6. Signal transduction and transcription control example: the Wnt pathway P P dsh APC axin GSK3 -catenin -catenin P P ubi ubi ubi ubi ubi ubi -catenin -catenin
10. the FOXO3a-ER fusion gene ER HSP HSP HSP HSP 4-OHT ER HSP HSP HSP HSP 4-OHT inactive active DB DB
11. Measure mRNA Does regulation occur through transcription? p27 cdk2 0 8 4 Hr of 4-OHT Does the 5’ regulatory region harbor a protein binding site: EMSA Does this drive transcription: luciferase assay
13. Reporter assays Single molecule fish ………… acgaagtctagaggtcgattagatcgagcgataagcttcaggaacctgatacgatgatgccccttatagtatagta…………………… tgcttca ctagct tcgaagt tgctact
14. Native PAAGE Protein DNA interaction in vitro 32-P-GGAATTCG 1. Label double-stranded DNA (oligonucleotide with binding element ) 2. Incubate with protein 32-P-GGAATTCG 3. Compete with specific (a) or non-specific oligonucleotide (b) 4. Incubate with specific (a) or control antibody (b) 2 1 3a 3b 4a 4b
15. Reporter assays in vivo Signalling conserved through evolution C.elegans Mammalians Daf-2 FoxO PKB PI3K Ins/IGF-R Daf-18 Age-1 Akt-1 Daf-16 PTEN SOD-3 MnSOD
16. A GFP reporter of the DAF-16/FOXO regulated MnSOD ortholog sod-3 Honda and Honda, 1999 wild type daf-2(e1370) daf-2(sa189) -130 -380 FOXO binding sites GFP BamHI sod-3 locus sod-3::gfp sod-3::gfp transgenic animal on food
17. Starvation and DAF-2 inactivation induce DAF-16 dependent expression of SOD-3::GFP SOD-3::GFP levels Relative GFP level ± SEM Food Temperature + 20 + 20 + 25 - 20 - 20 wild type daf-16(mu86) daf-2 (e1370) wild type on food wild type starved daf-16(mu86) on food daf-16(mu86) starved daf-2(e1370 ) at 25 o C A E D C B
18. Paraquat induces DAF-16/FOXO dependent expression of SOD-3::GFP wild type wild type daf-16(mu86) daf-16(mu86) 0.25 mM Paraquat Control wild type daf-16(mu86) SOD-3::GFP levels Measured after 48 hrs growth on Paraquat containing plates started with synchronized L1 larvae
19. ChIP PCR and analyze Does regulation occur through transcription? Chromatin immunoprecipitation or Chip
20. Microarray genome-wide location analysis (aka ChIP on chip) Microarray e.g. 100 kbp (44 000 features 1 probe every ~250 bp) #2 Elutie DNA Massive parallel sequencing
21. DNA microarrays and gene expression regulation analyzing the genome instead of one gene omgeving signaal transductie 10 000’s genes