1. Analysis of Genetic Components of Amphiprion ocellaris that may Allow Symbiosis with the
Sea Anemone
Elise Mason, Lindsey Ly, Katisha Bellegarde, Corey Exime
Department of Biology, University of Massachusetts Dartmouth
May 5, 2015
ABSTRACT
Various species of anemonefish have established a symbiotic relationship with the sea anemone,
a cnidarian that attacks prey by expulsion of its nematocysts, which release a neurotoxin that
may paralyze or kill the prey. This complex release process is triggered by a combination of
mechanical and chemical stimuli recognized by the anemone. It is believed that the anemonefish
may have evolved a genetic modification which has altered the chemical structure of their mucus
layer to offer protection from the sea anemone by not being recognized as prey. To test this
hypothesis, a series of experiments were conducted using the clown anemonefish Amphiprion
ocellaris, to identify a set of genes that may be involved in this camouflage ability. Gene
expression was studied in various tissues that are related to mucus production and secretion. The
gene sequences that were identified were then used to investigate the evolutionary pathway of
this gene in closely related species. This paper focuses on the function of the b4galt1 gene and
investigates whether the gene plays a role in the symbiotic relationship between A. ocellaris fish
and the sea anemone. The results for this gene were inconclusive as to its role in protecting the
fish from being recognized as prey, however further investigation may lead to new findings that
relate the gene to this function.

2. INTRODUCTION
Symbiotic relationships between different species are common in a variety of different
environments. One interesting relationship exists between a number of species of anemonefish
and sea anemones. Sea anemones are predatory cnidarians which use their tentacles to attack
prey. These cnidocytes, or stinging cells, are discharged when the anemone sense prey in their
presence, but the process of release is sensitive because the cells cannot be regenerated once they
are discharged (Anderson and Bouchard, 2008). For this reason, the discharge of these toxic cells
are highly regulated by chemical and mechanical sensory pathways.
This brings into question what adaptations the anemonefish have developed in order to
survive in the hostile environment of the sea anemone. Research has shown that the mucous coat
of the anemonefish provides protection against the toxins released by the sea anemone and
prevents them from triggering the release of their nematocysts. The chemosensory nature of the
sea anemone tentacles recognizes the compound N-acetyleneuraminic acid (NANA) and this
along with a mechanical stimulus causes the release of the nematocysts (R. Drew, personal
communication). This experiment focuses on the genes present in various tissues of the false
clown anemonefish Amphiprion ocellaris in an attempt to determine if something in their
genome has provided them with this protection against the toxins of the sea anemone.
Gene Summary
Beta-1,4-galactosyltranferase 1, abbreviated as b4galt1, is a protein coding gene which
codes for a specific subfamily of glycosyltransferase enzymes, the galactosyltransferase. There
are many types of glycosyltransferases because they are generally very site-specific and so
different enzymes catalyze the synthesis of various glycoconjugates based on their specific
glyosidic linkages (Amado et al., 1999). The β-1,4-galactosyltransferase enzymes are responsible
for synthesizing the carbohydrate disaccharide component of many types of glycoconjugates,
whether they be glycoproteins, glycolipids, or proteoglycans (Qasba et al., 2008). In most
vertebrates, this gene is expressed as transmembrane enzyme which spans the Golgi complex
(Shaper et al., 1998), which is the main site of glycosylation. It has been identified as a
“housekeeping gene” which means that it is expressed constantly in all cells to maintain proper
cell function (Eisenberg and Levanon, 2013). According to The Human Protein Atlas website,
the b4galt1 RNA transcript is expressed in every organ system in the human body and the
protein was identified in 45 out of 81 tissue cell types that were unaffected by any type of disease
or syndrome, but was also detected in various cancerous tissues (Uhlén et al, 2015).
The β-1,4-galactosyltransferase 1 protein is capable of functioning as a cell recognition
molecule and Nixon and colleagues demonstrated how this glycosyltransferase is used in sperm
recognition by the zona pellucida of mammalian oocytes (2001). The zona pellucida is
comprised of three types of glycoproteins, one of those being ZP3. The ZP3 glycoprotein is
where the B4GalT1 protein is found. During fertilization of an oocyte, a sperm binds to the
oligosaccharide portion of ZP3 and B4GalT1 acts as the sperm receptor in this process.

3. Figure 1: KEGG pathway for N-glycan biosynthesis involving B4GalT1 as a
galactosyltransferase enzyme
The b4galt1 gene is most often encoded as a protein that functions in the final steps of N-
glycan biosynthesis, and is highlighted in red in the KEGG pathway. N-glycan biosynthesis
follows a complex pathway which involves many steps carried out throughout the endoplasmic
reticulum and the Golgi complex. The B4GalT1 protein acts in a variety of cell types by
catalyzing the transfer of a galactose monosaccharide molecule from a UDP-sugar donor
molecule to the asparagine residue of an acceptor protein through the formation of a glycosidic
bond in the Golgi apparatus (Qasba et al. 2008). For example, B4GalT1 catalyzes the binding of
galactose to the immunoglobin G glycan, and this glycan is necessary for the binding of IgG to
various immune cell receptors (Lauc et al. 2013). It is identified as a β- galactosyltransferase
because of the position of the glycosidic linkages it forms when adding the galactose
monosaccharide to a protein.

4. MATERIALS AND METHODS
Bioinformatics Analysis
Using previously sequenced transcriptomes from A. ocellaris, unidentified gene
sequences labeled by contig number were assigned to each student for further investigation of
their relevance to the symbiosis between the anemonefish and the sea anemone. First, the gene
sequences were identified using the online Basic Local Assignment Search Tool (BLAST) on the
NCBI website. The assigned sequence was entered into the database search bar to identify the
most closely related sequence that had already been identified and entered into the database. The
most closely related sequence was used to design forward and reverse primers for the gene of
interest. The given gene sequences were cDNA sequences and so they contain only protein-
coding regions of the fish DNA. For this reason the sequences were entered into BLASTx, which
is a protein database. To do this, the entire sequence along with the title were pasted into the
appropriate field and the settings were corrected to match those as instructed in the lab handout.
The search conducted by the database revealed the most closely related sequence to the
assigned sequence was β-1,4-galactosyltransferase 1. The most closely related sequence that had
previously been identified in the database was that of the bicolor damselfish (Stegastes partitus).
This gene sequence was then used to design primers to be used for PCR.
>AOC_contig_0011424 Average coverage: 3.65
AAGAGAGGCAGAGTGAGGAGGAACTGGTTGATGACGTAGACTCCGTAGTCCAGCTGCTGC
CTCTGCAGGATGGGGGTGCAGGTAGTACAGCCAGTACTTGAGGTGTTCGTCGCGTTTGCG
GAACGGGATGATGATGGCGACCTTCTGCAACGCCTTGCAGTCTGTGGGCCGGAAGCGTCC
GCCTGGCTGCACTTGGGGGTTGTCCTTCTTTATCTGCTGCAGGCTCACGGGGATGTTGAA
TTCGACCCGCAGAGGACCCACCAGCAGAGGAGACGTCTCGGGGCACTTGTCCAGCTCCTT
CTGCGGCTCCCGGACCCCCTGCTCCTCCTTCGGCTTGGTTCGGGAAGTGAACGCGCTGGT
TGTGAGCTGGCCGGACGCTGCTGTCACATTGTGATGGAGGGACTGCTGATTCTGGGCGAA
GGCGAAACGTAGGTCCAAGGAGCGGACGTAAAAGAAGACGGTGACGGAGATGTGGAGGAA
GCCCAGCAGCACCACTAGCTGACAGGTCCGGTGGAGAAGGTTGAAGTTCACGGCGGAATC
TCCGGGCATCCTGACCCCGGAGCTGTCGACTCGAACCCGGCAGAGGTTGTGAAAATTGCG
GAGAGTGGAGCTTCTCTGTTCCCGAACCGTTAGCTGCTTTCCGCCTCCATTTTTTAAAAG
TTTGCTGAAAAGGTGTCGCCGCTGAGGTCCGGTCAAATGAAGGCAATGATCCCCGGAAAG
AAGCCGAAAAAAGAGCAGAGCGTCGGAGAAAGTTTGATAGCAGTTAGCTCAGTTAGCTTC
CTCGGTGTGAAGTAATGGGGAGAGCTAACCGCTATACGGTTAACGGCTCGGGAACTCTGT
GTCTCCGTCAGCGGGCTGCTCGAAAAAAAGGCGGAGAAACGTGAAAAGTTCCACAAATGT
CTTCTCACGTCTATCTGCGGGTGACTTTTCACCGGGTTTTCGACAGAAGCTGCTGCCGCC
TGGG
Figure 2: The cDNA sequence of A. ocellaris assigned to Elise Mason which is most closely
related to b4galt1 gene in Stegases partitus
Primer Design
After identifying the most closely related sequence, primers for PCR were generated
through another database on the NCBI website called Primer-BLAST. The given cDNA
sequence was pasted into the “PCR Template” field and the settings were adjusted according to
the instruction packet provided by Dr. Drew.
After clicking “Get Primers” primer sequences and their details were generated on the
screen. Multiple primer pairs of forward and reverse primers were given from the database, but
the first pair was used because it was the best match for the sequence. The best pair of forward
and reverse primer sequences were AGAGAGGCAGAGTGAGGAGG(+) and

5. AGAAGGAGCTGGACAAGTGC(-) respectively. Both primers were 20 base pairs in length
and resulted in a gene product of 301 base pairs. Once the primer sequences were identified they
were prepared by an outside company and shipped to the university to be used in PCR analysis.
PCR Optimization
Once the primers had arrived they were first used to conduct PCR optimization to obtain
the optimal annealing temperature for the best PCR results for each student’s specific gene.
Primers for PCR normally anneal best around 60.0°C but each primer can vary in its appropriate
annealing temperature. For this reason we conducted PCR optimization at a gradient of
temperatures between 54.0 and 60.0°C to determine which temperature would be best to anneal
the primers to the cDNA template sequences. To do this, each student was provided with a PCR
master mix, the forward and reverse primers for their corresponding gene sequences, and a
centrifuge tube strip with 8 tubes. The PCR master mix contained TAE buffer, 2.0 mM MgCl2,
0.4nM of dNTPs, one unit of Taq polymerase, and sterile water. In order to achieve these
concentrations, a total of 225µL of master mix was used, along with 10µL of forward primer,
10µL of reverse primer and 25µL of cDNA template from A. ocellaris for a total of 250µL,
enough for 4 reactions plus room for error. Two students added their samples to one centrifuge
tube strip. The individual PCR samples with the specific primers were prepared by pipetting the
forward and reverse primers and the cDNA templates into the master mix and mixed by pipetting
in and out several times. The tubes were labeled 1-8 and then 50µL of complete master mix was
added to alternating tubes, 4 tubes for each student. In other words, one student added 50µL each
to tubes 1, 3, 5, and 7 and the other student added 50µL each to tubes 2, 4, 6, and 8. The tubes
were stored on ice until they were placed into the thermocycler to complete the PCR reactions.
The thermocycler conducted 30 cycles of PCR in which the cDNA was denatured at 95°C for 2
minutes for the first cycle and for the following cycles they were denatured at the same
temperature for 30 seconds, then the primers were annealed along the gradient temperatures for
30 seconds, the strands were extended at 72°C for 1 minute, then dwells at that same temperature
for 5 minutes and following that the temperature was dropped to 4°C.
Tube Temperature (°C) Student Initials
1 60.0 LL
2 59.6 EM
3 58.8 LL
4 57.7 EM
5 56.4 LL
6 55.3 EM
7 54.5 LL
8 54.0 EM
Figure 3: Table of temperature gradient for PCR temperature optimization performed by
Lindsey Ly and Elise Mason
PCR Validation
To determine the optimal annealing temperatures of the primers in our PCR products,
agarose gel electrophoresis was conducted to observe the amplified DNA fragments. A 1.5%
agarose gel was prepared by weighing out 1.2g of agarose powder and adding it to a 150mL
Erlenmeyer flask. 80mL of TAE buffer was added to the flask and the mixture was heated in the

6. microwave for 1 minute to dissolve the agarose powder. Once removed from the microwave, the
solution was swirled to mix the agarose well until the liquid was cool enough to touch. After
cooling, 4.0µL of ethidium bromide (10mg/mL) was added to the gel solution to label the DNA
fragments for visualization under UV light. The gel was then poured into the electrophoresis
plastic gel tray and two combs were placed in the gel, one at the top and one in the middle,
creating two sets of 15 wells. While the gel was solidifying, the PCR samples were prepared to
be run through the gel. A new centrifuge tube strip with 4 tubes was obtained by each student
and labeled 1-4. 2.0µL of loading dye was pipetted into each of the 4 tubes. 10µL of PCR
product were then pipetted into each tube, mixing the samples with the dye by pipetting in and
out, changing tips between each tube. Once the gel had solidified the combs were removed the
gel was covered with TAE running buffer to carry the electric current. Four students loaded
10µL of each of their samples into designated wells in the same gel and a ladder was loaded into
the first well in the top set and bottom set of wells for size comparison. The electrophoresis was
run at 110 volts for 45 minutes. The gels were then removed from the electrophoresis apparatus
and observed under UV light to observe the fragments.
Analysis of Gene Expression in Tissues
Once the gels had been analyzed and the annealing temperatures for the primers had been
determined, semi-quantitative PCR was performed to determine the levels of expression of the
assigned genes in specific tissues of A. ocellaris. The mRNA samples from tissues of the brain,
liver, gill, and skin were analyzed. A centrifuge tube strip with 8 tubes was obtained along with
PCR master mix with the same ingredients as in the last PCR run, the same forward and reverse
primers, and cDNA from each tissue sample. Three cDNA dilutions of A. ocellaris were also
provided which provided a standard curve for comparison against the PCR samples to verify that
the variation that will be observed is truly from expression levels rather than varying DNA
fragment concentration in the entire sample. To prepare our samples for PCR, 18µL of each
forward and reverse primers were pipetted into the master mix which was prepared in the same
manner as before using the semi-quantitative method for more accurate measurements. The
master mix with the primers was vortexed for 5 seconds and placed on ice. The centrifuge tube
strip was labeled 1-8 and with the optimal annealing temperature, and the samples were added as
in the following table. The pipette was coated with the master mix and 45µL of master mix was
pipetted into each of the 8 tubes following quantitative pipetting and sterile techniques. 5µL of
cDNA template from each tissue sample was added to the appropriate tubes, changing tips
between each template. The tubes were vortexed for 3 seconds and loaded into the thermocycler
at the optimal annealing temperature and PCR was run as before.
Tube Sample
1 Undiluted gDNA
2 1:10 dilution gDNA
3 1:100 dilution gDNA
4 Brain cDNA
5 Liver cDNA
6 Gill cDNA
7 Skin cDNA
8 TAE- negative control
Figure 4: Setup of centrifuge tubes for analysis of gene expression in different A. ocellaris tissue

7. Phylogenetic Analysis
The next step in this experiment involved running another PCR and observing the
products by gel electrophoresis to compare expression of the given genes in a variety of fish
species which are closely related to A. ocellaris. Eight PCR reactions were prepared in the
manner showed in Figure 4. An 8-tube centrifuge strip was used as in the other experiments with
positive and negative control added to tube 1 and 8, respectively. The positive control was either
A. ocellaris skin or gill cDNA, based on expression results from the previous PCR. The negative
control was a TAE buffer which contained no template DNA for the primers to build off of. A
master mix was prepared to accommodate 9 reactions in the same manner as the last PCR. The
PCR reaction was conducted at 55.0˚C and the results were observed by gel electrophoresis the
next week. A 1.5% agarose gel was prepared as the previous gel for electrophoresis. The gel was
run at 110V for 45 minutes and observed under UV light.
Ingredient 1 reaction 9 reactions
PCR master mix 39.0 µL 351.0 µL
dNTPs 2.0 µL 18.0 µL
Primer F 2.0 µL 18.0 µL
Primer R 2.0 µL 18.0 µL
Template DNA 5.0 µL ---
Total 50.0 µL 405.0 µL
Figure 5: Master mix recipe setup for PCR gene fragments in various fish species
Tube Number Tissue Sample
1 A. ocellaris skin/gill cDNA
2 A. ocellaris gDNA
3 A. bicinctus
4 A. clarkia
5 Premnas biaculeatus
6 Chrysiptera parasema
7 Chrysiptera springeri
8 TAE buffer
Figure 6: Setup of the PCR reactions for the comparison of gene expression in fish species
related to A. ocellaris for B4GalT1 gene primers
From the results of the previous experiment, the PCR products that produced expression
in any of the other fish species were used for PCR cleanup to sequence the expressed gene
products and analyze of the evolution of the gene sequences being studied. To conduct the PCR
cleanup, the original tube strips as demonstrated in Figure 6 were used because they contained
the amplified sequences for each of the fish species studied. Successful PCR products were
determined from the gel and 10µL of sodium acetate and 200µL of buffer PB were added into
the tubes that corresponded with those products. A spin column was placed into a 2mL collection
tube for each sample and the samples were pipetted into the center of the tube to bind the DNA
to the filter of the spin column. The columns in the collection tubes were centrifuged for 30
seconds at 13000x g (RCF). The flow through was disposed of from the collection tube and the
spin column was returned to the tube. Then 750µL of buffer PE was pipetted into the spin
column. The samples were centrifuged again at 13000x g for 30 seconds. The flow through was

8. discarded once again and the tube was centrifuged for 1 minute at the same pace. Following the
centrifugation, a 1.5mL centrifuge tube was obtained and labeled for each spin column
containing successful PCR products. The spin columns were placed in their respective tubes and
40µL of buffer EB were pipetted onto the center of the membrane. The column stood for 1
minute and then was centrifuged for 1 minute. A data sheet was filled out to organize and
identify all the samples used for sequencing. For each successful sample, 15µL of the cleaned
PCR products were added to two wells in a 96-well plate. In one well, 5µL of forward primer
was added and into the other, 5µL of reverse primer was added. The products were sent off
campus to be sequenced by an outside company and the results were returned in the form of
chromatograms.
The chromatograms for each cleaned product were trimmed and evaluated for the
strength of the sequences. Those that displayed clean, strongly determined sequences were used
to construct a phylogenetic tree. To achieve a total of 8 related gene sequences for each student,
one of the trimmed chromatogram sequences were entered into nucleotide BLAST, to find other
closely related sequences that were not already used in this experiment and have already been
identified. These sequences were downloaded from the GENBANK database, placed into one
Microsoft document and renamed. The sequences were then copied into the CLUSTALW
program to analyze nucleotide variation between the sequences of each species. The sequences
were then used to construct a phylogenetic tree which demonstrated the possible evolutionary
pathway of the gene sequence being studied.
RESULTS AND DISCUSSION
PCR Validation Results
After running the gel electrophoresis and observing the gel under UV light, two of the
student’s primers had annealed to some sequences but the other two did not show conclusive
results. The first set of primers created a few weak bands at the first four temperatures in the
gradient. The gel was also not prepared correctly and the agarose was not evenly distributed
which distorted the migration of the DNA fragments through the gel.
While it was difficult to interpret the expression of each gene fragment from this gel, it
does seem as though none of the temperatures were optimal in annealing the primers for Corey’s
gene, while a variety of temperatures were effective in annealing Lindsey’s primers. The
weakness of the bands that did show may be attributed to a low concentration of DNA fragments
that were produced by the PCR process. For the next PCR performed for analysis of A. ocellaris
tissues, 18µL of forward and reverse primers were used instead of the 10µL used in the
optimization PCR reaction in an attempt to receive stronger results.

9. Figure 7: Gel electrophoresis results from PCR temperature optimization from MGAT5B,
B3GAT2, B4GalT1, and OGT. From top left to right and bottom left.
Analysis of Gene Expression in Tissues
The gel electrophoresis from gene expression analysis produced stronger results for some
of the group members. The primers for BGalT1, shown in the bottom left wells of the gel,
seemed to bind to many DNA fragments in the gDNA dilutions but did not show conclusive
results in any of the A. ocellaris tissues. There are a few faint bands in brain, liver, and gill
tissues but nothing that can be made out in the skin tissue. The gDNA dilution showed best with
the MGAT5B PCR products and there was strong expression in the brain tissue of A. ocellaris.
The OGT PCR products showed strong expression in the brain, liver, and gill tissues but not in
the skin. The B4GalT1 gene showed expression of multiple fragments in the cDNA dilutions but
very weak expression in the brain, liver, and gill tissues and no expression in the skin tissues.
The B3GAT2 dilutions were not expressed strongly. While there was one band expressed in the
brain tissue, its significance is diminished because the comparison gradient was compromised.
However, this is not to say the brain tissue band is completely useless, and this information was
used for further analysis.
The inconclusive results for the B4GalT1 gene expression in the A. ocellaris tissues may
be contributed to the inability to find an appropriate annealing temperature from the
optimization. The PCR of this gene for this experiment was conducted at a standard 55.0˚C,
which is not uncommon for many primers, but may not have been best for these primers. There
is also the possibility that the primers for this gene are not strongly specific to any of the cDNA
sequences of the A. ocellaris tissues. This could result both forward and reverse primers binding
to multiple fragments as seen in the dilution wells. The dilutions were all composed of gDNA,
unlike the tissue samples, so there is a possibility of the amplified gene sequence being
interrupted by introns, which could cause varying band sizes. The concentration of cDNA of the
tissue sequences also may have had an effect on the gene expression in these tissues, resulting in
a low concentration of amplified DNA fragments, possibly below or just at a detection threshold,
producing the weak expression seen in the gel.

10. Figure 8: Gel electrophoresis results from PCR analysis of gene expression in tissues for
B3GAT2, OGT, B4GalT1, and MGAT5B from top left to bottom right.
Analysis of Gene Expression in Related Fish Species
The results from the gel electrophoresis showed differential gene expression in each of
the PCR products for the four genes. The expression of B4GalT1was sporadic but present in 3
tissue products; A. ocellaris gDNA, A. bicinctus, and A. clarkia. An error obviously occurred in
the first well, because this was the positive control sample and therefore should have shown
some sort of banding. However, this may have been due to the lack of expression of the
B4GalT1 gene in the skin tissue of the A. ocellaris cDNA, which was seen in the analysis of
gene expression in tissues. There is a slight possibility that using gill cDNA for this part of the
experiment may have proved more useful because of the faint expression shown in the same
experiment. Either way, the three tissue samples were used for PCR cleanup and sent off for
sequencing.

11. Figure 9: Gel electrophoresis results of gene expression in fish species related to A. ocellaris for
MGAT5B, B4GalT1, B3GAT2, and OGT respectively from top left to bottom right.
Phylogenetic Analysis of Related Gene Sequences
All of the chromatogram sequences came back extremely messy for the b4galt1 gene and
it was impossible to determine the gene sequence from them. Therefore, to conduct the
phylogenetic analysis and create a phylogenetic tree, the original contig sequence given for the
b4galt1 gene was used. The sequence was entered into BLASTn to derive seven similar gene
sequences from other species based on similarities in the nucleotide sequence rather than the
protein sequence. These gene sequences were then aligned with the contig sequence in the
CLUSTALW program to analyze nucleotide variation. From the results provided by
CLUSTALW, it was clear that only small sequence portions were relatable to the gene contig
sequence, even with relatively closely related species. Nevertheless, these results do tend to
correlate with the BLASTn results, as only four of the 7 most closely related sequences showed
similarities in more than 200 base pairs.

12. Figure 10: Results of the CLUSTALW alignments between gene sequences of different species
collected from BLASTn database
Abbreviations: AOC= Amphiprion ocellaris, SPA= Stegases partitus, LCR= Larimichthys
crocea, OLA= Orizyas latipes, NBR= Neolamprologus brichardi, OCU= Oryctolagus cuniculus,
TRU= Takifugu rubripes

13. Figure 11: Phylogenetic tree created by evolution of the B4GalT1 gene sequence in A. ocellaris
and related species
Using this sequence created a high level of difficulty with the alignments, and many of
these sequences had to be reverse complemented in order to achieve the results shown in Figure
10. The second portion of the alignment was the only alignment which displayed strong results
showing similarities between the different species sequences. This may be because this is the
only portion of the gene sequence that all of these species share, possibly due some sort of
genome reduction event. This level of similarity was only achieved by removing the last gene
sequence given in the BLASTn results, which belonged to Poecilia formosa. Basing the mutation
analysis off of this second alignment shown in Figure 10, and the phylogenetic tree created, there
appears to be one obvious nucleotide addition in the A. ocellaris sequence that is not included in
any of the other species. The tree shows that A. ocellaris was last to evolve, along with Stegases
partitus, suggesting that this mutation is an addition rather than a deletion. The b4galt1 gene
sequence appears to have evolved first from a common ancestor in Torafugu rubripes, although
there are a relatively small number of mutations between this sequence and A. ocellaris. This
distance may be attributed to the fact that T. rubripes has the smallest genome of all known
vertebrates (Gellner and Brenner, 1999), and therefore the gene sequence is just more truncated
compared to AOC. Overall, the nucleotide variations between the 7 different species observed
include a variety of transitions and transversions, some of them only seen between 2 species, and
some with nucleotide mutations between 3 or more species. For example, at one position distant
relatives TRU and AOC both have a guanine along with OLA and SPA, while NBR and LCR
both have a cytosine at that position, and OCU contains a thymine. The mutations among these
gene sequences between these species do not necessarily show any patterning, making the gene
evolution difficult to interpret.
Normally non-coding sequences tend to experience much higher rates of evolution
because they are more prone to greater rates of mutation. However, this sequence encodes a
protein coding gene that is highly expressed and so this explanation does not agree with the low
Abbreviations:
AOC= Amphiprion ocellaris
SPA= Stegasespartitus
LCR= Larimichthys crocea
OLA= Orizyas latipes
NBR= Neolamprologus brichardi
OCU= Oryctolagus cuniculus
TRU= Takifugu rubripes

14. similarity between the gene sequences. Moreover, it is a gene that is expressed in a variety of
tissues and its function is involved in a multitude of cellular processes, so such drastic alterations
to the sequences of a gene that is very frequently expressed is not normally seen (FANTOM
Consortium, 2014). With these observations being made, it is most likely that the amount of
discrepancy between the sequences is due to the fact that this gene was not able to be sequenced
clearly from the PCR reactions of the fish from the Amphiprion genus and related species. The
contig sequence of the b4galt1 gene was not as specific as the gene that would have been
sequenced by a better PCR result, and therefore it was difficult to find strong matches in the
BLAST database. Repeating these experiments with another set of primers or re-doing the
temperature optimization may have had different effects on the experiment’s findings as a whole.
Another hypothesis as to why these gene’s primers often bound weakly to multiple
sequences rather than producing one solid gene product may be related to the variable nature of
the gene itself. An extensive experiment carried out by the FANTOM Consortium in 2014
investigated differential gene expression in a host of mammalian transcriptomes by focusing on
the binding of active, capped RNA enhancers to transcriptome promoter regions in different
mammalian tissues. The article explains that B4GalT1 is highly expressed, especially in
mammals, and the promoter regions of such genes are often conserved evolutionarily. Then it
goes on to explain that it is in fact possible for multiple promoters to be linked to the same gene.
They also identified a transcription initiation region for B4GalT1 that has 6 unique regulatory
patterns (FANTOM Consortium, 2014). This evidence suggests that if B4GalT1 has 6 varying
regulatory patterns, it could have as many as 6 or more promoter or enhancer sequences
containing SNPs that allowed the primers to bind to multiple sequences in these experiments. If
the binding of variable enhancer RNAs is a driving force behind regulating the expression of this
gene in different tissues, it is possible that a lack of these enhancers in our PCR products resulted
in weak and sporadic expression of this gene in the fish transcriptomes. While it may be a
stretch, if this gene is expressed in almost every tissue type in mammals, it is possible that this is
also the case in some fish species. There may be multiple, conserved promoter sequences for this
one gene, and their expression could be differentially regulated in different tissues by specific
regulatory elements that have yet to be identified. More extensive study of this gene and its
promoter region may be key in gaining a better understanding of this gene’s function in the
anemonefish A. ocellaris as well as other symbiotic fish.

15. REFERENCES
Amado, M., R. Almeida, T. Schwientek, H. Clausen. 1999. Identification and characterization of
large galactosyltransferase gene families: galactosyltransferases for all functions.
Biochim Biophys Acta. 1473:35-53.
Anderson, P. A. V., C. Bouchard. 2009. The regulation of cnidocyte discharge. Toxicon. 54:
1046-1053.
Eisenberg, E., E.Y. Levanon. 2013. Human housekeeping genes, revisited. Trends in Genetics.
29(10):569-574.
The FANTOM Consortium and the RIKEN PMI and GLST (DGT). 2014. A promoter-level
mammalian expression atlas. Nature. 507:462-470.
Gellner, K., S. Brenner. 1999. Analysis of 148 kb of Genomic DNA Around the wnt1 Locus of
Fugu rubripes. Genome Res. 9(3): 251-258.
Lauc, G., JE Huffman, M. Pucic, L. Zgaga, B. Adamczyk, et al. 2013. Loci Associated with N-
Glycosylation of Human Immunoglobin G Show Pleiotropy with Autoimmune Diseases
and Haematological Cancers. PLoS Genetics. 9.1.
Mebs, D. 2009. Chemical biology of the mutualistic relationship of sea anemones with fish and
crustaceans. Toxicon. 54: 1071-1074.
Nixon, B., Q. Lu, M.J. Wassler, C.I. Foote, M.A. Ensslin, B.D. Shur. 2001. Galactosyltransferase
Function during Mammalian Fertilization. Cells Tissues Organs. 168: 46-57.
Qasba, PK., B. Ramakrishnan, E. Boeggeman. 2008. Structure and Function of β-1,4-
Galactosyltransferase. Curr Drug Targets. 9(4): 292-309.
Shaper N.L., M. Charron, N. Lo, J.H. Shaper. 1998. [beta] 1,4-galactosyltransferase and lactose
biosynthesis: Recruitment of a housekeeping gene from the nonmammalian vertebrate
gene pool for a mammary gland specific function. Journal of Mammary Gland Biology
and Neoplasia. 3(3): 315-324.
Uhlén, M., et. al. 2015. Tissue-based map of the human proteome. Science. 347(6220).
http://www.proteinatlas.org/ENSG00000086062-B4GALT1/tissue. Website accessed
5/4/2015.