SlideShare a Scribd company logo
1 of 21
 
Signal transduction and transcription control omgeving Transcriptie apparaat mRNA mRNA export mRNA afbraak translatie signaal transductie
Signal transduction and transcription control signaal signaal transductie
Signal transduction and transcription control example  RTK/Ras/MAPK cell membrane GTP GDP RAF MEK ERK ELK, SAP2, etc. grb2 shc mSOS RAS RAS
Signal transduction and transcription control RTK/Ras/MAPK extended version
Signal transduction and transcription control example: the Wnt pathway P P dsh APC axin GSK3  -catenin  -catenin P P ubi ubi ubi ubi ubi ubi  -catenin  -catenin
Signal transduction and transcription control the Wnt pathway the extended version
The PI3K/PKB/FOXO module PI3K PI-3P PTEN PI PKB FOXO FOXO1=FKHR FOXO3=FKHR-L1 FOXO4=AFX cell membrane PDK1 nucleus
Measuring transcriptional activity Reporter (luciferase) RT-PCR Northern Protein Expression arrays
the FOXO3a-ER fusion gene ER HSP HSP HSP HSP 4-OHT ER HSP HSP HSP HSP 4-OHT inactive active DB DB
Measure mRNA Does regulation occur through transcription? p27 cdk2 0 8 4 Hr of 4-OHT Does the 5’ regulatory region harbor  a protein binding site: EMSA Does this drive transcription: luciferase assay
Reporter assays FOXO PKB PKB ? FOXO PKB
Reporter assays Single molecule fish ………… acgaagtctagaggtcgattagatcgagcgataagcttcaggaacctgatacgatgatgccccttatagtatagta…………………… tgcttca ctagct tcgaagt tgctact
Native PAAGE Protein DNA interaction in vitro 32-P-GGAATTCG 1.  Label double-stranded DNA (oligonucleotide with binding element ) 2. Incubate with protein 32-P-GGAATTCG 3. Compete with specific (a) or non-specific oligonucleotide (b) 4. Incubate with specific (a) or control antibody (b) 2 1 3a 3b 4a 4b
Reporter assays in vivo Signalling conserved through evolution C.elegans   Mammalians Daf-2 FoxO PKB PI3K Ins/IGF-R Daf-18 Age-1 Akt-1 Daf-16 PTEN SOD-3 MnSOD
A GFP reporter of the DAF-16/FOXO  regulated MnSOD ortholog  sod-3 Honda and Honda, 1999 wild type daf-2(e1370) daf-2(sa189) -130 -380 FOXO binding sites GFP BamHI sod-3 locus sod-3::gfp sod-3::gfp transgenic animal on food
Starvation and DAF-2 inactivation induce DAF-16 dependent expression of SOD-3::GFP SOD-3::GFP levels Relative GFP level ± SEM Food Temperature + 20 + 20 + 25 - 20 - 20 wild type daf-16(mu86) daf-2 (e1370) wild type on food wild type starved daf-16(mu86)  on food daf-16(mu86)  starved daf-2(e1370 ) at 25 o C A E D C B
Paraquat induces DAF-16/FOXO dependent  expression of SOD-3::GFP wild type wild type daf-16(mu86) daf-16(mu86) 0.25 mM Paraquat Control wild type daf-16(mu86) SOD-3::GFP levels Measured after 48 hrs growth on Paraquat containing plates started with synchronized L1 larvae
ChIP PCR and analyze Does regulation occur through transcription? Chromatin immunoprecipitation or Chip
Microarray genome-wide location analysis (aka ChIP on chip) Microarray e.g. 100 kbp (44 000 features 1 probe every ~250 bp) #2 Elutie DNA Massive parallel sequencing
DNA microarrays and gene expression regulation analyzing the genome instead of one gene omgeving signaal transductie 10 000’s genes

More Related Content

What's hot

Translation lgis
Translation lgisTranslation lgis
Translation lgisZahid Azeem
 
Post Transcriptional Modifications
Post Transcriptional ModificationsPost Transcriptional Modifications
Post Transcriptional ModificationsSrishti Pandey
 
090630 Ion Cannel Retreat
090630 Ion Cannel Retreat090630 Ion Cannel Retreat
090630 Ion Cannel RetreatRalf02
 
The discovery of AZD4547
The discovery of AZD4547The discovery of AZD4547
The discovery of AZD4547David Andrews
 
Poster Plant Research (2)
Poster Plant Research (2)Poster Plant Research (2)
Poster Plant Research (2)Kayla Arroyo
 
Michael Bauer - How can dye-dilution help us? - IFAD 2011
Michael Bauer - How can dye-dilution help us? - IFAD 2011Michael Bauer - How can dye-dilution help us? - IFAD 2011
Michael Bauer - How can dye-dilution help us? - IFAD 2011International Fluid Academy
 
Estrogen, mTOR, and Metastasis
Estrogen, mTOR, and MetastasisEstrogen, mTOR, and Metastasis
Estrogen, mTOR, and Metastasisdgotto
 
Seminario molecular[1] listo
Seminario molecular[1] listoSeminario molecular[1] listo
Seminario molecular[1] listozapata25
 
Small molecule inhibitors of PI4 Kinase
Small molecule inhibitors of PI4 KinaseSmall molecule inhibitors of PI4 Kinase
Small molecule inhibitors of PI4 KinaseDavid Andrews
 
Transcription process slides
Transcription process slidesTranscription process slides
Transcription process slidesJoydeep16
 
Window of endometrial receptivity1
Window of endometrial receptivity1Window of endometrial receptivity1
Window of endometrial receptivity1鋒博 蔡
 
Talk at Developmental Workshop NIH
Talk at Developmental Workshop NIHTalk at Developmental Workshop NIH
Talk at Developmental Workshop NIHIvan Krivega
 

What's hot (20)

Translation lgis
Translation lgisTranslation lgis
Translation lgis
 
Transcription NEW
Transcription NEWTranscription NEW
Transcription NEW
 
AAACR Talk 2009
AAACR Talk 2009AAACR Talk 2009
AAACR Talk 2009
 
RNA polymerase
RNA polymeraseRNA polymerase
RNA polymerase
 
Post Transcriptional Modifications
Post Transcriptional ModificationsPost Transcriptional Modifications
Post Transcriptional Modifications
 
Transcription
TranscriptionTranscription
Transcription
 
IPA for DNA analysis
IPA for DNA analysisIPA for DNA analysis
IPA for DNA analysis
 
090630 Ion Cannel Retreat
090630 Ion Cannel Retreat090630 Ion Cannel Retreat
090630 Ion Cannel Retreat
 
The discovery of AZD4547
The discovery of AZD4547The discovery of AZD4547
The discovery of AZD4547
 
Poster Plant Research (2)
Poster Plant Research (2)Poster Plant Research (2)
Poster Plant Research (2)
 
Dna sequencing
Dna sequencingDna sequencing
Dna sequencing
 
Michael Bauer - How can dye-dilution help us? - IFAD 2011
Michael Bauer - How can dye-dilution help us? - IFAD 2011Michael Bauer - How can dye-dilution help us? - IFAD 2011
Michael Bauer - How can dye-dilution help us? - IFAD 2011
 
Estrogen, mTOR, and Metastasis
Estrogen, mTOR, and MetastasisEstrogen, mTOR, and Metastasis
Estrogen, mTOR, and Metastasis
 
Factor H binding protein and vaccine approaches
Factor H binding protein and vaccine approachesFactor H binding protein and vaccine approaches
Factor H binding protein and vaccine approaches
 
Seminario molecular[1] listo
Seminario molecular[1] listoSeminario molecular[1] listo
Seminario molecular[1] listo
 
Small molecule inhibitors of PI4 Kinase
Small molecule inhibitors of PI4 KinaseSmall molecule inhibitors of PI4 Kinase
Small molecule inhibitors of PI4 Kinase
 
Transcription process slides
Transcription process slidesTranscription process slides
Transcription process slides
 
Genetic code and translation
Genetic code and translationGenetic code and translation
Genetic code and translation
 
Window of endometrial receptivity1
Window of endometrial receptivity1Window of endometrial receptivity1
Window of endometrial receptivity1
 
Talk at Developmental Workshop NIH
Talk at Developmental Workshop NIHTalk at Developmental Workshop NIH
Talk at Developmental Workshop NIH
 

Viewers also liked

Presentation cellmole
Presentation cellmolePresentation cellmole
Presentation cellmoleHotaru Imai
 
Tyrosine kinase report
Tyrosine kinase reportTyrosine kinase report
Tyrosine kinase reportjinx11
 
Signal transduction in plant defence responses
Signal transduction in plant defence responsesSignal transduction in plant defence responses
Signal transduction in plant defence responsesrkravikirankt
 
Second Messenger: cAMP Pathway
Second Messenger: cAMP PathwaySecond Messenger: cAMP Pathway
Second Messenger: cAMP PathwayHotaru Imai
 
Receptor tyrosine kinase
Receptor tyrosine kinaseReceptor tyrosine kinase
Receptor tyrosine kinaseSobia
 
Cellular signal transduction pathways under abiotic stress
Cellular signal transduction pathways under abiotic stressCellular signal transduction pathways under abiotic stress
Cellular signal transduction pathways under abiotic stressSenthil Natesan
 
Signal Tansduction Kel 4
Signal Tansduction Kel 4Signal Tansduction Kel 4
Signal Tansduction Kel 4dewisetiyana52
 
Receptors and signal transduction
Receptors and signal transductionReceptors and signal transduction
Receptors and signal transductionaljeirou
 
Signal transduction presentation
Signal transduction presentationSignal transduction presentation
Signal transduction presentationManish Kumar
 
Lipid metabolism
Lipid  metabolismLipid  metabolism
Lipid metabolismhussamdr
 
Designfo#{1} #{2}trangers
Designfo#{1} #{2}trangersDesignfo#{1} #{2}trangers
Designfo#{1} #{2}trangersguest0437b8
 
Videosssssssssssssssssssssssssssssssssssssssssss[1]
Videosssssssssssssssssssssssssssssssssssssssssss[1]Videosssssssssssssssssssssssssssssssssssssssssss[1]
Videosssssssssssssssssssssssssssssssssssssssssss[1]gueste33163
 

Viewers also liked (20)

Presentation cellmole
Presentation cellmolePresentation cellmole
Presentation cellmole
 
Cell signaling
Cell signaling Cell signaling
Cell signaling
 
Third messanger
Third messangerThird messanger
Third messanger
 
NF-kB
NF-kBNF-kB
NF-kB
 
Tyrosine kinase report
Tyrosine kinase reportTyrosine kinase report
Tyrosine kinase report
 
Signal transduction in plant defence responses
Signal transduction in plant defence responsesSignal transduction in plant defence responses
Signal transduction in plant defence responses
 
Signal transduction
Signal transductionSignal transduction
Signal transduction
 
Second Messenger: cAMP Pathway
Second Messenger: cAMP PathwaySecond Messenger: cAMP Pathway
Second Messenger: cAMP Pathway
 
Receptor tyrosine kinase
Receptor tyrosine kinaseReceptor tyrosine kinase
Receptor tyrosine kinase
 
Cellular signal transduction pathways under abiotic stress
Cellular signal transduction pathways under abiotic stressCellular signal transduction pathways under abiotic stress
Cellular signal transduction pathways under abiotic stress
 
Signal Tansduction Kel 4
Signal Tansduction Kel 4Signal Tansduction Kel 4
Signal Tansduction Kel 4
 
Receptors and signal transduction
Receptors and signal transductionReceptors and signal transduction
Receptors and signal transduction
 
Introduction of cell signaling
Introduction of cell signalingIntroduction of cell signaling
Introduction of cell signaling
 
Signal transduction presentation
Signal transduction presentationSignal transduction presentation
Signal transduction presentation
 
Lipid metabolism
Lipid  metabolismLipid  metabolism
Lipid metabolism
 
Copper Laser Slats
Copper Laser SlatsCopper Laser Slats
Copper Laser Slats
 
Designfo#{1} #{2}trangers
Designfo#{1} #{2}trangersDesignfo#{1} #{2}trangers
Designfo#{1} #{2}trangers
 
Alum.Es
Alum.EsAlum.Es
Alum.Es
 
Added Value Luxury Archetypes
Added Value Luxury ArchetypesAdded Value Luxury Archetypes
Added Value Luxury Archetypes
 
Videosssssssssssssssssssssssssssssssssssssssssss[1]
Videosssssssssssssssssssssssssssssssssssssssssss[1]Videosssssssssssssssssssssssssssssssssssssssssss[1]
Videosssssssssssssssssssssssssssssssssssssssssss[1]
 

Similar to Collegepart B.Burgering Deel 1

6 RTK signaling MAPK Akt.pdfCell signaling presentation
6 RTK signaling MAPK Akt.pdfCell signaling presentation6 RTK signaling MAPK Akt.pdfCell signaling presentation
6 RTK signaling MAPK Akt.pdfCell signaling presentationvincentlangat14
 
The R T K R A S M E K Signaling Pathway By Lenard Tardio
The  R T K  R A S  M E K  Signaling  Pathway By  Lenard  TardioThe  R T K  R A S  M E K  Signaling  Pathway By  Lenard  Tardio
The R T K R A S M E K Signaling Pathway By Lenard TardioDickinson Lab Lab
 
Barshop December 2011
Barshop December 2011Barshop December 2011
Barshop December 2011Sky Lar
 
Chemokine signaling pathway
Chemokine signaling pathwayChemokine signaling pathway
Chemokine signaling pathwayCreative BioMart
 
"The role of the nuclear factor TDP 43 in neurodegeneration" by Francisco E. ...
"The role of the nuclear factor TDP 43 in neurodegeneration" by Francisco E. ..."The role of the nuclear factor TDP 43 in neurodegeneration" by Francisco E. ...
"The role of the nuclear factor TDP 43 in neurodegeneration" by Francisco E. ...Vall d'Hebron Institute of Research (VHIR)
 
Beta Globin Gene Cluster
Beta Globin Gene Cluster Beta Globin Gene Cluster
Beta Globin Gene Cluster alirezaplus
 
Mapk cascade
Mapk cascadeMapk cascade
Mapk cascadeonlyasim
 
Expression systems
Expression systemsExpression systems
Expression systemsBruno Mmassy
 
Map kinase and jak stat pathway
Map kinase and jak stat pathway Map kinase and jak stat pathway
Map kinase and jak stat pathway DHINESHKUMAR V
 
Discriminating Facts from Artefacts in the Secreted Ly-6 Protein Family
Discriminating Facts from Artefacts in the Secreted Ly-6 Protein FamilyDiscriminating Facts from Artefacts in the Secreted Ly-6 Protein Family
Discriminating Facts from Artefacts in the Secreted Ly-6 Protein FamilyChris Southan
 
Student day 2012 4 1-2012
Student day 2012 4 1-2012 Student day 2012 4 1-2012
Student day 2012 4 1-2012 Sky Lar
 
RNA interference in Crop Improvement
RNA interference in Crop ImprovementRNA interference in Crop Improvement
RNA interference in Crop ImprovementKanmani Bharathi J
 
UIowa 2005 - Iowa City, IA
UIowa 2005 - Iowa City, IAUIowa 2005 - Iowa City, IA
UIowa 2005 - Iowa City, IARandy Simpson
 
Mock Qualifying Exam
Mock Qualifying ExamMock Qualifying Exam
Mock Qualifying ExamSky Lar
 
Digestive Disease Week 2017 Discovery of dual LXR/GPBAR1
Digestive Disease Week 2017 Discovery of dual LXR/GPBAR1Digestive Disease Week 2017 Discovery of dual LXR/GPBAR1
Digestive Disease Week 2017 Discovery of dual LXR/GPBAR1Attività scientifica
 

Similar to Collegepart B.Burgering Deel 1 (20)

6 RTK signaling MAPK Akt.pdfCell signaling presentation
6 RTK signaling MAPK Akt.pdfCell signaling presentation6 RTK signaling MAPK Akt.pdfCell signaling presentation
6 RTK signaling MAPK Akt.pdfCell signaling presentation
 
The R T K R A S M E K Signaling Pathway By Lenard Tardio
The  R T K  R A S  M E K  Signaling  Pathway By  Lenard  TardioThe  R T K  R A S  M E K  Signaling  Pathway By  Lenard  Tardio
The R T K R A S M E K Signaling Pathway By Lenard Tardio
 
Barshop December 2011
Barshop December 2011Barshop December 2011
Barshop December 2011
 
Chemokine signaling pathway
Chemokine signaling pathwayChemokine signaling pathway
Chemokine signaling pathway
 
Gabe%27s poster II
Gabe%27s poster IIGabe%27s poster II
Gabe%27s poster II
 
Map kinase
Map kinaseMap kinase
Map kinase
 
Debanjan summer
Debanjan summerDebanjan summer
Debanjan summer
 
"The role of the nuclear factor TDP 43 in neurodegeneration" by Francisco E. ...
"The role of the nuclear factor TDP 43 in neurodegeneration" by Francisco E. ..."The role of the nuclear factor TDP 43 in neurodegeneration" by Francisco E. ...
"The role of the nuclear factor TDP 43 in neurodegeneration" by Francisco E. ...
 
Beta Globin Gene Cluster
Beta Globin Gene Cluster Beta Globin Gene Cluster
Beta Globin Gene Cluster
 
Mapk cascade
Mapk cascadeMapk cascade
Mapk cascade
 
Cell 671
Cell 671Cell 671
Cell 671
 
Expression systems
Expression systemsExpression systems
Expression systems
 
Map kinase and jak stat pathway
Map kinase and jak stat pathway Map kinase and jak stat pathway
Map kinase and jak stat pathway
 
Discriminating Facts from Artefacts in the Secreted Ly-6 Protein Family
Discriminating Facts from Artefacts in the Secreted Ly-6 Protein FamilyDiscriminating Facts from Artefacts in the Secreted Ly-6 Protein Family
Discriminating Facts from Artefacts in the Secreted Ly-6 Protein Family
 
Student day 2012 4 1-2012
Student day 2012 4 1-2012 Student day 2012 4 1-2012
Student day 2012 4 1-2012
 
RNA interference in Crop Improvement
RNA interference in Crop ImprovementRNA interference in Crop Improvement
RNA interference in Crop Improvement
 
UIowa 2005 - Iowa City, IA
UIowa 2005 - Iowa City, IAUIowa 2005 - Iowa City, IA
UIowa 2005 - Iowa City, IA
 
Mock Qualifying Exam
Mock Qualifying ExamMock Qualifying Exam
Mock Qualifying Exam
 
RNA Metabolism
RNA MetabolismRNA Metabolism
RNA Metabolism
 
Digestive Disease Week 2017 Discovery of dual LXR/GPBAR1
Digestive Disease Week 2017 Discovery of dual LXR/GPBAR1Digestive Disease Week 2017 Discovery of dual LXR/GPBAR1
Digestive Disease Week 2017 Discovery of dual LXR/GPBAR1
 

More from BMW, Utrecht University (11)

Downregulation Van Groeifactorsignaaltransductie2009 Deel2b
Downregulation Van Groeifactorsignaaltransductie2009 Deel2bDownregulation Van Groeifactorsignaaltransductie2009 Deel2b
Downregulation Van Groeifactorsignaaltransductie2009 Deel2b
 
Downregulation Van Groeifactorsignaaltransductie2009 Deel2
Downregulation Van Groeifactorsignaaltransductie2009 Deel2Downregulation Van Groeifactorsignaaltransductie2009 Deel2
Downregulation Van Groeifactorsignaaltransductie2009 Deel2
 
Downregulation Deel2
Downregulation Deel2Downregulation Deel2
Downregulation Deel2
 
Downregulation Deel1
Downregulation Deel1Downregulation Deel1
Downregulation Deel1
 
College Medema 2
College Medema 2College Medema 2
College Medema 2
 
College Medema 1
College Medema 1College Medema 1
College Medema 1
 
Cytoskelet Plus Matrix Deel2
Cytoskelet Plus Matrix Deel2Cytoskelet Plus Matrix Deel2
Cytoskelet Plus Matrix Deel2
 
Cytoskelet Plus Matrix Deel 1
Cytoskelet Plus Matrix Deel 1Cytoskelet Plus Matrix Deel 1
Cytoskelet Plus Matrix Deel 1
 
Collegepart B.Burgering Deel 2
Collegepart B.Burgering Deel 2Collegepart B.Burgering Deel 2
Collegepart B.Burgering Deel 2
 
Signaaltransductie Bos Deel2
Signaaltransductie  Bos Deel2Signaaltransductie  Bos Deel2
Signaaltransductie Bos Deel2
 
Bos 18112009 1
Bos 18112009 1Bos 18112009 1
Bos 18112009 1
 

Collegepart B.Burgering Deel 1

  • 1.  
  • 2. Signal transduction and transcription control omgeving Transcriptie apparaat mRNA mRNA export mRNA afbraak translatie signaal transductie
  • 3. Signal transduction and transcription control signaal signaal transductie
  • 4. Signal transduction and transcription control example RTK/Ras/MAPK cell membrane GTP GDP RAF MEK ERK ELK, SAP2, etc. grb2 shc mSOS RAS RAS
  • 5. Signal transduction and transcription control RTK/Ras/MAPK extended version
  • 6. Signal transduction and transcription control example: the Wnt pathway P P dsh APC axin GSK3  -catenin  -catenin P P ubi ubi ubi ubi ubi ubi  -catenin  -catenin
  • 7. Signal transduction and transcription control the Wnt pathway the extended version
  • 8. The PI3K/PKB/FOXO module PI3K PI-3P PTEN PI PKB FOXO FOXO1=FKHR FOXO3=FKHR-L1 FOXO4=AFX cell membrane PDK1 nucleus
  • 9. Measuring transcriptional activity Reporter (luciferase) RT-PCR Northern Protein Expression arrays
  • 10. the FOXO3a-ER fusion gene ER HSP HSP HSP HSP 4-OHT ER HSP HSP HSP HSP 4-OHT inactive active DB DB
  • 11. Measure mRNA Does regulation occur through transcription? p27 cdk2 0 8 4 Hr of 4-OHT Does the 5’ regulatory region harbor a protein binding site: EMSA Does this drive transcription: luciferase assay
  • 12. Reporter assays FOXO PKB PKB ? FOXO PKB
  • 13. Reporter assays Single molecule fish ………… acgaagtctagaggtcgattagatcgagcgataagcttcaggaacctgatacgatgatgccccttatagtatagta…………………… tgcttca ctagct tcgaagt tgctact
  • 14. Native PAAGE Protein DNA interaction in vitro 32-P-GGAATTCG 1. Label double-stranded DNA (oligonucleotide with binding element ) 2. Incubate with protein 32-P-GGAATTCG 3. Compete with specific (a) or non-specific oligonucleotide (b) 4. Incubate with specific (a) or control antibody (b) 2 1 3a 3b 4a 4b
  • 15. Reporter assays in vivo Signalling conserved through evolution C.elegans Mammalians Daf-2 FoxO PKB PI3K Ins/IGF-R Daf-18 Age-1 Akt-1 Daf-16 PTEN SOD-3 MnSOD
  • 16. A GFP reporter of the DAF-16/FOXO regulated MnSOD ortholog sod-3 Honda and Honda, 1999 wild type daf-2(e1370) daf-2(sa189) -130 -380 FOXO binding sites GFP BamHI sod-3 locus sod-3::gfp sod-3::gfp transgenic animal on food
  • 17. Starvation and DAF-2 inactivation induce DAF-16 dependent expression of SOD-3::GFP SOD-3::GFP levels Relative GFP level ± SEM Food Temperature + 20 + 20 + 25 - 20 - 20 wild type daf-16(mu86) daf-2 (e1370) wild type on food wild type starved daf-16(mu86) on food daf-16(mu86) starved daf-2(e1370 ) at 25 o C A E D C B
  • 18. Paraquat induces DAF-16/FOXO dependent expression of SOD-3::GFP wild type wild type daf-16(mu86) daf-16(mu86) 0.25 mM Paraquat Control wild type daf-16(mu86) SOD-3::GFP levels Measured after 48 hrs growth on Paraquat containing plates started with synchronized L1 larvae
  • 19. ChIP PCR and analyze Does regulation occur through transcription? Chromatin immunoprecipitation or Chip
  • 20. Microarray genome-wide location analysis (aka ChIP on chip) Microarray e.g. 100 kbp (44 000 features 1 probe every ~250 bp) #2 Elutie DNA Massive parallel sequencing
  • 21. DNA microarrays and gene expression regulation analyzing the genome instead of one gene omgeving signaal transductie 10 000’s genes