SlideShare uma empresa Scribd logo
1 de 42
Personalised medicine

     Medicine for the Quantum age….

    Dr. Patrick Gladding, MBChB, PhD
            Cardiologist, WDHB
Problems with contemporary medicine



• Clinical decisions are based on historical clinical
  trial data
• Clinical trials have traditionally taken
  heterogeneous populations and demonstrated
  results only for the “average patient”
• Personalized risk predictions could be made
  using databases containing heterogeneous data,
  e.g. genomic data, imaging data (EMR) and
  cardiac models
Current medicine is reductionistic



“The whole is more than the sum of its
parts.”

       – Aristotle, Metaphysica



  Interconnected and Interdependent Systems


                                              3
4
5
Personalised Medicine

                        • Its about:

                           – populations as
                             much as
                             individuals
                           – Increasing
                             efficiency and
                             resource
                             utilisation
                           – In a world of
                             limited resources
                             only option is to
                             personalise
Genomic and Personalised Medicine

• Genomics,
  proteomics,
  metabolomics
• Information
  technology
• Artificial intelligence
• Supercomputing
• Molecular imaging
• Nanomedicine
• Biosensors
• Superconvergence
  – “Ubiquitous” Cloud
    supercomputing
  – Low-cost genome sequencing
  – Pervasive connectivity
  – Digital medicine
  – mHealth
tgaagccctctttttctctccttctatttctctctagagcactcaagactttactgacgaaaa
ctcaggaaatcctctatcacaaagaggtttggcaactaaactaagacattaaaagga
aaataccacatgccactctgcaggttgcaataactactacttactggatacattcaaa
ccctccagaatcaacagttatcaggtaaccaacaagaaatgcaagccgtcgacaa
cctcacctctgcgcctggtaacaccagtctgtgcaccagagactacaaaatcaccca
ggtcctcttcccactgctctacactgtcctgttttttgttggacttatcacaaatggcctggc
gatgaggattttctttcaaatccggagtaaatcaaactttattatttttcttaagaacacag
tcatttctgatcttctcatgattctgacttttccattcaaaattcttagtgatgccaaactggg
aacaggaccactgagaacttttgtgtgtcaagttacctccgtcatattttatttcacaatgt
atatcagtatttcattcctgggactgataactatcgatcgctaccagaagaccaccagg
ccatttaaaacatccaaccccaaaaatctcttgggggctaagattctctctgttgtcatct
gggcattcatgttcttactctctttgcctaacatgattctgaccaacaggcagccgagag
acaagaatgtgaagaaatgctctttccttaaatcagagttcggtctagtctggcatgaa
atagtaaattacatctgtcaagtcattttctggattaatttcttaattgttattgtatgttataca
ctcattacaaaagaactgtaccggtcatacgtaagaacgaggggtgtaggtaaagtc
cccaggaaaaaggtgaacgtcaaagttttcattatcattgctgtattctttatttgttttgttc
ctttccattttgcccgaattccttacaccctgagccaaacccgggatgtctttgactgcac
tgctgaaaatactctgttctatgtgaaagagagcactctgtggttaacttccttaaatgca
tgcctggatccgttcatctattttttcctttgcaagtccttcagaaattccttgataagtatgc
tgaagtgccccaattctgcaacatctctgtcccaggacaataggaaaatagaacag
gatggtggtgacccaaatgaagagactccaatgtaaacaaattaactaaggaaat
tgaagccctctttttctctccttctatttctctctagagcactcaagactttactgacgaaaa
ctcaggaaatcctctatcacaaagaggtttggcaactaaactaagacattaaaagga
aaataccacatgccactctgcaggttgcaataactactacttactggatacattcaaa
ccctccagaatcaacagttatcaggtaaccaacaagaaatgcaagccgtcgacaa
cctcacctctgcgcctggtaacaccagtctgtgcaccagagactacaaaatcaccca
ggtcctcttcccactgctctacactgtcctgttttttgttggacttatcacaaatggcctggc
gatgaggattttctttcaaatccggagtaaatcaaactttattatttttcttaagaacacag
tcatttctgatcttctcatgattctgacttttccattcaaaattcttagtgatgccaaactggg
aacaggaccactgagaacttttgtgtgtcaagttacctccgtcatattttatttcacaatgt
Single Nucleotide Polymorphisms (SNPs)
atatcagtatttcattcctgggactgataactatcgatcgctaccagaagaccaccagg
ccatttaaaacatccaaccccaaaaatctcttgggggctaagattctctctgttgtcatct
                 ~1 letter every 1,200
gggcattcatgttcttactctctttgcctaacatgattctgaccaacaggcagccgagag
acaagaatgtgaagaaatgctctttccttaaatcagagttcggtctagtctggcatgaa
atagtaaattacatctgtcaagtcattttctggattaatttcttaattgttattgtatgttataca
ctcattacaaaagaactgtaccggtcatacgtaagaacgaggggtgtaggtaaagtc
cccaggaaaaaggtgaacgtcaaagttttcattatcattgctgtattctttatttgttttgttc
ctttccattttgcccgaattccttacaccctgagccaaacccgggatgtctttgactgcac
tgctgaaaatactctgttctatgtgaaagagagcactctgtggttaacttccttaaatgca
tgcctggatccgttcatctattttttcctttgcaagtccttcagaaattccttgataagtatgc
tgaagtgccccaattctgcaacatctctgtcccaggacaataggaaaatagaacag
gatggtggtgacccaaatgaagagactccaatgtaaacaaattaactaaggaaat
10101011010010101010001010010101001010010000100011
00101001010101001010010000010111110010101010011010
01001010001010100010100101001001001010111111111111
11111111111111000000101001000100100000100010011100
01010010101001010010100101010011001010000100111111
11111111111111100000100101101111110011001010101011
01011110101010010101010010101101001010010010101001
01111111100101010101010101010100101010010100101001
01111111111111111110010010101010100101010100101010
Single Nucleotide Polymorphisms (SNPs)
01111111111111111111010101001010010101001010100100
10100101010010100100101001010101001010010101001001
            ~1 letter every 1,200
00101001001010010010101001010100101011111111111111
11111111111100101010101001010101001010010010101010
00001010111111111111111111010100101001000000000000
00000001010100101001010100101010100101010101100100
00101010100101010010101000101010100010101001010010
00101010111101000100010001111100000100111110001010
10001010111100100101010010101001010011111001010101
01001010010010001000111111111110001010101000001011
11111000101110101010001010101000101111100100101001
11110010100101110100101111001
Genome sequencing   > Exponential reduction in cost




                                           NEJM 2012
Handheld minisequencing




                • $1 per test
                • 20mins for result
                • Not yet available
Feedback loops – giving patients their
information


       Action                 Personalised data




                                 Relevance
     Choices


A Learning system                                  14
                         TED talks: Thomas Goetz
• An integrated EMR &
  biobank is essential
• Semantic
  interoperability
• Machine processable
  databases
Gladding et al. Personalized Medicine (2010) 7(4)
Deep computing – data mining
Network
    Medicine

•   Nodes, hubs
•   Topology
•   Scale free
•   Self-organising
•   Small world
•   Holographic
Social networks and molecular medicine
Reclassifying disease – “diseasome”


                            • Linking
                              diseases
                              through
                              networks,
                              closest
                              neighbour
                              based on
                              genomics




                             http://diseasome.eu/
Drug repositioning
Non-profit
Socially responsible
 Virtual company
Jobs and NZ knowledge economy
Disclosures - IP



                                                                CardioMPO
                                                                Australasia
                                    Clopidogrel
                                 Pharmacogenomics
                               PCT phase US, China, Japan,
                               Europe, Australia, New Zealand




• Founder of non-profit Theranostics Laboratory
• USPTO issued patent; Licensing fees and
  royalties
Pharmacogenomics


  Tailoring drug treatment to genotype
0.75c/d   $4/d
                         Prasugrel
$550k     $2.9 million




                              Ticagrelor




                     $6/d
                     $4.4 million




                                           26
                    Pharmgkb
Ethnic rates of nonresponders




                                *2/wt = higher dose
                                *2/*2 = alternative drug




                                                     27
Rapid low-cost genotyping - NSH


1




    • MALDI-TOF MS
         • Cheap <$30


                                • Nanosphere
2                                  o Rapid 2hrs
                                   o Blood->result
                                   o Clopidogrel/warfarin
                                     PGx
                                   o Norovirus
                                   o Hypervirulent C. diff
Mass Spectrometry MALDI-TOF
Mass Spectrometry MALDI-TOF

                         2
                             • Pattern recognition of spectral output
                             • ‘Machine learning’                         3
                                                                 • Dendrogram:
                                                                 assignment of
                                                                 species pattern




1
• Culture specimen
• Ionise
• Analyse            4




                              • Species identification based on probabilistics
Cardiac mHealth projects


        Community focused




                            31
Cardiac ultrasound project

• Modeling astronaut’s hearts on ISS
• NZ Employment
ICMA v 1.0




    User ID
   Password
Jagir Hussan                     ICMA v 1.0
Auckland 03 Sept 12 10:31 NZST
Jagir Hussan                                     ICMA v 1.0
Auckland 03 Sept 12 10:47 NZST
MR. John E. Dtotu
                                                                  Referring Physician: Dr James Thomas
5543AT75
1071, Kna street,                                                              Male                    163 cm
                                               04-971-3343                                             90 kgs
Kapiti Coast                                                                   10-12-1975
Scans        Models
 4Views        Stress14   Pretrial    P4LVX

  Created on: 31 Sept 2012     Created by: Dr. Patrick Gladding    Status: Validated (Dr James Thomas)
  Analysis     Workshee
               t

                                                                     APLAX      Normal             Fiber
                                                                     4CH
                                                                     2CH
                                                                     SAX
                                                                     Surface
                                                                     Lines




                                                                                Epi                                Endo

                                                                                      CLEAR ALL
                                                                                       CLEAR ALL           SAVE
                                                                                                            SAVE
Advanced ECG for general practice
                                  Digital ECG e.g. XML


                                                  Internet




                •   Spectralised, digital ECG
                •   Artificial intelligence
                •   Metric for health
Advanced ECG


• Standard 12L snap-shot resting ECG from
  Mortara, Philips, Cardiax machine
• 12L ECG is ‘spectralised’ into multiple
  parameters
• Pattern recognition, artificial intelligence applied
  to resulting parameters
• Higher diagnostic yield than standard 12L ECG
  for CAD, HCM, NICM, ICM
Enhancement of exercise treadmill testing



 • Problem: Limited access to exercise
   treadmill testing for patients with chest pain
 • ETT Sensitivity 67%, specificity 78%

 • n=58 patients (10 normal, 48 severe disease
   on coronary angio)
 • All with positive treadmill “coronary disease”
 • One excluded due to noise and six due to
   other cardiac abnormalities on echo

                                                    38
A-ECG results


                •   Lime - Healthy
                •   Red – CAD
                •   Blue - HCM
                •   Aqua - LVH
                •   Purple - NICM
                •   Orange - ICM




                                     39
Enhancement of exercise treadmill testing -Results



 • A-ECG sensitivity of 97.2% and specificity
   of 53% for the angiography results
 • 8 healthy patients with abnormal ETT
   would have been identified correctly with
   A-ECG
 • Theoretically reducing unnecessary
   invasive coronary angiograms by 53%
 • Cost saving $528/A-ECG
                                                     40
Screening programs                                              Population Genomics
Targeted resource allocation                                    Modeling
Community oriented                                              Disease Simulation
Patient-centric                                                 Cost-effectiveness Analysis




                                    Diagnostics Lab
   Wireless Biosensor                 Genebank




   High risk individual
                                                                   Digital Avatar



                               Electronic Healthcare Database
                               Population 4.2 million
Conclusion

• Personalised medicine is emerging as the
  fastest evolving aspect of medicine
• Ushering in a new era in preventative medicine
  with low cost molecular diagnostics, advanced
  informatics
• Will be applicable to every specialty within
  medicine
• Need for industry partnerships (e.g. IBM, Orion)
  & HINZ members
• Needs your help!
  – Acknowledgements: Innovation Hub, North Shore
    hospital laboratory staff, CEO

Mais conteúdo relacionado

Semelhante a Personalised medicine: Medicine for the Quantum age

Next generation sequencing in pharmacogenomics
Next generation sequencing in pharmacogenomicsNext generation sequencing in pharmacogenomics
Next generation sequencing in pharmacogenomics
Dr. Gerry Higgins
 
Dna fingerprinting
Dna fingerprintingDna fingerprinting
Dna fingerprinting
Saikat Saha
 
Describe in your own words the benefits, but also the problems of ha.pdf
Describe in your own words the benefits, but also the problems of ha.pdfDescribe in your own words the benefits, but also the problems of ha.pdf
Describe in your own words the benefits, but also the problems of ha.pdf
arenamobiles123
 

Semelhante a Personalised medicine: Medicine for the Quantum age (20)

Deep MALDI for Oncology Biomarkers Study
Deep MALDI for Oncology Biomarkers StudyDeep MALDI for Oncology Biomarkers Study
Deep MALDI for Oncology Biomarkers Study
 
Dna chip
Dna chipDna chip
Dna chip
 
Developing a Rapid Clinical Sequencing System to Classify Meningioma: Meet th...
Developing a Rapid Clinical Sequencing System to Classify Meningioma: Meet th...Developing a Rapid Clinical Sequencing System to Classify Meningioma: Meet th...
Developing a Rapid Clinical Sequencing System to Classify Meningioma: Meet th...
 
From Panels to Genomes with VarSeq: The Complete Tertiary Platform for Short ...
From Panels to Genomes with VarSeq: The Complete Tertiary Platform for Short ...From Panels to Genomes with VarSeq: The Complete Tertiary Platform for Short ...
From Panels to Genomes with VarSeq: The Complete Tertiary Platform for Short ...
 
Trends in Annotation of Genomic Data
Trends in Annotation of Genomic DataTrends in Annotation of Genomic Data
Trends in Annotation of Genomic Data
 
Axt microarrays
Axt microarraysAxt microarrays
Axt microarrays
 
Third Generation Sequencing
Third Generation Sequencing Third Generation Sequencing
Third Generation Sequencing
 
Molecular techniques for pathology research - MDX .pdf
Molecular techniques for pathology research - MDX .pdfMolecular techniques for pathology research - MDX .pdf
Molecular techniques for pathology research - MDX .pdf
 
Microarray technology.pptx
Microarray technology.pptxMicroarray technology.pptx
Microarray technology.pptx
 
Nanomedicine
NanomedicineNanomedicine
Nanomedicine
 
DNA & Personalized Medicine
DNA & Personalized MedicineDNA & Personalized Medicine
DNA & Personalized Medicine
 
Recombinant DNA technology
Recombinant DNA technologyRecombinant DNA technology
Recombinant DNA technology
 
Next generation sequencing in pharmacogenomics
Next generation sequencing in pharmacogenomicsNext generation sequencing in pharmacogenomics
Next generation sequencing in pharmacogenomics
 
Microarry andd NGS.pdf
Microarry andd NGS.pdfMicroarry andd NGS.pdf
Microarry andd NGS.pdf
 
Genomics: The coming challenge to the health system
Genomics: The coming challenge to the health systemGenomics: The coming challenge to the health system
Genomics: The coming challenge to the health system
 
Microarray (DNA and SNP microarray)
Microarray (DNA and SNP microarray)Microarray (DNA and SNP microarray)
Microarray (DNA and SNP microarray)
 
microarrayppt-170906064529.pdf
microarrayppt-170906064529.pdfmicroarrayppt-170906064529.pdf
microarrayppt-170906064529.pdf
 
Dna fingerprinting
Dna fingerprintingDna fingerprinting
Dna fingerprinting
 
MICROARRAY.pptx
MICROARRAY.pptxMICROARRAY.pptx
MICROARRAY.pptx
 
Describe in your own words the benefits, but also the problems of ha.pdf
Describe in your own words the benefits, but also the problems of ha.pdfDescribe in your own words the benefits, but also the problems of ha.pdf
Describe in your own words the benefits, but also the problems of ha.pdf
 

Mais de Health Informatics New Zealand

Mais de Health Informatics New Zealand (20)

The Austin Health Diabetes Discovery Initiative: Using technology to support ...
The Austin Health Diabetes Discovery Initiative: Using technology to support ...The Austin Health Diabetes Discovery Initiative: Using technology to support ...
The Austin Health Diabetes Discovery Initiative: Using technology to support ...
 
Shaping Informatics for Allied Health - Refining our voice
Shaping Informatics for Allied Health - Refining our voiceShaping Informatics for Allied Health - Refining our voice
Shaping Informatics for Allied Health - Refining our voice
 
Surveillance of social media: Big data analytics
Surveillance of social media: Big data analyticsSurveillance of social media: Big data analytics
Surveillance of social media: Big data analytics
 
The Power of Surface Modelling
The Power of Surface ModellingThe Power of Surface Modelling
The Power of Surface Modelling
 
Laptop computers enhancing clinical care in community allied health service
Laptop computers enhancing clinical care in community allied health serviceLaptop computers enhancing clinical care in community allied health service
Laptop computers enhancing clinical care in community allied health service
 
Making surgical practice improvement easy
Making surgical practice improvement easyMaking surgical practice improvement easy
Making surgical practice improvement easy
 
Safe IT Practices: making it easy to do the right thing
Safe IT Practices: making it easy to do the right thingSafe IT Practices: making it easy to do the right thing
Safe IT Practices: making it easy to do the right thing
 
Beyond EMR - so you've got an EMR - what next?
Beyond EMR - so you've got an EMR - what next?Beyond EMR - so you've got an EMR - what next?
Beyond EMR - so you've got an EMR - what next?
 
Empowered Health
Empowered HealthEmpowered Health
Empowered Health
 
Reducing hospitalisations and arrests of mental health patients through the u...
Reducing hospitalisations and arrests of mental health patients through the u...Reducing hospitalisations and arrests of mental health patients through the u...
Reducing hospitalisations and arrests of mental health patients through the u...
 
Using the EMR in early recognition and management of sepsis
Using the EMR in early recognition and management of sepsisUsing the EMR in early recognition and management of sepsis
Using the EMR in early recognition and management of sepsis
 
Allied Health and informatics: Identifying our voice - can you hear us?
Allied Health and informatics: Identifying our voice - can you hear us?Allied Health and informatics: Identifying our voice - can you hear us?
Allied Health and informatics: Identifying our voice - can you hear us?
 
Change in the data collection landscape: opportunity, possibilities and poten...
Change in the data collection landscape: opportunity, possibilities and poten...Change in the data collection landscape: opportunity, possibilities and poten...
Change in the data collection landscape: opportunity, possibilities and poten...
 
Overview of the New Zealand Maternity Clinical Information System
Overview of the New Zealand Maternity Clinical Information SystemOverview of the New Zealand Maternity Clinical Information System
Overview of the New Zealand Maternity Clinical Information System
 
Nhitb wednesday 9am plenary (sadhana first)
Nhitb wednesday 9am plenary (sadhana first)Nhitb wednesday 9am plenary (sadhana first)
Nhitb wednesday 9am plenary (sadhana first)
 
Oncology treatment patterns in the South Island
Oncology treatment patterns in the South IslandOncology treatment patterns in the South Island
Oncology treatment patterns in the South Island
 
Electronic prescribing system medication errors: Identification, classificati...
Electronic prescribing system medication errors: Identification, classificati...Electronic prescribing system medication errors: Identification, classificati...
Electronic prescribing system medication errors: Identification, classificati...
 
Global trends in technology for retailers and how they are impacting the phar...
Global trends in technology for retailers and how they are impacting the phar...Global trends in technology for retailers and how they are impacting the phar...
Global trends in technology for retailers and how they are impacting the phar...
 
"Not flying under the radar": Developing an App for Patient-led Management of...
"Not flying under the radar": Developing an App for Patient-led Management of..."Not flying under the radar": Developing an App for Patient-led Management of...
"Not flying under the radar": Developing an App for Patient-led Management of...
 
The quantified self: Does personalised monitoring change everything?
The quantified self: Does personalised monitoring change everything?The quantified self: Does personalised monitoring change everything?
The quantified self: Does personalised monitoring change everything?
 

Último

Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...
Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...
Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...
chetankumar9855
 
Call Girls in Gagan Vihar (delhi) call me [🔝 9953056974 🔝] escort service 24X7
Call Girls in Gagan Vihar (delhi) call me [🔝  9953056974 🔝] escort service 24X7Call Girls in Gagan Vihar (delhi) call me [🔝  9953056974 🔝] escort service 24X7
Call Girls in Gagan Vihar (delhi) call me [🔝 9953056974 🔝] escort service 24X7
9953056974 Low Rate Call Girls In Saket, Delhi NCR
 
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
Sheetaleventcompany
 

Último (20)

Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
 
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service Available
 
Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...
Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...
Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...
 
Top Rated Pune Call Girls (DIPAL) ⟟ 8250077686 ⟟ Call Me For Genuine Sex Serv...
Top Rated Pune Call Girls (DIPAL) ⟟ 8250077686 ⟟ Call Me For Genuine Sex Serv...Top Rated Pune Call Girls (DIPAL) ⟟ 8250077686 ⟟ Call Me For Genuine Sex Serv...
Top Rated Pune Call Girls (DIPAL) ⟟ 8250077686 ⟟ Call Me For Genuine Sex Serv...
 
Call Girls in Gagan Vihar (delhi) call me [🔝 9953056974 🔝] escort service 24X7
Call Girls in Gagan Vihar (delhi) call me [🔝  9953056974 🔝] escort service 24X7Call Girls in Gagan Vihar (delhi) call me [🔝  9953056974 🔝] escort service 24X7
Call Girls in Gagan Vihar (delhi) call me [🔝 9953056974 🔝] escort service 24X7
 
Call Girls Mysore Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Mysore Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Mysore Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Mysore Just Call 8250077686 Top Class Call Girl Service Available
 
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service AvailableCall Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
 
Coimbatore Call Girls in Coimbatore 7427069034 genuine Escort Service Girl 10...
Coimbatore Call Girls in Coimbatore 7427069034 genuine Escort Service Girl 10...Coimbatore Call Girls in Coimbatore 7427069034 genuine Escort Service Girl 10...
Coimbatore Call Girls in Coimbatore 7427069034 genuine Escort Service Girl 10...
 
Call Girls Madurai Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Madurai Just Call 9630942363 Top Class Call Girl Service AvailableCall Girls Madurai Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Madurai Just Call 9630942363 Top Class Call Girl Service Available
 
Russian Call Girls Service Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
Russian Call Girls Service  Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...Russian Call Girls Service  Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
Russian Call Girls Service Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
 
Call Girls Jaipur Just Call 9521753030 Top Class Call Girl Service Available
Call Girls Jaipur Just Call 9521753030 Top Class Call Girl Service AvailableCall Girls Jaipur Just Call 9521753030 Top Class Call Girl Service Available
Call Girls Jaipur Just Call 9521753030 Top Class Call Girl Service Available
 
Call Girls Service Jaipur {9521753030} ❤️VVIP RIDDHI Call Girl in Jaipur Raja...
Call Girls Service Jaipur {9521753030} ❤️VVIP RIDDHI Call Girl in Jaipur Raja...Call Girls Service Jaipur {9521753030} ❤️VVIP RIDDHI Call Girl in Jaipur Raja...
Call Girls Service Jaipur {9521753030} ❤️VVIP RIDDHI Call Girl in Jaipur Raja...
 
Call Girls Varanasi Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Varanasi Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 8250077686 Top Class Call Girl Service Available
 
Call Girls Kolkata Kalikapur 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...
Call Girls Kolkata Kalikapur 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...Call Girls Kolkata Kalikapur 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...
Call Girls Kolkata Kalikapur 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...
 
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service
 
Andheri East ) Call Girls in Mumbai Phone No 9004268417 Elite Escort Service ...
Andheri East ) Call Girls in Mumbai Phone No 9004268417 Elite Escort Service ...Andheri East ) Call Girls in Mumbai Phone No 9004268417 Elite Escort Service ...
Andheri East ) Call Girls in Mumbai Phone No 9004268417 Elite Escort Service ...
 
Call Girls Coimbatore Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Coimbatore Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 8250077686 Top Class Call Girl Service Available
 
Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...
Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...
Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...
 
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...
 
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
 

Personalised medicine: Medicine for the Quantum age