SlideShare uma empresa Scribd logo
1 de 3
Bioc4010 Sample Questions:

1. A) What is the base call accuracy of a base in an Illumina sequenced short
read with a Q value of 20?
B) Is this better or worse than a Q value of 10?

Answer: A) Probability 1 in 100 or 99% call accuracy
B)Better. Q10 corresponds to a probability of 1 in 10 or 90% call accuracy


Formula: Q = -10 log10 P


2. What two primary advantages does exome sequencing provide over whole
genome sequencing?

Answer: Cost and data reduction. Exome capture limits the sequencing to known
protein-coding genes and some miRNAs.


3. Split and sort the string ‘CAPTAINKIRK’ into its appropriate suffix array

Answer:

Ainkirk
Aptainkirk
Captainkirk
Inkirk
Irk
K
Kirk
Nkirk
Ptainkirk
Rk
Tainkirk
4. Given a base-quality score threshold of Q30, the following short read
alignment, and reference sequence, what is the genotype (two alleles, eg
G/C)at the indicated position? Base qualities for the position are listed on the
side for each of the reads.




AGCTCCCAGGGTCCAG                                   Q29
          GTCCAGTCTCGGTT                           Q40
      CAGGGTCCAGTC                                 Q47
           TCCAGTCTCGGTTCCATC                      Q35
    CCCAGGGCCCAG                                   Q50
        GGGTCCAGTCTC                               Q31
   TCCCAGGGCC                                      Q10
       AGGGTCCAGT                                  Q45
 GCTCCCAGGGCCCAGTCT                                Q46
CTCCCAGGGCCC                                     Q33
CCAGGGTCCAGTCQ38
 GCTCCCAGGGCCCAGTCTCGG                              Q41
      CAGGGTCCAGTCTCG                               Q15
AGCTCCCAGGGTCCAGTCTCGGTTCCATCTA
           *

Answer: Discard the reads where the base quality score is below Q30. Sum up the
reference and alternate bases at the position. (T =6 , C = 4). Therefore the genotype
called is T/C (heterozygous).


5. Sort the following types of genetic variants into the categories: Potentially
Disease Causing, Unlikely to be Disease Causing

1. Splice Site
2. Non-Synonymous
3. Synonymous
4. FrameshiftIndel
5. Stop Loss
6. Stop Gain
7. Intronic (Non-Splice Site)
8. Intergenic


Answer:

Disease: 1, 2, 4, 5, 6
Non-Disease: 3, 7, 8
6) What is the primary motivation for using “next gen” sequencing methods
and modern genomics approaches to diagnosing human genetic diseases?

Answer: Cost

7) What does the base quality of a sequencing read tell you?

Answer: The base quality is equivalent to the probability of an incorrect base call.
(Also acceptable answer is the base call accuracy)

8) What problem does binary search address?

Answer: Efficiently searching the index of a genome

Mais conteúdo relacionado

Semelhante a Bioc4010 sample questions

Graph and assembly strategies for the MHC and ribosomal DNA regions
Graph and assembly strategies for the MHC and ribosomal DNA regionsGraph and assembly strategies for the MHC and ribosomal DNA regions
Graph and assembly strategies for the MHC and ribosomal DNA regionsGenome Reference Consortium
 
19_21Translation
19_21Translation19_21Translation
19_21TranslationKaren Lewis
 
Successful detection of 40 COSMIC hotspot mutations at allelic frequency belo...
Successful detection of 40 COSMIC hotspot mutations at allelic frequency belo...Successful detection of 40 COSMIC hotspot mutations at allelic frequency belo...
Successful detection of 40 COSMIC hotspot mutations at allelic frequency belo...Thermo Fisher Scientific
 
CDAC 2018 Pellegrini clustering ppi networks
CDAC 2018 Pellegrini clustering ppi networksCDAC 2018 Pellegrini clustering ppi networks
CDAC 2018 Pellegrini clustering ppi networksMarco Antoniotti
 
Pyrosequencing slide presentation rev3.
Pyrosequencing slide presentation rev3.Pyrosequencing slide presentation rev3.
Pyrosequencing slide presentation rev3.Robert Bruce
 
High throughput qPCR: tips for analysis across multiple plates
High throughput qPCR: tips for analysis across multiple platesHigh throughput qPCR: tips for analysis across multiple plates
High throughput qPCR: tips for analysis across multiple platesIntegrated DNA Technologies
 
[2020-09-01] IIBMP2020 Generating annotation texts of HLA sequences with anti...
[2020-09-01] IIBMP2020 Generating annotation texts of HLA sequences with anti...[2020-09-01] IIBMP2020 Generating annotation texts of HLA sequences with anti...
[2020-09-01] IIBMP2020 Generating annotation texts of HLA sequences with anti...Eli Kaminuma
 
Wang labsummer2010
Wang labsummer2010Wang labsummer2010
Wang labsummer2010russodl
 
Translating data to predictive models
Translating data to predictive modelsTranslating data to predictive models
Translating data to predictive modelsChemAxon
 
SNP genotyping using Affymetrix' Axiom Genotyping Solution
SNP genotyping using Affymetrix' Axiom Genotyping SolutionSNP genotyping using Affymetrix' Axiom Genotyping Solution
SNP genotyping using Affymetrix' Axiom Genotyping SolutionAffymetrix
 
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3QIAGEN
 
Aai 2007-pcr array-poster
Aai 2007-pcr array-posterAai 2007-pcr array-poster
Aai 2007-pcr array-posterElsa von Licy
 
Ascb 2007-pcr array-poster
Ascb 2007-pcr array-posterAscb 2007-pcr array-poster
Ascb 2007-pcr array-posterElsa von Licy
 
16 s rdna based microbial identification f
16 s rdna based microbial identification f16 s rdna based microbial identification f
16 s rdna based microbial identification fAman Kumar
 

Semelhante a Bioc4010 sample questions (20)

Graph and assembly strategies for the MHC and ribosomal DNA regions
Graph and assembly strategies for the MHC and ribosomal DNA regionsGraph and assembly strategies for the MHC and ribosomal DNA regions
Graph and assembly strategies for the MHC and ribosomal DNA regions
 
19_21Translation
19_21Translation19_21Translation
19_21Translation
 
Successful detection of 40 COSMIC hotspot mutations at allelic frequency belo...
Successful detection of 40 COSMIC hotspot mutations at allelic frequency belo...Successful detection of 40 COSMIC hotspot mutations at allelic frequency belo...
Successful detection of 40 COSMIC hotspot mutations at allelic frequency belo...
 
CDAC 2018 Pellegrini clustering ppi networks
CDAC 2018 Pellegrini clustering ppi networksCDAC 2018 Pellegrini clustering ppi networks
CDAC 2018 Pellegrini clustering ppi networks
 
In silico analysis for unknown data
In silico analysis for unknown dataIn silico analysis for unknown data
In silico analysis for unknown data
 
Validaternai
ValidaternaiValidaternai
Validaternai
 
Pyrosequencing slide presentation rev3.
Pyrosequencing slide presentation rev3.Pyrosequencing slide presentation rev3.
Pyrosequencing slide presentation rev3.
 
High throughput qPCR: tips for analysis across multiple plates
High throughput qPCR: tips for analysis across multiple platesHigh throughput qPCR: tips for analysis across multiple plates
High throughput qPCR: tips for analysis across multiple plates
 
[2020-09-01] IIBMP2020 Generating annotation texts of HLA sequences with anti...
[2020-09-01] IIBMP2020 Generating annotation texts of HLA sequences with anti...[2020-09-01] IIBMP2020 Generating annotation texts of HLA sequences with anti...
[2020-09-01] IIBMP2020 Generating annotation texts of HLA sequences with anti...
 
Wang labsummer2010
Wang labsummer2010Wang labsummer2010
Wang labsummer2010
 
Translating data to predictive models
Translating data to predictive modelsTranslating data to predictive models
Translating data to predictive models
 
SNP genotyping using Affymetrix' Axiom Genotyping Solution
SNP genotyping using Affymetrix' Axiom Genotyping SolutionSNP genotyping using Affymetrix' Axiom Genotyping Solution
SNP genotyping using Affymetrix' Axiom Genotyping Solution
 
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
 
Abrf poster2007
Abrf poster2007Abrf poster2007
Abrf poster2007
 
Aai 2007-pcr array-poster
Aai 2007-pcr array-posterAai 2007-pcr array-poster
Aai 2007-pcr array-poster
 
Ascb 2007-pcr array-poster
Ascb 2007-pcr array-posterAscb 2007-pcr array-poster
Ascb 2007-pcr array-poster
 
Agro pract 2
Agro pract 2Agro pract 2
Agro pract 2
 
17._mol_tools_i_21.pptx
17._mol_tools_i_21.pptx17._mol_tools_i_21.pptx
17._mol_tools_i_21.pptx
 
Pcrarraywhitepaper
PcrarraywhitepaperPcrarraywhitepaper
Pcrarraywhitepaper
 
16 s rdna based microbial identification f
16 s rdna based microbial identification f16 s rdna based microbial identification f
16 s rdna based microbial identification f
 

Mais de Dan Gaston

Population and evolutionary genetics 1
Population and evolutionary genetics 1Population and evolutionary genetics 1
Population and evolutionary genetics 1Dan Gaston
 
2016 ngs health_lecture
2016 ngs health_lecture2016 ngs health_lecture
2016 ngs health_lectureDan Gaston
 
Human genetics evolutionary genetics
Human genetics   evolutionary geneticsHuman genetics   evolutionary genetics
Human genetics evolutionary geneticsDan Gaston
 
Genomics, Bioinformatics, and Pathology
Genomics, Bioinformatics, and PathologyGenomics, Bioinformatics, and Pathology
Genomics, Bioinformatics, and PathologyDan Gaston
 
2015 Bioc4010 lecture1and2
2015 Bioc4010 lecture1and22015 Bioc4010 lecture1and2
2015 Bioc4010 lecture1and2Dan Gaston
 
2016 Dal Human Genetics - Genomics in Medicine Lecture
2016 Dal Human Genetics - Genomics in Medicine Lecture2016 Dal Human Genetics - Genomics in Medicine Lecture
2016 Dal Human Genetics - Genomics in Medicine LectureDan Gaston
 
Bioc4700 2014 Guest Lecture
Bioc4700   2014 Guest LectureBioc4700   2014 Guest Lecture
Bioc4700 2014 Guest LectureDan Gaston
 
Protein Evolution: Structure, Function, and Human Health
Protein Evolution: Structure, Function, and Human HealthProtein Evolution: Structure, Function, and Human Health
Protein Evolution: Structure, Function, and Human HealthDan Gaston
 
Bioc4010 lectures 1 and 2
Bioc4010 lectures 1 and 2Bioc4010 lectures 1 and 2
Bioc4010 lectures 1 and 2Dan Gaston
 
Dgaston dec-06-2012
Dgaston dec-06-2012Dgaston dec-06-2012
Dgaston dec-06-2012Dan Gaston
 
Bioinformatics in Gene Research
Bioinformatics in Gene ResearchBioinformatics in Gene Research
Bioinformatics in Gene ResearchDan Gaston
 

Mais de Dan Gaston (11)

Population and evolutionary genetics 1
Population and evolutionary genetics 1Population and evolutionary genetics 1
Population and evolutionary genetics 1
 
2016 ngs health_lecture
2016 ngs health_lecture2016 ngs health_lecture
2016 ngs health_lecture
 
Human genetics evolutionary genetics
Human genetics   evolutionary geneticsHuman genetics   evolutionary genetics
Human genetics evolutionary genetics
 
Genomics, Bioinformatics, and Pathology
Genomics, Bioinformatics, and PathologyGenomics, Bioinformatics, and Pathology
Genomics, Bioinformatics, and Pathology
 
2015 Bioc4010 lecture1and2
2015 Bioc4010 lecture1and22015 Bioc4010 lecture1and2
2015 Bioc4010 lecture1and2
 
2016 Dal Human Genetics - Genomics in Medicine Lecture
2016 Dal Human Genetics - Genomics in Medicine Lecture2016 Dal Human Genetics - Genomics in Medicine Lecture
2016 Dal Human Genetics - Genomics in Medicine Lecture
 
Bioc4700 2014 Guest Lecture
Bioc4700   2014 Guest LectureBioc4700   2014 Guest Lecture
Bioc4700 2014 Guest Lecture
 
Protein Evolution: Structure, Function, and Human Health
Protein Evolution: Structure, Function, and Human HealthProtein Evolution: Structure, Function, and Human Health
Protein Evolution: Structure, Function, and Human Health
 
Bioc4010 lectures 1 and 2
Bioc4010 lectures 1 and 2Bioc4010 lectures 1 and 2
Bioc4010 lectures 1 and 2
 
Dgaston dec-06-2012
Dgaston dec-06-2012Dgaston dec-06-2012
Dgaston dec-06-2012
 
Bioinformatics in Gene Research
Bioinformatics in Gene ResearchBioinformatics in Gene Research
Bioinformatics in Gene Research
 

Último

Congestive Cardiac Failure..presentation
Congestive Cardiac Failure..presentationCongestive Cardiac Failure..presentation
Congestive Cardiac Failure..presentationdeepaannamalai16
 
Grade Three -ELLNA-REVIEWER-ENGLISH.pptx
Grade Three -ELLNA-REVIEWER-ENGLISH.pptxGrade Three -ELLNA-REVIEWER-ENGLISH.pptx
Grade Three -ELLNA-REVIEWER-ENGLISH.pptxkarenfajardo43
 
How to Make a Duplicate of Your Odoo 17 Database
How to Make a Duplicate of Your Odoo 17 DatabaseHow to Make a Duplicate of Your Odoo 17 Database
How to Make a Duplicate of Your Odoo 17 DatabaseCeline George
 
week 1 cookery 8 fourth - quarter .pptx
week 1 cookery 8  fourth  -  quarter .pptxweek 1 cookery 8  fourth  -  quarter .pptx
week 1 cookery 8 fourth - quarter .pptxJonalynLegaspi2
 
Daily Lesson Plan in Mathematics Quarter 4
Daily Lesson Plan in Mathematics Quarter 4Daily Lesson Plan in Mathematics Quarter 4
Daily Lesson Plan in Mathematics Quarter 4JOYLYNSAMANIEGO
 
Mental Health Awareness - a toolkit for supporting young minds
Mental Health Awareness - a toolkit for supporting young mindsMental Health Awareness - a toolkit for supporting young minds
Mental Health Awareness - a toolkit for supporting young mindsPooky Knightsmith
 
Unraveling Hypertext_ Analyzing Postmodern Elements in Literature.pptx
Unraveling Hypertext_ Analyzing  Postmodern Elements in  Literature.pptxUnraveling Hypertext_ Analyzing  Postmodern Elements in  Literature.pptx
Unraveling Hypertext_ Analyzing Postmodern Elements in Literature.pptxDhatriParmar
 
BIOCHEMISTRY-CARBOHYDRATE METABOLISM CHAPTER 2.pptx
BIOCHEMISTRY-CARBOHYDRATE METABOLISM CHAPTER 2.pptxBIOCHEMISTRY-CARBOHYDRATE METABOLISM CHAPTER 2.pptx
BIOCHEMISTRY-CARBOHYDRATE METABOLISM CHAPTER 2.pptxSayali Powar
 
Q-Factor HISPOL Quiz-6th April 2024, Quiz Club NITW
Q-Factor HISPOL Quiz-6th April 2024, Quiz Club NITWQ-Factor HISPOL Quiz-6th April 2024, Quiz Club NITW
Q-Factor HISPOL Quiz-6th April 2024, Quiz Club NITWQuiz Club NITW
 
Using Grammatical Signals Suitable to Patterns of Idea Development
Using Grammatical Signals Suitable to Patterns of Idea DevelopmentUsing Grammatical Signals Suitable to Patterns of Idea Development
Using Grammatical Signals Suitable to Patterns of Idea Developmentchesterberbo7
 
Reading and Writing Skills 11 quarter 4 melc 1
Reading and Writing Skills 11 quarter 4 melc 1Reading and Writing Skills 11 quarter 4 melc 1
Reading and Writing Skills 11 quarter 4 melc 1GloryAnnCastre1
 
Grade 9 Quarter 4 Dll Grade 9 Quarter 4 DLL.pdf
Grade 9 Quarter 4 Dll Grade 9 Quarter 4 DLL.pdfGrade 9 Quarter 4 Dll Grade 9 Quarter 4 DLL.pdf
Grade 9 Quarter 4 Dll Grade 9 Quarter 4 DLL.pdfJemuel Francisco
 
4.16.24 Poverty and Precarity--Desmond.pptx
4.16.24 Poverty and Precarity--Desmond.pptx4.16.24 Poverty and Precarity--Desmond.pptx
4.16.24 Poverty and Precarity--Desmond.pptxmary850239
 
Q4-PPT-Music9_Lesson-1-Romantic-Opera.pptx
Q4-PPT-Music9_Lesson-1-Romantic-Opera.pptxQ4-PPT-Music9_Lesson-1-Romantic-Opera.pptx
Q4-PPT-Music9_Lesson-1-Romantic-Opera.pptxlancelewisportillo
 
Multi Domain Alias In the Odoo 17 ERP Module
Multi Domain Alias In the Odoo 17 ERP ModuleMulti Domain Alias In the Odoo 17 ERP Module
Multi Domain Alias In the Odoo 17 ERP ModuleCeline George
 
4.16.24 21st Century Movements for Black Lives.pptx
4.16.24 21st Century Movements for Black Lives.pptx4.16.24 21st Century Movements for Black Lives.pptx
4.16.24 21st Century Movements for Black Lives.pptxmary850239
 
Scientific Writing :Research Discourse
Scientific  Writing :Research  DiscourseScientific  Writing :Research  Discourse
Scientific Writing :Research DiscourseAnita GoswamiGiri
 
ICS2208 Lecture6 Notes for SL spaces.pdf
ICS2208 Lecture6 Notes for SL spaces.pdfICS2208 Lecture6 Notes for SL spaces.pdf
ICS2208 Lecture6 Notes for SL spaces.pdfVanessa Camilleri
 

Último (20)

Congestive Cardiac Failure..presentation
Congestive Cardiac Failure..presentationCongestive Cardiac Failure..presentation
Congestive Cardiac Failure..presentation
 
Grade Three -ELLNA-REVIEWER-ENGLISH.pptx
Grade Three -ELLNA-REVIEWER-ENGLISH.pptxGrade Three -ELLNA-REVIEWER-ENGLISH.pptx
Grade Three -ELLNA-REVIEWER-ENGLISH.pptx
 
How to Make a Duplicate of Your Odoo 17 Database
How to Make a Duplicate of Your Odoo 17 DatabaseHow to Make a Duplicate of Your Odoo 17 Database
How to Make a Duplicate of Your Odoo 17 Database
 
week 1 cookery 8 fourth - quarter .pptx
week 1 cookery 8  fourth  -  quarter .pptxweek 1 cookery 8  fourth  -  quarter .pptx
week 1 cookery 8 fourth - quarter .pptx
 
Daily Lesson Plan in Mathematics Quarter 4
Daily Lesson Plan in Mathematics Quarter 4Daily Lesson Plan in Mathematics Quarter 4
Daily Lesson Plan in Mathematics Quarter 4
 
Mental Health Awareness - a toolkit for supporting young minds
Mental Health Awareness - a toolkit for supporting young mindsMental Health Awareness - a toolkit for supporting young minds
Mental Health Awareness - a toolkit for supporting young minds
 
Unraveling Hypertext_ Analyzing Postmodern Elements in Literature.pptx
Unraveling Hypertext_ Analyzing  Postmodern Elements in  Literature.pptxUnraveling Hypertext_ Analyzing  Postmodern Elements in  Literature.pptx
Unraveling Hypertext_ Analyzing Postmodern Elements in Literature.pptx
 
BIOCHEMISTRY-CARBOHYDRATE METABOLISM CHAPTER 2.pptx
BIOCHEMISTRY-CARBOHYDRATE METABOLISM CHAPTER 2.pptxBIOCHEMISTRY-CARBOHYDRATE METABOLISM CHAPTER 2.pptx
BIOCHEMISTRY-CARBOHYDRATE METABOLISM CHAPTER 2.pptx
 
Q-Factor HISPOL Quiz-6th April 2024, Quiz Club NITW
Q-Factor HISPOL Quiz-6th April 2024, Quiz Club NITWQ-Factor HISPOL Quiz-6th April 2024, Quiz Club NITW
Q-Factor HISPOL Quiz-6th April 2024, Quiz Club NITW
 
Using Grammatical Signals Suitable to Patterns of Idea Development
Using Grammatical Signals Suitable to Patterns of Idea DevelopmentUsing Grammatical Signals Suitable to Patterns of Idea Development
Using Grammatical Signals Suitable to Patterns of Idea Development
 
Reading and Writing Skills 11 quarter 4 melc 1
Reading and Writing Skills 11 quarter 4 melc 1Reading and Writing Skills 11 quarter 4 melc 1
Reading and Writing Skills 11 quarter 4 melc 1
 
Grade 9 Quarter 4 Dll Grade 9 Quarter 4 DLL.pdf
Grade 9 Quarter 4 Dll Grade 9 Quarter 4 DLL.pdfGrade 9 Quarter 4 Dll Grade 9 Quarter 4 DLL.pdf
Grade 9 Quarter 4 Dll Grade 9 Quarter 4 DLL.pdf
 
4.16.24 Poverty and Precarity--Desmond.pptx
4.16.24 Poverty and Precarity--Desmond.pptx4.16.24 Poverty and Precarity--Desmond.pptx
4.16.24 Poverty and Precarity--Desmond.pptx
 
Q4-PPT-Music9_Lesson-1-Romantic-Opera.pptx
Q4-PPT-Music9_Lesson-1-Romantic-Opera.pptxQ4-PPT-Music9_Lesson-1-Romantic-Opera.pptx
Q4-PPT-Music9_Lesson-1-Romantic-Opera.pptx
 
Multi Domain Alias In the Odoo 17 ERP Module
Multi Domain Alias In the Odoo 17 ERP ModuleMulti Domain Alias In the Odoo 17 ERP Module
Multi Domain Alias In the Odoo 17 ERP Module
 
4.16.24 21st Century Movements for Black Lives.pptx
4.16.24 21st Century Movements for Black Lives.pptx4.16.24 21st Century Movements for Black Lives.pptx
4.16.24 21st Century Movements for Black Lives.pptx
 
prashanth updated resume 2024 for Teaching Profession
prashanth updated resume 2024 for Teaching Professionprashanth updated resume 2024 for Teaching Profession
prashanth updated resume 2024 for Teaching Profession
 
Scientific Writing :Research Discourse
Scientific  Writing :Research  DiscourseScientific  Writing :Research  Discourse
Scientific Writing :Research Discourse
 
Paradigm shift in nursing research by RS MEHTA
Paradigm shift in nursing research by RS MEHTAParadigm shift in nursing research by RS MEHTA
Paradigm shift in nursing research by RS MEHTA
 
ICS2208 Lecture6 Notes for SL spaces.pdf
ICS2208 Lecture6 Notes for SL spaces.pdfICS2208 Lecture6 Notes for SL spaces.pdf
ICS2208 Lecture6 Notes for SL spaces.pdf
 

Bioc4010 sample questions

  • 1. Bioc4010 Sample Questions: 1. A) What is the base call accuracy of a base in an Illumina sequenced short read with a Q value of 20? B) Is this better or worse than a Q value of 10? Answer: A) Probability 1 in 100 or 99% call accuracy B)Better. Q10 corresponds to a probability of 1 in 10 or 90% call accuracy Formula: Q = -10 log10 P 2. What two primary advantages does exome sequencing provide over whole genome sequencing? Answer: Cost and data reduction. Exome capture limits the sequencing to known protein-coding genes and some miRNAs. 3. Split and sort the string ‘CAPTAINKIRK’ into its appropriate suffix array Answer: Ainkirk Aptainkirk Captainkirk Inkirk Irk K Kirk Nkirk Ptainkirk Rk Tainkirk
  • 2. 4. Given a base-quality score threshold of Q30, the following short read alignment, and reference sequence, what is the genotype (two alleles, eg G/C)at the indicated position? Base qualities for the position are listed on the side for each of the reads. AGCTCCCAGGGTCCAG Q29 GTCCAGTCTCGGTT Q40 CAGGGTCCAGTC Q47 TCCAGTCTCGGTTCCATC Q35 CCCAGGGCCCAG Q50 GGGTCCAGTCTC Q31 TCCCAGGGCC Q10 AGGGTCCAGT Q45 GCTCCCAGGGCCCAGTCT Q46 CTCCCAGGGCCC Q33 CCAGGGTCCAGTCQ38 GCTCCCAGGGCCCAGTCTCGG Q41 CAGGGTCCAGTCTCG Q15 AGCTCCCAGGGTCCAGTCTCGGTTCCATCTA * Answer: Discard the reads where the base quality score is below Q30. Sum up the reference and alternate bases at the position. (T =6 , C = 4). Therefore the genotype called is T/C (heterozygous). 5. Sort the following types of genetic variants into the categories: Potentially Disease Causing, Unlikely to be Disease Causing 1. Splice Site 2. Non-Synonymous 3. Synonymous 4. FrameshiftIndel 5. Stop Loss 6. Stop Gain 7. Intronic (Non-Splice Site) 8. Intergenic Answer: Disease: 1, 2, 4, 5, 6 Non-Disease: 3, 7, 8
  • 3. 6) What is the primary motivation for using “next gen” sequencing methods and modern genomics approaches to diagnosing human genetic diseases? Answer: Cost 7) What does the base quality of a sequencing read tell you? Answer: The base quality is equivalent to the probability of an incorrect base call. (Also acceptable answer is the base call accuracy) 8) What problem does binary search address? Answer: Efficiently searching the index of a genome