Martin presented a talk about NGS in Forensics Genetics and discussed examples using the GS Junior. Sponsored talk by Roche.

1. NGS in Forensics Genetics – Examples using the
GS Junior
Martin Mikkelsen
Section of Forensic Genetics, Department of Forensic Medicine, Faculty
of Health and Medical Sciences, University of Copenhagen

2. Current methods used in Forensic Genetics
SNPs/DIPs
X-chromosome
Y-chromosomes
mtDNA
Autosomal STR
typing

3. Agenda
 Examples using the GS Junior in Forensic Genetics
 STR sequencing
 mtDNA sequencing
 Future aspects of NGS in Forensic Genetics
GS Junior at Department of Forensic Medicine, Copenhagen

4. STR sequencing

5. STR-systems
An accordion-like DNA sequence that occurs between genes
TCCCAAGCTCTTCCTCTTCCCTAGATCAATACAGACAGAAGACA
GGTGGATAGATAGATAGATAGATAGATAGATAGATAGAT
AGATAGATAGATATCATTGAAAGACAAAACAGAGATGGATGA
TAGATACATGCTTACAGATGCACAC
= 12 GATA repeats (“12” is all that is reported)
7 repeats Homozygote = both
8 repeats alleles are of the same
9 repeats length
10 repeats
Heterozygote = alleles
11 repeats
12 repeats
differ and can be resolved
from one another
13 repeats
Target region
(Short Tandem Repeat)

6. Variation in STRs
 Detectable with CE  Not-detectable with CE
based methods: based methods:
 Variation in the number  Base substitutions
of repeat units  Inversions of two or
 Insertion and deletion more nucleotides
of one or more  Mutation in the primer
nucleotides in the binding site
amplified region

7. STR typing by sequencing using NGS
Proof-of-concept:
The long read length allows for sequencing of the whole STR
region including flanking regions
Clonal amplification allows for separation of the alleles and
haplotyping

8. Examples using the GS Junior to sequence STRs
 DS21S11
 Included in most STR
typing kits
 A complex STR-system
 3 repeat regions
[TCTA]X[TCTG]X[TCTA]3TA[TCTA]3TCA[TCTA]2TCCATA[TCTA]X
A B C

9. Case with three alleles
Child
28;30;32.2
Mother
30;32.2 28;30 30;32.2
Father
28;30;32.2 28;30
A B C

10. “Hidden” heterozygosis
A B C

11. Deletion outside the repeat region
Observed in two Somali samples
A B C

12. mtDNA sequencing

13. mtDNA in Forensic Genetics?
 Cases with little or no autosomal DNA
 Complicated kinship cases where the maternal inheritance
needs to be investigated
 Current mtDNA investigations:
 Sanger sequencing of HV1 and HV2, or control region
 Typing of selected SNPs in the coding region
 Advantages of full mtDNA sequencing:
 15x more information than the control region
 Increasing power of discrimination
 MtDNA contains heteroplasmy

14. Sequencing mtDNA at Section of Forensic Genetics
• Sequencing of the whole mtDNA using the GS Junior
• 20 samples in one run
• High coverage (estimated coverage ~ 100x)
• Must be able to detect and quantify heteroplasmy

15. mtDNA sequencing run
Cardiac 4
RUN data:
Reads: 137091
Bases: 58760702
averageLength: 428,626
averageQuality: 30,251
Mapped Avg. Map
No. reads %-mapped Contig Avg. Depth
reads Length:
Sample 1 3231 3173 98% 1 76,8 400
Sample 2 4428 4362 99% 1 107,8 408
Sample 3 6114 6028 99% 1 151,2 414
Sample 4 8561 8433 99% 1 215,1 422
Sample 5 6087 5985 98% 1 150,1 415
Sample 6 5572 5475 98% 1 137,5 415
Sample 7 6376 6268 98% 1 156,7 413
Sample 8 4445 4359 98% 1 108,4 411
Sample 9 7040 6922 98% 1 173,8 415
Sample 10 4239 4175 98% 1 105,2 416
Sample 11 5379 5307 99% 1 134,8 420
Sample 12 6775 6673 98% 1 166,8 413
Sample 13 6574 6481 99% 1 165,8 423
Sample 14 4186 4105 98% 1 103,1 415
Sample 15 6110 6002 98% 1 153,7 423
Sample 16 10852 10698 99% 1 273,9 423
Sample 17 9205 9066 98% 1 233,5 426
Sample 18 11663 11472 98% 1 297,5 429
Sample 19 10996 10815 98% 1 278,3 425
Sample 20 8827 8680 98% 1 218,2 415
Avg. 170,41

16. Heteroplasmy
Point heteroplasmy at pos. 195

17. What does NGS give to forensic genetics?
A higher throughput!
STRs:
 A system that is fully compatible with current used
technology
Database Profiles in database
CODIS (USA) 9,404,747
NDDNA (UK) 5,512,776
March 2011
 Additional information from STR systems increasing the
power of discrimination
mtDNA:
 Easy sequencing of the entire mtDNA
 Detection and quantification of heteroplasmy

18. Future aspects of NGS
in forensics

19. Future aspects of NGS in forensics
Molecular autopsy
Cardiac gene sequencing project
 585 regions from 33 cardiac genes
 Involved in electrical conduction in the heart
 Captured using NimbleGen SeqCap EZ Library
 Can be sequenced on the GS Junior with one run
Will provide additional information to pathologist performing
the autopsy

20. Future aspects of NGS in forensics
Patient suffering from Brugada syndrome
Carrying a mutation in the SCN5A gene (R121W)

21. Future aspects of NGS in forensics
Forensic
Toxicology
Forensic
NGS Genetics
Forensic
Pathology
The ultimate forensic
autopsy report

22. Acknowledgements
Section of Forensic Genetics:
Marlene Andersen
Stine Hansen
And…
Eszter Rockenbauer
Anders J. Hansen
Rune Frank-Hansen
Claus Børsting
Michael Stangegaard
Niels Morling
Anja Jørgensen
Nadia Jochumsen
Maibritt Sigvardt