SlideShare a Scribd company logo
1 of 27
Screening of  MDR1 Gene  Polymorphisms  in  Non Tribal  Population  of  Kerala  Pooja Gupta MSc Project Thesis Internal Guide: Mrs K.Narayani, SRM Arts and Science College, Chennai External Guide: Dr.Moinak Banerjee, Rajiv Gandhi Centre for Biotechnology, Trivandrum
Objective & Scope ,[object Object],[object Object],[object Object]
Epilepsy ,[object Object],[object Object],[object Object]
Pharmacoresistance in Epilepsy ,[object Object],[object Object],[object Object],[object Object]
Course of an AED
Multidrug Transporters ,[object Object],[object Object],[object Object],[object Object]
Common  MDR transporters
P-gp Expression and Genotype ,[object Object],[object Object],[object Object]
Structure of P-gp
Plan of Work
Methodology
 
Results PRIMER PRIMER SEQUENCE AMPLIFIED PRODUCT SIZE SNP MDR13 MDR14 AGGTTTCATTTTGGTGCCTG GAACAAAAGGATGCACACGAC 299 In07+139  C/T MDR9 MDR10a TGCAGGCTATAGGTTCCAGG TTTAGTTTGACTCACCTTCCCG 224 Ex22  G2677T MDR11 MDR12 TGTTTTCAGCTGCTTGATGG AAGGCATGTATGTTGGCCTC 197 Ex27  C3435T
Gradient PCR In 07+139C/T Ex22 G2677T Ex27 C3435T 56.3ºC 53ºC 61.3ºC
RFLP Results
Genotypes obtained by RFLP
 
 
 
 
 
 
Linkage Disequilibrium Analysis 1-  In07+139C/T 2- Ex 2677G/T 3- Ex 3435C/T In07+139C/T was found to be in strong linkage disequilibrium with Ex 2677G/T(D’=0.649,r²=0.387)  but not in significant LD with Ex 3435C/T  (D’=0.393,r²=0.12)
Summary and Conclusion ,[object Object],[object Object],[object Object]
Contd….. ,[object Object],[object Object],[object Object]
Contd… ,[object Object],[object Object]
 

More Related Content

What's hot

Genetic polymorphisms
Genetic polymorphisms Genetic polymorphisms
Genetic polymorphisms cindyzeta
 
Genetic polymorphisms
Genetic polymorphisms Genetic polymorphisms
Genetic polymorphisms cindyzeta
 
Application of RDT in gene therapy
Application of RDT in gene therapyApplication of RDT in gene therapy
Application of RDT in gene therapyANUGYA JAISWAL
 
Pharmaceurtical role of nucleic acid
Pharmaceurtical role of nucleic acidPharmaceurtical role of nucleic acid
Pharmaceurtical role of nucleic acidLaraibTariq5
 
Whole Exome Sequencing at Stanford University
Whole Exome Sequencing at Stanford UniversityWhole Exome Sequencing at Stanford University
Whole Exome Sequencing at Stanford UniversityGolden Helix
 
Topological analysis of coexpression networks in neoplastic tissues (BITS2012...
Topological analysis of coexpression networks in neoplastic tissues (BITS2012...Topological analysis of coexpression networks in neoplastic tissues (BITS2012...
Topological analysis of coexpression networks in neoplastic tissues (BITS2012...Roberto Anglani
 
SSR 2015-poster-A Hypoxia-HIF-Kdm3a Pathway Controls Trophoblast Stem Cell Li...
SSR 2015-poster-A Hypoxia-HIF-Kdm3a Pathway Controls Trophoblast Stem Cell Li...SSR 2015-poster-A Hypoxia-HIF-Kdm3a Pathway Controls Trophoblast Stem Cell Li...
SSR 2015-poster-A Hypoxia-HIF-Kdm3a Pathway Controls Trophoblast Stem Cell Li...Wei Cui
 
20140824 Abnormalities in human pluripotent cells due to reprogramming mechan...
20140824 Abnormalities in human pluripotent cells due to reprogramming mechan...20140824 Abnormalities in human pluripotent cells due to reprogramming mechan...
20140824 Abnormalities in human pluripotent cells due to reprogramming mechan...Alim Polat
 
A New molecular biology techniques for gene therapy
A New molecular biology techniques for gene therapyA New molecular biology techniques for gene therapy
A New molecular biology techniques for gene therapyVanessa Chappell
 
Cell biology review paper
Cell biology review paperCell biology review paper
Cell biology review paperBrendan Kelemen
 
Gene Therapy by Lekhan
Gene Therapy by LekhanGene Therapy by Lekhan
Gene Therapy by LekhanLekhan Lodhi
 

What's hot (20)

Genetic polymorphisms
Genetic polymorphisms Genetic polymorphisms
Genetic polymorphisms
 
Genetic polymorphisms
Genetic polymorphisms Genetic polymorphisms
Genetic polymorphisms
 
Application of RDT in gene therapy
Application of RDT in gene therapyApplication of RDT in gene therapy
Application of RDT in gene therapy
 
2016 BDSRA Cotman, Chandrachud, Hillje, Ilo, Nowell, Oh CLN2, CLN3, CLN6, Adu...
2016 BDSRA Cotman, Chandrachud, Hillje, Ilo, Nowell, Oh CLN2, CLN3, CLN6, Adu...2016 BDSRA Cotman, Chandrachud, Hillje, Ilo, Nowell, Oh CLN2, CLN3, CLN6, Adu...
2016 BDSRA Cotman, Chandrachud, Hillje, Ilo, Nowell, Oh CLN2, CLN3, CLN6, Adu...
 
2014 BDSRA Palmer CLN 5 and CLN 6
2014 BDSRA Palmer CLN 5 and CLN 62014 BDSRA Palmer CLN 5 and CLN 6
2014 BDSRA Palmer CLN 5 and CLN 6
 
Sjogren ppt
Sjogren pptSjogren ppt
Sjogren ppt
 
BDSRA 2015 CLN1 CLN2 CLN3 Sleat, Lobel
BDSRA 2015 CLN1 CLN2 CLN3 Sleat, Lobel BDSRA 2015 CLN1 CLN2 CLN3 Sleat, Lobel
BDSRA 2015 CLN1 CLN2 CLN3 Sleat, Lobel
 
Pharmaceurtical role of nucleic acid
Pharmaceurtical role of nucleic acidPharmaceurtical role of nucleic acid
Pharmaceurtical role of nucleic acid
 
Whole Exome Sequencing at Stanford University
Whole Exome Sequencing at Stanford UniversityWhole Exome Sequencing at Stanford University
Whole Exome Sequencing at Stanford University
 
1.3 df
1.3 df1.3 df
1.3 df
 
Topological analysis of coexpression networks in neoplastic tissues (BITS2012...
Topological analysis of coexpression networks in neoplastic tissues (BITS2012...Topological analysis of coexpression networks in neoplastic tissues (BITS2012...
Topological analysis of coexpression networks in neoplastic tissues (BITS2012...
 
BDSRA 2015 CLN1 Hofmann
BDSRA 2015 CLN1 HofmannBDSRA 2015 CLN1 Hofmann
BDSRA 2015 CLN1 Hofmann
 
2013 ANCL Mole
2013 ANCL Mole2013 ANCL Mole
2013 ANCL Mole
 
SSR 2015-poster-A Hypoxia-HIF-Kdm3a Pathway Controls Trophoblast Stem Cell Li...
SSR 2015-poster-A Hypoxia-HIF-Kdm3a Pathway Controls Trophoblast Stem Cell Li...SSR 2015-poster-A Hypoxia-HIF-Kdm3a Pathway Controls Trophoblast Stem Cell Li...
SSR 2015-poster-A Hypoxia-HIF-Kdm3a Pathway Controls Trophoblast Stem Cell Li...
 
20140824 Abnormalities in human pluripotent cells due to reprogramming mechan...
20140824 Abnormalities in human pluripotent cells due to reprogramming mechan...20140824 Abnormalities in human pluripotent cells due to reprogramming mechan...
20140824 Abnormalities in human pluripotent cells due to reprogramming mechan...
 
BDSRA 2015 CLN10 Burrow, Spaeth, Sisk, Hallinan
BDSRA 2015 CLN10 Burrow, Spaeth, Sisk, HallinanBDSRA 2015 CLN10 Burrow, Spaeth, Sisk, Hallinan
BDSRA 2015 CLN10 Burrow, Spaeth, Sisk, Hallinan
 
2013 a6b1 a7b1 Marta
2013 a6b1 a7b1 Marta2013 a6b1 a7b1 Marta
2013 a6b1 a7b1 Marta
 
A New molecular biology techniques for gene therapy
A New molecular biology techniques for gene therapyA New molecular biology techniques for gene therapy
A New molecular biology techniques for gene therapy
 
Cell biology review paper
Cell biology review paperCell biology review paper
Cell biology review paper
 
Gene Therapy by Lekhan
Gene Therapy by LekhanGene Therapy by Lekhan
Gene Therapy by Lekhan
 

Viewers also liked

Curso Telescópio Aula 4
Curso Telescópio Aula 4Curso Telescópio Aula 4
Curso Telescópio Aula 4Maracaju Vip
 
Tutorial vb projeto em vb.net
Tutorial vb projeto em vb.netTutorial vb projeto em vb.net
Tutorial vb projeto em vb.netMaracaju Vip
 
Last day
Last dayLast day
Last dayson9524
 
Curso de torneiro mecanico
Curso de torneiro mecanicoCurso de torneiro mecanico
Curso de torneiro mecanicoMaracaju Vip
 
Indo-network pilar 1
Indo-network pilar 1Indo-network pilar 1
Indo-network pilar 1arya setiyaki
 
PROTEINAS
PROTEINASPROTEINAS
PROTEINASEscuela
 
Curso telescopio Aula 1
Curso telescopio Aula 1Curso telescopio Aula 1
Curso telescopio Aula 1Maracaju Vip
 
Indo-network Pilar 2
Indo-network Pilar 2Indo-network Pilar 2
Indo-network Pilar 2arya setiyaki
 
B2B Informatie over het Logo spel van Koninklijke Jumbo
B2B Informatie over het Logo spel van Koninklijke JumboB2B Informatie over het Logo spel van Koninklijke Jumbo
B2B Informatie over het Logo spel van Koninklijke JumboMascha Rood
 
Biblia de acordes para jazz (guitarra)
Biblia de acordes para jazz (guitarra)Biblia de acordes para jazz (guitarra)
Biblia de acordes para jazz (guitarra)Maracaju Vip
 
Projeto telescópio faça você mesmo
Projeto telescópio faça você mesmoProjeto telescópio faça você mesmo
Projeto telescópio faça você mesmoMaracaju Vip
 
A bíblia do carro
A bíblia do carroA bíblia do carro
A bíblia do carroMaracaju Vip
 
Caso barrio ituzaingó anexo
Caso barrio ituzaingó anexoCaso barrio ituzaingó anexo
Caso barrio ituzaingó anexoEscuela
 

Viewers also liked (18)

Curso Telescópio Aula 4
Curso Telescópio Aula 4Curso Telescópio Aula 4
Curso Telescópio Aula 4
 
Presentation
PresentationPresentation
Presentation
 
Tutorial vb projeto em vb.net
Tutorial vb projeto em vb.netTutorial vb projeto em vb.net
Tutorial vb projeto em vb.net
 
Last day
Last dayLast day
Last day
 
Camara
CamaraCamara
Camara
 
Php 4 a bíblia
Php 4   a bíbliaPhp 4   a bíblia
Php 4 a bíblia
 
Curso de torneiro mecanico
Curso de torneiro mecanicoCurso de torneiro mecanico
Curso de torneiro mecanico
 
Camara
CamaraCamara
Camara
 
Indo-network pilar 1
Indo-network pilar 1Indo-network pilar 1
Indo-network pilar 1
 
PROTEINAS
PROTEINASPROTEINAS
PROTEINAS
 
Curso telescopio Aula 1
Curso telescopio Aula 1Curso telescopio Aula 1
Curso telescopio Aula 1
 
Indo-network Pilar 2
Indo-network Pilar 2Indo-network Pilar 2
Indo-network Pilar 2
 
B2B Informatie over het Logo spel van Koninklijke Jumbo
B2B Informatie over het Logo spel van Koninklijke JumboB2B Informatie over het Logo spel van Koninklijke Jumbo
B2B Informatie over het Logo spel van Koninklijke Jumbo
 
Biblia de acordes para jazz (guitarra)
Biblia de acordes para jazz (guitarra)Biblia de acordes para jazz (guitarra)
Biblia de acordes para jazz (guitarra)
 
Projeto telescópio faça você mesmo
Projeto telescópio faça você mesmoProjeto telescópio faça você mesmo
Projeto telescópio faça você mesmo
 
A bíblia do carro
A bíblia do carroA bíblia do carro
A bíblia do carro
 
Caso barrio ituzaingó anexo
Caso barrio ituzaingó anexoCaso barrio ituzaingó anexo
Caso barrio ituzaingó anexo
 
Probiotics1
Probiotics1Probiotics1
Probiotics1
 

Similar to Screening Of Mdr1 [Autosaved]

Dr. Ángel Carracedo - Simposio Internacional 'La enfermedad de la duda: el TOC'
Dr. Ángel Carracedo - Simposio Internacional 'La enfermedad de la duda: el TOC'Dr. Ángel Carracedo - Simposio Internacional 'La enfermedad de la duda: el TOC'
Dr. Ángel Carracedo - Simposio Internacional 'La enfermedad de la duda: el TOC'Fundación Ramón Areces
 
Genome Wide Association Studies in Psychiatry
Genome Wide Association Studies in PsychiatryGenome Wide Association Studies in Psychiatry
Genome Wide Association Studies in PsychiatryDr.Guru S Gowda
 
Open Source Pharma /Genomics and clinical practice / Prof Hosur
Open Source Pharma /Genomics and clinical practice / Prof Hosur Open Source Pharma /Genomics and clinical practice / Prof Hosur
Open Source Pharma /Genomics and clinical practice / Prof Hosur opensourcepharmafound
 
From reads to pathways for efficient disease gene finding
From reads to pathways for efficient disease gene findingFrom reads to pathways for efficient disease gene finding
From reads to pathways for efficient disease gene findingJoaquin Dopazo
 
Will the real proteins please stand up
Will the real proteins please stand upWill the real proteins please stand up
Will the real proteins please stand upChris Southan
 
A New Generation Of Mechanism-Based Biomarkers For The Clinic
A New Generation Of Mechanism-Based Biomarkers For The ClinicA New Generation Of Mechanism-Based Biomarkers For The Clinic
A New Generation Of Mechanism-Based Biomarkers For The ClinicJoaquin Dopazo
 
MathiasHibbard_604FinalPaper
MathiasHibbard_604FinalPaperMathiasHibbard_604FinalPaper
MathiasHibbard_604FinalPaperMathias Hibbard
 
Spilman tropisetron brain research
Spilman tropisetron brain researchSpilman tropisetron brain research
Spilman tropisetron brain researchpatricia spilman
 
Analisis de la expresion de genes en la depresion
Analisis de la expresion de genes en la depresionAnalisis de la expresion de genes en la depresion
Analisis de la expresion de genes en la depresionCinthya Yessenia
 
Genetics differences affect drug metabolism
Genetics differences affect drug metabolismGenetics differences affect drug metabolism
Genetics differences affect drug metabolismfaysalahmed35
 
Altered proliferation and networks in neural cells derived from idiopathic au...
Altered proliferation and networks in neural cells derived from idiopathic au...Altered proliferation and networks in neural cells derived from idiopathic au...
Altered proliferation and networks in neural cells derived from idiopathic au...Masuma Sani
 
Integrative regulatory genomics for target gene prioritisation in SLE
Integrative regulatory genomics for target gene prioritisation in SLEIntegrative regulatory genomics for target gene prioritisation in SLE
Integrative regulatory genomics for target gene prioritisation in SLEEnrico Ferrero
 
1995 Research Publication
1995 Research Publication1995 Research Publication
1995 Research PublicationPhil Myers
 
26 ASBMB TODAY FEBRUARY 2021Discovering an old DoGs’ ne
 26 ASBMB TODAY FEBRUARY 2021Discovering an old DoGs’ ne 26 ASBMB TODAY FEBRUARY 2021Discovering an old DoGs’ ne
26 ASBMB TODAY FEBRUARY 2021Discovering an old DoGs’ neMargaritoWhitt221
 

Similar to Screening Of Mdr1 [Autosaved] (20)

Dr. Ángel Carracedo - Simposio Internacional 'La enfermedad de la duda: el TOC'
Dr. Ángel Carracedo - Simposio Internacional 'La enfermedad de la duda: el TOC'Dr. Ángel Carracedo - Simposio Internacional 'La enfermedad de la duda: el TOC'
Dr. Ángel Carracedo - Simposio Internacional 'La enfermedad de la duda: el TOC'
 
Genome Wide Association Studies in Psychiatry
Genome Wide Association Studies in PsychiatryGenome Wide Association Studies in Psychiatry
Genome Wide Association Studies in Psychiatry
 
Open Source Pharma /Genomics and clinical practice / Prof Hosur
Open Source Pharma /Genomics and clinical practice / Prof Hosur Open Source Pharma /Genomics and clinical practice / Prof Hosur
Open Source Pharma /Genomics and clinical practice / Prof Hosur
 
From reads to pathways for efficient disease gene finding
From reads to pathways for efficient disease gene findingFrom reads to pathways for efficient disease gene finding
From reads to pathways for efficient disease gene finding
 
Will the real proteins please stand up
Will the real proteins please stand upWill the real proteins please stand up
Will the real proteins please stand up
 
Diaz-Arrastia, Ramon
Diaz-Arrastia, RamonDiaz-Arrastia, Ramon
Diaz-Arrastia, Ramon
 
A New Generation Of Mechanism-Based Biomarkers For The Clinic
A New Generation Of Mechanism-Based Biomarkers For The ClinicA New Generation Of Mechanism-Based Biomarkers For The Clinic
A New Generation Of Mechanism-Based Biomarkers For The Clinic
 
MathiasHibbard_604FinalPaper
MathiasHibbard_604FinalPaperMathiasHibbard_604FinalPaper
MathiasHibbard_604FinalPaper
 
Spilman tropisetron brain research
Spilman tropisetron brain researchSpilman tropisetron brain research
Spilman tropisetron brain research
 
mmc2
mmc2mmc2
mmc2
 
Analisis de la expresion de genes en la depresion
Analisis de la expresion de genes en la depresionAnalisis de la expresion de genes en la depresion
Analisis de la expresion de genes en la depresion
 
Genetics differences affect drug metabolism
Genetics differences affect drug metabolismGenetics differences affect drug metabolism
Genetics differences affect drug metabolism
 
Schizophrenia
SchizophreniaSchizophrenia
Schizophrenia
 
PIIS0016508514604509
PIIS0016508514604509PIIS0016508514604509
PIIS0016508514604509
 
Altered proliferation and networks in neural cells derived from idiopathic au...
Altered proliferation and networks in neural cells derived from idiopathic au...Altered proliferation and networks in neural cells derived from idiopathic au...
Altered proliferation and networks in neural cells derived from idiopathic au...
 
Integrative regulatory genomics for target gene prioritisation in SLE
Integrative regulatory genomics for target gene prioritisation in SLEIntegrative regulatory genomics for target gene prioritisation in SLE
Integrative regulatory genomics for target gene prioritisation in SLE
 
Gasparini_2014_02Thesis
Gasparini_2014_02ThesisGasparini_2014_02Thesis
Gasparini_2014_02Thesis
 
6 55 E
6 55 E6 55 E
6 55 E
 
1995 Research Publication
1995 Research Publication1995 Research Publication
1995 Research Publication
 
26 ASBMB TODAY FEBRUARY 2021Discovering an old DoGs’ ne
 26 ASBMB TODAY FEBRUARY 2021Discovering an old DoGs’ ne 26 ASBMB TODAY FEBRUARY 2021Discovering an old DoGs’ ne
26 ASBMB TODAY FEBRUARY 2021Discovering an old DoGs’ ne
 

Recently uploaded

Bhawanipatna Call Girls 📞9332606886 Call Girls in Bhawanipatna Escorts servic...
Bhawanipatna Call Girls 📞9332606886 Call Girls in Bhawanipatna Escorts servic...Bhawanipatna Call Girls 📞9332606886 Call Girls in Bhawanipatna Escorts servic...
Bhawanipatna Call Girls 📞9332606886 Call Girls in Bhawanipatna Escorts servic...Dipal Arora
 
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...Sheetaleventcompany
 
Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...
Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...
Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...Angel
 
💚Chandigarh Call Girls 💯Riya 📲🔝8868886958🔝Call Girls In Chandigarh No💰Advance...
💚Chandigarh Call Girls 💯Riya 📲🔝8868886958🔝Call Girls In Chandigarh No💰Advance...💚Chandigarh Call Girls 💯Riya 📲🔝8868886958🔝Call Girls In Chandigarh No💰Advance...
💚Chandigarh Call Girls 💯Riya 📲🔝8868886958🔝Call Girls In Chandigarh No💰Advance...Sheetaleventcompany
 
Kolkata Call Girls Naktala 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...
Kolkata Call Girls Naktala  💯Call Us 🔝 8005736733 🔝 💃  Top Class Call Girl Se...Kolkata Call Girls Naktala  💯Call Us 🔝 8005736733 🔝 💃  Top Class Call Girl Se...
Kolkata Call Girls Naktala 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...Namrata Singh
 
Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...
Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...
Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...Sheetaleventcompany
 
Dehradun Call Girl Service ❤️🍑 8854095900 👄🫦Independent Escort Service Dehradun
Dehradun Call Girl Service ❤️🍑 8854095900 👄🫦Independent Escort Service DehradunDehradun Call Girl Service ❤️🍑 8854095900 👄🫦Independent Escort Service Dehradun
Dehradun Call Girl Service ❤️🍑 8854095900 👄🫦Independent Escort Service DehradunSheetaleventcompany
 
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room DeliveryCall 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room DeliveryJyoti singh
 
Gastric Cancer: Сlinical Implementation of Artificial Intelligence, Synergeti...
Gastric Cancer: Сlinical Implementation of Artificial Intelligence, Synergeti...Gastric Cancer: Сlinical Implementation of Artificial Intelligence, Synergeti...
Gastric Cancer: Сlinical Implementation of Artificial Intelligence, Synergeti...Oleg Kshivets
 
Jual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan Cytotec
Jual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan CytotecJual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan Cytotec
Jual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan Cytotecjualobat34
 
❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...
❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...
❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...Sheetaleventcompany
 
Genuine Call Girls Hyderabad 9630942363 Book High Profile Call Girl in Hydera...
Genuine Call Girls Hyderabad 9630942363 Book High Profile Call Girl in Hydera...Genuine Call Girls Hyderabad 9630942363 Book High Profile Call Girl in Hydera...
Genuine Call Girls Hyderabad 9630942363 Book High Profile Call Girl in Hydera...GENUINE ESCORT AGENCY
 
👉Chandigarh Call Girl Service📲Niamh 8868886958 📲Book 24hours Now📲👉Sexy Call G...
👉Chandigarh Call Girl Service📲Niamh 8868886958 📲Book 24hours Now📲👉Sexy Call G...👉Chandigarh Call Girl Service📲Niamh 8868886958 📲Book 24hours Now📲👉Sexy Call G...
👉Chandigarh Call Girl Service📲Niamh 8868886958 📲Book 24hours Now📲👉Sexy Call G...Sheetaleventcompany
 
Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...
Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...
Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...gragneelam30
 
👉 Amritsar Call Girls 👉📞 8725944379 👉📞 Just📲 Call Ruhi Call Girl Near Me Amri...
👉 Amritsar Call Girls 👉📞 8725944379 👉📞 Just📲 Call Ruhi Call Girl Near Me Amri...👉 Amritsar Call Girls 👉📞 8725944379 👉📞 Just📲 Call Ruhi Call Girl Near Me Amri...
👉 Amritsar Call Girls 👉📞 8725944379 👉📞 Just📲 Call Ruhi Call Girl Near Me Amri...Sheetaleventcompany
 
❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...
❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...
❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...Sheetaleventcompany
 
Intramuscular & Intravenous Injection.pptx
Intramuscular & Intravenous Injection.pptxIntramuscular & Intravenous Injection.pptx
Intramuscular & Intravenous Injection.pptxsaranpratha12
 
👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...
👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...
👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...rajnisinghkjn
 
Dehradun Call Girls Service {8854095900} ❤️VVIP ROCKY Call Girl in Dehradun U...
Dehradun Call Girls Service {8854095900} ❤️VVIP ROCKY Call Girl in Dehradun U...Dehradun Call Girls Service {8854095900} ❤️VVIP ROCKY Call Girl in Dehradun U...
Dehradun Call Girls Service {8854095900} ❤️VVIP ROCKY Call Girl in Dehradun U...Sheetaleventcompany
 
Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...
Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...
Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...Sheetaleventcompany
 

Recently uploaded (20)

Bhawanipatna Call Girls 📞9332606886 Call Girls in Bhawanipatna Escorts servic...
Bhawanipatna Call Girls 📞9332606886 Call Girls in Bhawanipatna Escorts servic...Bhawanipatna Call Girls 📞9332606886 Call Girls in Bhawanipatna Escorts servic...
Bhawanipatna Call Girls 📞9332606886 Call Girls in Bhawanipatna Escorts servic...
 
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
 
Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...
Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...
Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...
 
💚Chandigarh Call Girls 💯Riya 📲🔝8868886958🔝Call Girls In Chandigarh No💰Advance...
💚Chandigarh Call Girls 💯Riya 📲🔝8868886958🔝Call Girls In Chandigarh No💰Advance...💚Chandigarh Call Girls 💯Riya 📲🔝8868886958🔝Call Girls In Chandigarh No💰Advance...
💚Chandigarh Call Girls 💯Riya 📲🔝8868886958🔝Call Girls In Chandigarh No💰Advance...
 
Kolkata Call Girls Naktala 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...
Kolkata Call Girls Naktala  💯Call Us 🔝 8005736733 🔝 💃  Top Class Call Girl Se...Kolkata Call Girls Naktala  💯Call Us 🔝 8005736733 🔝 💃  Top Class Call Girl Se...
Kolkata Call Girls Naktala 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...
 
Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...
Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...
Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...
 
Dehradun Call Girl Service ❤️🍑 8854095900 👄🫦Independent Escort Service Dehradun
Dehradun Call Girl Service ❤️🍑 8854095900 👄🫦Independent Escort Service DehradunDehradun Call Girl Service ❤️🍑 8854095900 👄🫦Independent Escort Service Dehradun
Dehradun Call Girl Service ❤️🍑 8854095900 👄🫦Independent Escort Service Dehradun
 
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room DeliveryCall 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery
 
Gastric Cancer: Сlinical Implementation of Artificial Intelligence, Synergeti...
Gastric Cancer: Сlinical Implementation of Artificial Intelligence, Synergeti...Gastric Cancer: Сlinical Implementation of Artificial Intelligence, Synergeti...
Gastric Cancer: Сlinical Implementation of Artificial Intelligence, Synergeti...
 
Jual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan Cytotec
Jual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan CytotecJual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan Cytotec
Jual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan Cytotec
 
❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...
❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...
❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...
 
Genuine Call Girls Hyderabad 9630942363 Book High Profile Call Girl in Hydera...
Genuine Call Girls Hyderabad 9630942363 Book High Profile Call Girl in Hydera...Genuine Call Girls Hyderabad 9630942363 Book High Profile Call Girl in Hydera...
Genuine Call Girls Hyderabad 9630942363 Book High Profile Call Girl in Hydera...
 
👉Chandigarh Call Girl Service📲Niamh 8868886958 📲Book 24hours Now📲👉Sexy Call G...
👉Chandigarh Call Girl Service📲Niamh 8868886958 📲Book 24hours Now📲👉Sexy Call G...👉Chandigarh Call Girl Service📲Niamh 8868886958 📲Book 24hours Now📲👉Sexy Call G...
👉Chandigarh Call Girl Service📲Niamh 8868886958 📲Book 24hours Now📲👉Sexy Call G...
 
Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...
Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...
Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...
 
👉 Amritsar Call Girls 👉📞 8725944379 👉📞 Just📲 Call Ruhi Call Girl Near Me Amri...
👉 Amritsar Call Girls 👉📞 8725944379 👉📞 Just📲 Call Ruhi Call Girl Near Me Amri...👉 Amritsar Call Girls 👉📞 8725944379 👉📞 Just📲 Call Ruhi Call Girl Near Me Amri...
👉 Amritsar Call Girls 👉📞 8725944379 👉📞 Just📲 Call Ruhi Call Girl Near Me Amri...
 
❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...
❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...
❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...
 
Intramuscular & Intravenous Injection.pptx
Intramuscular & Intravenous Injection.pptxIntramuscular & Intravenous Injection.pptx
Intramuscular & Intravenous Injection.pptx
 
👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...
👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...
👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...
 
Dehradun Call Girls Service {8854095900} ❤️VVIP ROCKY Call Girl in Dehradun U...
Dehradun Call Girls Service {8854095900} ❤️VVIP ROCKY Call Girl in Dehradun U...Dehradun Call Girls Service {8854095900} ❤️VVIP ROCKY Call Girl in Dehradun U...
Dehradun Call Girls Service {8854095900} ❤️VVIP ROCKY Call Girl in Dehradun U...
 
Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...
Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...
Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...
 

Screening Of Mdr1 [Autosaved]

  • 1. Screening of MDR1 Gene Polymorphisms in Non Tribal Population of Kerala Pooja Gupta MSc Project Thesis Internal Guide: Mrs K.Narayani, SRM Arts and Science College, Chennai External Guide: Dr.Moinak Banerjee, Rajiv Gandhi Centre for Biotechnology, Trivandrum
  • 2.
  • 3.
  • 4.
  • 6.
  • 7. Common MDR transporters
  • 8.
  • 12.  
  • 13. Results PRIMER PRIMER SEQUENCE AMPLIFIED PRODUCT SIZE SNP MDR13 MDR14 AGGTTTCATTTTGGTGCCTG GAACAAAAGGATGCACACGAC 299 In07+139 C/T MDR9 MDR10a TGCAGGCTATAGGTTCCAGG TTTAGTTTGACTCACCTTCCCG 224 Ex22 G2677T MDR11 MDR12 TGTTTTCAGCTGCTTGATGG AAGGCATGTATGTTGGCCTC 197 Ex27 C3435T
  • 14. Gradient PCR In 07+139C/T Ex22 G2677T Ex27 C3435T 56.3ºC 53ºC 61.3ºC
  • 17.  
  • 18.  
  • 19.  
  • 20.  
  • 21.  
  • 22.  
  • 23. Linkage Disequilibrium Analysis 1- In07+139C/T 2- Ex 2677G/T 3- Ex 3435C/T In07+139C/T was found to be in strong linkage disequilibrium with Ex 2677G/T(D’=0.649,r²=0.387) but not in significant LD with Ex 3435C/T (D’=0.393,r²=0.12)
  • 24.
  • 25.
  • 26.
  • 27.