructs were
amplified using the Hybaid Maxi Flow DNA preparation
kit. Their final concentration was adjusted to 1 µg/µl in
water and they were aliquoted and stored at Ϫ20°C. The
DNA vector and helper mixture, or the vector alone,
were injected at a concentration of 0.5 µg/µl.
2.4. Inverse PCR (iPCR) and junction sequences
Genomic DNA was extracted from G1 moths, G1
embryonic larvae or from the G2 silk gland. DNA was
purified by standard SDS lysis-phenol extraction treat-
ment after incubation with proteinase K. The DNA was
further treated with RNAse and purified as described by
Hediger et al. (2001). DNA was digested with Hae III
and circularised by ligation for 3 h at 18°C. PCR was
performed on the circularised fragments, using primer
sequences, in opposite orientations, corresponding to
sequences between the restriction site and the end
sequence of the piggyBac vector. For the 3Ј junction, the
forward primer (PRF) 5Ј-CCTCGATATACAGACCGA
TAAAACACATGC-3Ј and reverse primer (PRR) 5Ј-
AGTCAGTCAGAAACAACTTTGGCACATATC-3Ј
were used. For the 5Ј junction, the forward primer (PLF)
5Ј-CTTGCACTTGCCACAGAGGACTATTAGAGG-3Ј
and reverse primer (PLR) 5Ј-CAGTGACACTTACCGC
ATTGACAAGCACGC-3Ј were used. PCR fragments
were separated by electrophoresis in a 0.8% agarose gel
and plugs of single bands were reamplified and purified
(PCR purification kit, Qiagen, D). The purified frag-
ments were directly sequenced (GENOME Express;
Meylan, France) with the PLR primer for the left (5Ј)
boundary and PRF for the right (3Ј) boundary of the vec-
tor.
3. Results
3.1. Pattern of 3×P3-EGFP marker expression in B.
mori G0 embryos
We checked that the 3×P3-EGFP marker was func-
tional in B. mori embryos by co-injecting the piggyBac
vector and the helper plasmid pHA3pig into eggs at a
1:1 (w/w) ratio (1.17:1 H/V; molar ratio). We injected
DNA into the eggs at the anterior pole to favour its
location in the cephalic area, where the stemmata differ-
entiate. This may have a detrimental effect on hatching,
but this was not considered important in this preliminary
evaluation of the usefulness of the marker. Once the
stemmata had differentiated, we observed expression of
the marker through the egg shell (Fig. 1). On subsequent
days, and until the larval pre-hatched stage, the number
of embryos producing EGFP steadily increased (Table
2). The 3×P3-EGFP marker was expressed not only in
the stemmata, but also in other tissues, some of which

3. 249J.-L. Thomas et al. / Insect Biochemistry and Molecular Biology 32 (2002) 247–253
Fig. 1. Expression in stemmata of a G0 embryo (arrow). The brown-
ish dot corresponds to the vitellogenic clot. The second egg did not
express the marker although the vector was injected.
were identified as nervous system tissues. Expression
was observed in the thorax and abdomen as well as in
the head (data not shown). It was clear that the marker
was expressed in nervous system tissues in all these
body parts. In many cases it was necessary to dissect
embryos to view or to confirm EGFP expression because
the melanin of the vitellogenic clot covering the injection
hole was opaque. Expression of the 3×P3-EGFP marker
was clearly seen in G0 hatched larvae (Fig. 2) and would
clearly have been detected in G1 eggs with a trans-
parent chorion.
3.2. Conditional pBAC{3×P3-EGFPAF} expression in
G0 embryos
Unlike the pPIGA3GFP vector carrying the Bm-
Actin3 promoter, the pBac{3×P3-EGFPaf} vector
mediated fluorescence in the embryos, which was visible
through the egg chorion and rarely in vitellophages of
the Nistari strain.
This made it possible to test injection parameters to
facilitate the detection of expression from the fourth day
of embryonic development onwards. However, in most
cases, expression became detectable between 6 and 10
days of development (Table 2).
Although the Bm-Actin3 promoter gave strong, early
expression in the vitellophages of the eggs (48 h after
injection), it concealed any potential expression in the
embryonic tissues. Expression in eggs driven by this pro-
moter is poorly sensitive to injection location (anterior
or posterior) and to the presence or absence of the helper
plasmid. We used the pBac{3×P3-EGFPaf} vector to test
the effect of injection location on the frequency of
expression in the target tissue. Injections into the anterior
part of the egg gave a frequency of expression 3.5 times
Fig. 2. Expression in the five stemmata on the left side of a hatched
G0 larva. Expression was visible on both sides of the head; h: head,
t: thorax. The outline of the larva is shown by the dashed line.
higher than that obtained when the DNA solution was
injected into the posterior part of the egg. Moreover,
expression in stemmata was observed only for injections
into the anterior part of the egg. If DNA was injected
into the posterior part of the egg, only thoracic and
abdominal nervous tissues expressed the 3×P3-EGFP
marker. This difference demonstrates clearly the position
effect of the injections. However, injections into the pos-
terior part gave a hatching frequency 5.6 times higher
than that for injections into the anterior part of the egg
(Table 1). We avoided ventral injection because it
resulted in too low a frequency of embryonic develop-
ment (data not shown).
We also tested the effect of the helper plasmid on the
frequency of expression from the pBac{3×P3-EGFPaf}
vector. We compared the co-injection of the helper plas-
mid and vector (in two helper/vector weight ratios: 1:1
and 1:10) with injection of the vector alone (Table 2).
Surprisingly, expression was observed in the absence of
the helper plasmid, even late in embryonic development,
probably due to the persistence of episomal plasmid cop-
ies. Such an expression was never observed in our hands
with common plasmid vectors. Among diverse plasmid
vectors used, only one carrying a recombinant densoviral
vector (Jourdan et al., 1990; Giraud et al., 1992) was
able to give expression in embryonic somatic tissues at
2, 4 and 10 days of development (J.-L. Thomas unpub-
lished results). We found that the helper plasmid
increased the frequency of the marker expression.
Indeed, the frequency of expression with the 1:1 weight
ratio (1.17:1, H/V molar ratio) was 5–13 times higher
than that in the absence of the helper plasmid (Table 3).
In this case, we estimate that about 80% (6.69–
1.36/6.69) to 93% (7.99–0.59/7.99) of expression is
accounted for by somatic integrated vector.
We also tested a 1:10 ratio of helper plasmid to vector.
In this case, the frequency of vector-mediated fluor-
escence was lower, by a factor of 1.2–1.6, than that for
the 1:1 weight ratio of helper plasmid to vector.
3.3. The 3×P3-EGFP marker facilitates efficient
screening for piggyBac germline transgenesis
Based on our preliminary experiments, we chose a 1:1
(w/w, 0.5 µg/µl) mixture of vector helper plasmid into
Table 1
Comparison of the frequency of EGFP expression following co-injec-
tion of the pB3×P3-EGFPaf vector and the pHA3 helper (w/w ratio
of 1:1) into the anterior and posterior poles of the eggs
Injection No. injected No. GEP+ No. hatched
location
Anterior 320 11 (3.4%) 8 (2.5%)
Posterior 420 4 (0.95%) 59 (14%)

4. 250 J.-L. Thomas et al. / Insect Biochemistry and Molecular Biology 32 (2002) 247–253
Table 2
Comparison of various proportions of helper plasmid to vector on the frequency of vector expression in the embryonic stemmata. Numbers of
positive embryos for each recorded day correspond to the total number of positive embryos on that day; ND: not determined
Exp. Conditions No. of eggs No. of GFP-positive embryos at n days of development (%) Ratio
injected
4 6 7 8 11
1 H/V (1:1) 131 ND ND ND ND 2 (1.53) 1:1/1:10
H/V (1:10) 218 ND ND ND ND 2 (0.92) 1.65
H/V (1:1) 338 1 3 17 27 (7.99) ND ND
2 H/V (1:10) 167 0 0 3 11 (6.59) ND 1:1/1:10
1.21
V 170 0 0 1 1 (0.59) ND 1:1/0:1
13.54
3 H/V (1:1) 524 ND ND ND 35 (6.69) ND 1:1/0:1
V 808 ND ND ND 11 (1.36) ND 4.92
the posterior third of the egg. The DNA solution was
injected into the dorsal side, towards the ventral side of
the egg, where the germ band develops. We injected
6335 eggs, from which 2190 larvae hatched (34.6%). Of
the 1210 mated G0 moths, 1100 were mated in single
pair matings and the remaining 110 G0, all of the same
sex, were backcrossed with uninjected moths of the other
sex. We obtained 560 broods, including one single pair
mating brood with four positive individuals. Thus the
percentage of G0 moths with transgenic progeny was
0.08% (1/1210), as it is likely that only one of the two
parents was responsible for the transformation events.
Despite this very low frequency, the transgenic individ-
uals were easy to identify among the 120,000 eggs
screened (one brood corresponds to about 200–250 eggs)
when they were immersed under water or ethanol (Figs.
3(b) and 6(b)).
3.4. Pattern of expression during successive
developmental stages in the transgenic silkworm
The four G1 moths, two males and two females, were
backcrossed with their wild-type counterpart and G2
progeny eggs were screened for GFP. From the fifth day
of embryonic development onwards, we detected GFP
not only in the differentiating stemmata, but also in the
nervous system comprising the cerebrum and the ventral
Fig. 3. Expression in a four-day old G2 egg. (a) Bright field, (b) GFP
fluorescence system.
ganglionic chain (Figs. 3(b), 4(b) and 5(b)). On dissec-
tion, we observed that some peripheral nervous tissues
expressed the 3×P3-EGFP marker (Figs. 4(b) and 5(b)).
Later in development, 3×P3-EGFP marker expression
was observed in the differentiated stemmata of seven-
day old embryo (Fig. 6) and in the differentiating com-
pound eyes of the pupae (Fig. 7) and moths (Fig. 8).
From the four back-crosses we obtained four G2 batches
with different Mendelian proportions of GFP positive
embryos. Brood TJL1 had 75% positive embryos, TJL2
and TJL3 had 50% and TJL4 had 65% positive embryos.
This is consistent with broods TJL2 and TJL3 carrying
a single integration and brood TJL1 carrying two inser-
tions on two different chromosomes. The situation for
brood TJL4 must be more complex, because the pro-
portion (65%) was intermediate between 50 and 75%
(see below).
3.5. Evidence for germinal transgenesis by a
piggyBac-specific transposition process
Inverse PCR experiments were performed on G2 pro-
geny of TJL1, TJL3 and TJL4 G1 parents (Table 3).
None of the TJL2 G2 eggs hatched. We identified six
different genomic junction sequences flanking the 5Ј and
3Ј piggyBac ITR (inverted terminal repeat) sequences in
broods TJL1, TJL3 and TJL4. We observed two vector
insertions in the progeny of TJL1, one in the progeny
of TJL3 and four in the progeny of TJL4. ITRs were
bordered by the characteristic TTAA sequence, the
known target site of piggyBac (Wang and Fraser, 1993).
Except for TJL4.6, in which the 3Ј junction sequence
was the original baculovirus DNA sequence cloned into
the p3E1.2 vector all other junction sequences represent
novel sequences that are most probably derived from the
B. mori genome. PCR analysis showed that TJL1.1 and
TJL1.4 carried the same insertion (A), which differed

5. 251J.-L. Thomas et al. / Insect Biochemistry and Molecular Biology 32 (2002) 247–253
Fig. 4. Expression throughout the body of a five-day old G2 embryo (photomontage). The arrows show stemmata. The orange arrowheads show
positive peripheral nervous system. (a) Bright field, (b) GFP fluorescence system.
Fig. 5. Expression in the head and thorax of a five-day old embryo. The arrow shows the stemmata. The orange arrowheads show positive
peripheral nervous system. (a) Bright field, (b) GFP fluorescence system. The brown dot in (a) is an artefact and not the pigmented stemmata.
Fig. 6. Expression in the stemmata of a seven-day old G2 embryo.
At the bottom, a neighbouring, negative embryo is shown. (a) Bright
field, (b) GFP fluorescence system.
Fig. 7. Expression in differentiating compound eyes in seven-day old
nymphae. (a) Bright field, (b) GFP fluorescence system.
from that carried by TJL1.3 (B) (Table 2). This confirms
that the TJL1 transgenic parent carried two insertions.
TJL3.2 carried a single insertion identical to that of
TJL4.1 whereas TJL4.2, TJL4.3 and TJL4.6 carried dif-
Fig. 8. Expression in the compound eyes of one of the four G1 moths
obtained. (a) Bright field, (b) GFP fluorescence system.
ferent insertions. Finally, four different insertions were
carried by the TJL4 G1 parent. We found six insertions
in the eight G2 individuals analysed. This means that the
two G0 parents carried at least six piggyBac integrations
and that it is very likely that only one of the two parents
carried these six integrations.
4. Discussion
In this paper, we demonstrate the potential value of
the 3×P3-EGFP marker both for the screening of trans-
genic B. mori L. individuals and for evaluating improve-
ments in the frequency of transgenesis.
In the first published experiments describing the suc-
cessful use of a piggyBac transposon for B. mori L.
germline transgenesis, the Bm-Actin3EGFP marker was

6. 252 J.-L. Thomas et al. / Insect Biochemistry and Molecular Biology 32 (2002) 247–253
Table 3
Identification by iPCR of the genomic insertion sites of the pBac{3×P3-EGFPaf} vector. Six different integration events were identified in eight
individuals from 3 G2 transgenic broods. Two insertions were carried by the TJL1 G1 parent. The TJL3 parent carried one insertion identical to
one of the four discovered in the G2 progeny of the TJL4 parent; ND: not determined
Insertion
G2 individuals 5Ј Genomic sequences 3Ј Genomic sequences
identification
TJL 1.1 and TJL 1.4 A …TTAACGACATTACTACGTGGCTTTTAApiggyBac piggyBacTTAAGGGTGTTTCCATTTATT…
TJL 1.3 B ND piggyBacTTAATAAAACTACATTCAATA…
TJL 3.2 and TJL 4.1 C …CCGGG (Hae III site) TTAApiggyBac piggyBacTTAAGGANCGNCTNCATTTNT…
TJL 4.2 D …CCANACGCTCNACGCAGCCAAATTAApiggyBac piggyBacTTAACGATCATCAAACCGCG…
TJL 4.3 E ND piggyBacTTAATGAACGCTAATTTTCAC…
TJL 4.6 F …CCGG (Hae III site) TTAApiggyBac piggyBacTTAAATAATAGTTTCTAATTT…
found to be useful for the screening of G1 transgenic
individuals, but such screening was possible only at the
larval stage (Tamura et al., 2000). However, the fre-
quency of transgenesis (0.7–3.9%) made it necessary to
examine a large number of G1 larvae several times from
the first to the third instar. This screening was difficult
because it was necessary to check moving larvae fed on
an artificial diet. When the diet was cut to present a level
plane, the larvae rapidly made excavations like craters,
resulting in a large number of different focus levels.
Moreover, the rearing of thousands of G1 larvae is very
tedious and time-consuming. Thus, it is clear that if a
marker such as 3×P3-EGFP could be expressed in
embryonic stemmata, the screening process would be
simplified. Stemmata differentiate from the fifth day of
development and are immediately in contact with the
translucent chorion. Furthermore, eggs are laid in a
plane, at a single level, which should also facilitate
screening. In our first experiment, we investigated
whether all these considerations were useful. Expression
of the 3×P3-GFP marker was visible through the chorion
in G0 embryos, although a larger proportion of positive
embryos were detected after dechorionation.
We also observed EGFP production in other tissues.
The artificial 3×P3 promoter, containing three optimal
binding sites for Pax 6 homodimers, drives the tissue-
specific expression of the GFP gene in the stemmata of
embryos. Expression was also observed in nervous sys-
tem tissues including the brain, ventral ganglionic chain
and peripheral nervous tissues. These results are consist-
ent with those obtained in D. melanogaster by Horn et
al. (2000) and Musca domestica by Hediger et al. (2001).
Weak fluorescence was only rarely observed in the vitel-
lophages of the Nistari strain, which is an advantage in
screening for embryonic somatic expression. We also
thought that, unlike the Bm-Actin3GFP marker, the
3×P3-EGFP marker, which was expressed at discrete
sites in G0 embryos and was specific for embryonic
tissues, might be useful for evaluation of the conditions
required to target poorly represented tissues such as
stemmata or nerve precursor cells. This could be
extrapolated to other piggyBac vectors carrying pro-
moter of such a restricted tissue specificity and driving
expression of vital marker gene like GFP gene. It is dif-
ficult, if not impossible, with Bm-Actin3GFP, due to its
loose specificity to evaluate the effect of the presence or
absence of the helper plasmid on the frequency of
somatic embryonic expression or the position effect of
the site of injection as well. In both cases, expression
spreads in many vitellophages to all parts of the egg.
Such evaluation is possible at the larval stage, but only
after the death of numerous embryos and the loss of as
many potential interesting results helping the statistic
view. We assessed the potential value of the 3×P3-EGFP
marker for evaluation from early stages of embryonic
development, by comparing pBac{3×P3-EGFPaf} vector
injection with and without injection of the helper plas-
mid. Expression was detected from the fourth day of
embryonic development in some cases, but mostly after
seven or eight days of embryonic development (12 days
of incubation are required for the hatching of micro-
injected eggs; 10 days are normally required for the
hatching of wild-type control eggs), and its frequency
was favoured by the presence of the helper plasmid.
Injection of the helper plasmid with the vector, in an
equal weight ratio (1.17 molar ratio in favour of the
helper) gave a frequency of expression 5–13 times
higher than that in the absence of the helper plasmid.
The helper plasmid seems to be efficient in mediating
somatic transgenesis, probably stabilising the vector by
means of integration. It has to be clear that this con-
clusion may be drawn only because 3×P3-EGFP marker
is specifically expressed in embryonic tissues. Methods
improving the efficiency of helper plasmid function
should be straightforward to assess with the pBac{3×P3-
EGFPaf} vector. Our results suggest that to obtain germ-
line transgenesis, with the method in our own hands, it
would probably be more relevant to inject the vector into
the posterior part of the egg or into the ventral part where
the germ cells will differentiate. We injected the vector
into the posterior third of the egg, on the dorsal side,
opposite to the site of germ band differentiation, and
pushed the needle inside the vitellus toward the ventral
side, where the germ cells will appear in the germ band

7. 253J.-L. Thomas et al. / Insect Biochemistry and Molecular Biology 32 (2002) 247–253
(Miya, 1958; Nardi, 1993; Nakao, 1999). We did not
inject into the anterior part, targeting the pronuclei or
the zygote, nor into the ventral part, targeting the germ
cells, because injections with our system, in these areas
of the egg were deleterious for normal embryonic devel-
opment and hatching, as expected from Myohara’s
work (1994).
We found that all the known qualities of the 3×P3-
EGFP marker in species such as D. melanogaster, T.
castaneum (Berghammer et al., 1999; Horn et al., 2000)
and M. domestica (Hediger et al., 2001) were also valu-
able in B. mori L. transgenesis as demonstrated in the
Indian polyvoltin Nistari strain and recently in the white
eye mutant W1-pnd (results not shown). The most
important feature of this marker is that it makes it poss-
ible to screen large numbers of G1 broods, with ease, at
an early embryonic stage. This somatic tissue-specific
marker should also be of value for evaluating methods
to increase the frequency of germline transgenesis.
Acknowledgements
We would like to thank B. Decle´rieux, B. Perret and
L. Fontaine for rearing silkworms; C. Royer and A.-M.
Grenier for helpful discussion. We would also like to
thank E.A. Wimmer for critical reading of the manu-
script, for his kindness and for sharing his data and
reagents. In addition, we thank his collaborators: A. Ber-
ghammer and C. Horn.
References
Berghammer, A.J., Klinger, M., Wimmer, E.A., 1999. A universal
marker for transgenic insects. Nature 402, 370–371.
Cary, L., Goebel, M., Corsaro, H.H., Wang, H.H., Rosen, E., Fraser,
M.J., 1989. Transposon mutagenesis of baculoviruses: analysis of
Trichoplusia ni transposon IFP2 insertions within the FP-locus of
nuclear polyhedrosis viruses. Virology 161, 8–17.
Coulon-Bublex, M., Mounier, N., Couble, P., Prudhomme, J.C., 1993.
Cytoplasmic actin A3 gene promoter injected as supercoiled plas-
mid is transiently active in Bombyx mori embryonic vitellophages.
Roux’s Arch. Dev. Biol. 202, 123–127.
Fraser, M.J., Cary, L., Boonvisudhi, K., Wang, H.H., 1995. Assay for
movement of lepidopteran transposon IFP2 in insect cells using a
baculovirus genome as a target DNA. Virology 211, 397–407.
Giraud, C., Devauchelle, G., Bergoin, M., 1992. The densovirus of
Junonia ceonia (Jc DNV) as an insect cell expression vector.
Virology 186, 207–218.
Hediger, M., Niessen, M., Wimmer, E.A., Du¨bendorfer, A., Bopp, D.,
2001. Genetic transformation of the housefly Musca domestica with
the lepidopteran-derived transposon piggyBac. Insect Mol. Biol. 10,
113–119.
Horn, C., Jaunich, B., Wimmer, E.A., 2000. Highly sensitive, fluor-
escent transformation marker for Drosophila transgenesis. Dev.
Genes Evol. 210, 623–629.
Horn, C., Wimmer, E.A., 2000. A versatile vector set for animal trans-
genesis. Dev. Genes Evol. 210, 630–637.
Jourdan, M., Jousset, F.X., Gervais, M., Skory, S., Bergoin, M.,
Dumas, B., 1990. Cloning of the genome of a densovirus and res-
cue of infectious virus from recombinant plasmid in the insect host
Spodoptera littoralis. Virology 179, 403–409.
Miya, K., 1958. Studies on the embryonic development of the gonad
in the silkworm, Bombyx mori L. J. Faculty Agric. Iwate University
3, 436–467.
Myohara, M., 1994. Fate mapping of the silkworm, Bombyx mori,
using localized UV irradiation of the egg at fertilization. Develop-
ment 120 (10), 2869–2877.
Nagaraju, J., Kanda, T., Yukuhiro, K., Chavancy, G., Tamura, T., Cou-
ble, P., 1996. Attempt at transgenesis of the silkworm (Bombyx
mori L.) by egg-injection of foreign DNA. Appl. Entomol. Zool.
31, 587–596.
Nakao, H., 1999. Isolation and characterization of a Bombyx Vasa-like
gene. Dev. Genes Evol. 209, 312–316.
Nardi, J.B., 1993. Modulated expression of a surface epitope on
migrating germ cells of Manduca sexta embryos. Development
118, 967–975.
Ninaki, O., Maekawa, H., Gamo, T., Koga, K., Sakaguchi, B., 1985.
Hatchability of silkworm eggs injected with DNA at early embry-
onic stages. J. Seric. Sci. Jpn. 54, 428–434.
Tamura, T., Kanda, T., Takiya, S., Okano, K., Maekawa, H., 1990.
Transient expression of chimeric CAT genes injected into early
embryos of the domesticated silkworm Bombyx mori. Jpn. J. Genet.
65, 401–410.
Tamura, T., Thibert, C., Royer, C., Kanda, T., Abraham, E., Kamba,
M., Natuo, K., Thomas, J.-L., Mauchamp, B., Chavancy, G., Shirk,
P., Fraser, M., Prudhomme, J.-P., Couble, P., 2000. Germline trans-
formation of the silkworm Bombyx mori L. using a piggyBac trans-
poson-derived vector. Nat. Biotechnol. 18, 81–84.
Wang, H.H., Fraser, M., 1993. TTAA serves as the target site for the
TFP3 lepidopteran transposon insertions in both nuclear
polyhedrosis virus and Trichoplusia ni genomes. Insect Mol. Biol.
1, 109–116.