SlideShare a Scribd company logo
1 of 8
Download to read offline
Journal of Biology, Agriculture and Healthcare
ISSN 2224-3208 (Paper) ISSN 2225-093X (Online)
Vol.3, No.17, 2013

www.iiste.org

First Report on Fusarium solani, a Pathogenic Fungus Causing
Stem Rot Disease on Dragon Fruits (Hylocereus sp.) in Bali
Wiwik Susanah Rita1, Dewa Ngurah Suprapta2*, I Made Sudana2, I Made Dira Swantara3
1.Doctorate Program in Agricultural Science, School for Postgraduate Udayana University.
2.Laboratory of Biopesticide Faculty of Agriculture, Udayana University, Jl. PB. Sudirman Denpasar Bali
Indonesia.
3.Laboratory of Chemistry, Faculty of Natural Science and Mathematic, Udayana University
*Email of corresponding author : biop@dps.centrin.net.id
Abstract
In recent years, dragon fruit crop (Hylocereus spp.) has become increasingly important in Bali Indonesia due to
its high nutrient content and healing properties. However, the dragon fruit was reported to be seriously infected
with several complex diseases caused by fungi and causing serious losses to the farmers. The study on
morphological and molecular characterization the fungal pathogen was conducted to confirm the species of the
fungi. Koch Postulate was applied to confirm the causal agent of the disease. There were two isolates of fungi
isolated from the stems of diseased plants, namely isolate w1 (from stem of H. undatus) and isolate w2 (from
stem of H. polyrhizus). Based on macroscopic and microscopic characteristics, and analysis of 18S rDNA, both
of them were identified as Fusarium solani. This is the first report on the F. solani the cause of stem rot disease
on dragon fruits in Bali.
Keywords : stem rot disease, dragon fruit, Fusarium solani
1. Introduction
Dragon Fruits (Hylocereus spp.), which are also known as pitaya, are the fruits of cactus species, especially
of the genus Hylocereus. There are three species which have high commercial valuable fruits are the species of
Hylocereus undatus, (red rind, white flesh), Hylocereus polyrhizus (red rind, red flesh), and Hylocereus
costaricensis (red rind, super red flesh). Hylocereus spp. is grown commercially in Vietnam, Spain, Malaysia,
Japan, Mexico and other tropical and subtropical areas because of its high nutrient content and healing
properties. In recent years, this fruit has become increasingly important in Bali Indonesia. The dragon fruit is
rich in vitamin, it helps the digestive process due to its fiber, prevent colon cancer and diabetes, neutralize toxic
substances such as heavy metals, and helps to reduce cholesterol levels and high blood pressure (He et al., 2012;
Zainoldin and Baba, 2009). Recently, dragon fruit has been reported to be seriously infected with several
complex diseases caused by fungi and causing serious losses to farmers. Several dragon fruit plants grown in
Sobangan Village, Bali Indonesia showed severe symptom of stem rot disease. The disease caused significant
yield losses. Isolation of the fungi associated with the diseased-plants showed that Fusarium sp. was the most
frequent found on the stems showing brown rot symptom.
Various diseases caused by fungi have been reported on dragon fruit in tropical and subtropical countries,
such as fruit rot (Bipolaris cactivora) (Tarnowski et al., 2010; He et al. 2012), stem rot (Fusarium semitectum,
Fusarium oxysporium, Fusarium moniliforme) (Hawa et al., 2010), anthracnose (Colletotrichum
gloeosporioides) (Masyahit et al., 2009), brown spot (Botryodiplodia sp.), basal rot (Pythium sp.) (Lin et al.,
2006), wilt (Fusarium oxysporium), stem blight (Diplodia sp., Ascochyta sp., and Phoma sp.), black spot
(Alternaria sp.), speck blight (Nectriella sp.), (Wang et al.,2007), and stem lesion (Septogloeum sp.) (Zheng et
al., 2009).
In order to control the disease, it is necessary to identify the causal agent of the disease. The fungal
pathogen can be identified based on cultural and morphological characters. However it could be highly variable
depending on the media and cultural conditions that could be the problems in fungal identification. In recent
years, the increasing use of molecular methods in fungal identification has emerged as a possible answer to the
problems associated with the existing phenotypic identification systems (Mishra et al., 2003). One of the
molecular approaches to fungal identification is based on Polymerase Chain Reaction (PCR).
The main area for the development of fungal identification is ribosomal genes, present in all organisms and
at high copy numbers aiding detection and the sensitivity of the PCR reaction. The fungal nuclear ribosomal
DNA (rDNA) consist of three genes, the large subunit gene (25S), the small subunit gene (18S), and the 5.8S
gene, separated by internal transcribed spacer (ITS) regions, in a unit repeated many times. The ITS region is an
area of particular importance to fungal identification. It has areas of high conservation and areas of high
variability and is an ideal starter for the development of specific PCR primers for identification of fungal species
(Atkins and Clark, 2004). Sequences of the ITS regions ITS1 and ITS2 have been used widely in molecular
phylogenetic studies because of their relatively high variability and facility of amplification. For phylogenetic

93
Journal of Biology, Agriculture and Healthcare
ISSN 2224-3208 (Paper) ISSN 2225-093X (Online)
Vol.3, No.17, 2013

www.iiste.org

applications, most researchers use sequence alignments that are based on nucleotide similarity (Tippery and Les,
2008).
Suga et al. (2000) has investigated phylogenetic relationships of Fusarium solani using sequences from the
rDNA-ITS region. Mishra et al. (2003) has developed a fluorescent-based polymerase chain reaction in ITS
region to identify five toxigenic and pathogenic Fusarium species. Abd-Elsalam et al. (2003) have developed
two taxon-selective primers for quick identification of the Fusarium genus. These primers, ITS-Fu-f and ITS-Fur were designed by comparing the aligned sequences of internal transcribed spacer regions (ITS) of a range of
Fusarium species. Zhang et al. (2006) and O'Donnell et al. (2008) have studied phylogeni of Fusarium solani
Species Complex (FSSC) that cause infection in both humans and plants based on three genes of the ribosomal
DNA. The ITS region including 5.8S rDNA sequence of 58 isolates Candida parapsilosis in Brazil and Japan
was analyzed by Iida et al. (2005).
This paper reports on identification of fungal pathogen causing stem rot disease from dragon fruits planted
in Bali based on morphological and molecular methods using sequences from rDNA-ITS region.
2. Materials and Methods
2.1. Fungal Pathogen Isolation and Virulence Test
Fungi were isolated from the diseased stem of H. undatus and H. polyrhizus from dragon fruit’s orchard in
Sobangan village, Mengwi Bali. Surface sterilization was carried out by cleaning the symptom margins with
70% ethanol and cut into small blocks (ca 1.5 x 1.5 x 1.5 cm), soaked in 1% sodium hypochlorite (NaOCI) for 3
min, and rinsed in several changes of sterile distilled water (each 1 min). All sterilized samples were placed onto
Potato Dextrose Agar (PDA) and incubated at 25 ± 2°C for 7 days. Mycelium growing after 3 days of incubation
was transferred to a new PDA to obtain pure fungal cultures. The pure culture was inoculated on healthy dragon
fruit stems to confirm the similarity of symptoms in the field. For this purpose the Koch's postulates test was
carried out. Dragon fruit stems (30 days in age) were injured with a sterile needle and inoculated by spraying
with a suspension of spores of 1.5x106 spores/mL. Three plants were inoculated with a fungal isolate. For
control, dragon fruit stems were pierced with a sterile needle and sprayed with sterile water. Symptoms were
observed for a week after inoculation. The symptoms were compared with the symptoms of the disease in the
field. After that, the isolation of pathogenic fungi on infected stem was performed again. Pure cultures of
pathogenic fungi were inoculated again on dragon fruit plants and the same inoculation procedure was done to
obtain the similarity of symptoms. Fungal isolates obtained can be regarded as the cause of the disease and were
used for further identification.
2.2. Morphological Characterization
Characterization of the main fungal pathogens was carried out macroscopically, by observing the fungal colony
color, colony reverse color, no lines or concentric radier, issued exudates or not, media pigmentation, colony
surface, and how the growth of fungi (fast or slow). Microscopic identification was also carried out by observing
the shape of hyphae or spores under a microscope, and then the results were confirmed using fungal
identification book (Pit and Hocking, 1997).
2.3. DNA Extraction
Fusarium sp. isolates w1 and w2 were grown on potato dextrose agar (PDA) medium for 3 days at room
temperature. The mycelium grown was harvested and grown to a fine powder in a sterile mortar with liquid
nitrogen. DNA was extracted by using PhythopureTM DNA Extraction Kit (GE Healthcare, UK) according to
manufacturer’s instructions.
2.4. Molecular identification and phylogenetic relationships of fungal pathogen
Identification of fungal isolates was performed based on molecular genetic analysis using the internal transcribed
spacer region (ITS). PCR amplification used ITS 5 F: 5`- GGAAGTAAAAGTCGTAACAAGG - 3` and ITS 4
R: 5 `- TCCTCCGCTTATTGATATGC - 3 '(White et al. 1990). Amplification was performed on a volume of 25
L with the reaction mixture: 10 µL nuclease free water, 12.5 µL Go taq green master mixTM, ITS5 and ITS4
each 0.5 µL, 0.5 µL DMSO, and 1 µL of DNA template. PCR amplification for regional ITS consists of: pre
denaturation 95 ºC for 90 seconds, followed by 95 ºC for 30 seconds with 35 cycles, annealing 55 ºC in 30
seconds, extension 72 ºC in 90 seconds, and final extension 72 ºC for 5 minutes. The product was purified and
then sequenced. The nitrogen base sequence was analyzed using automated DNA sequencer (ABI PRISM 3130
Genetic Analyzer) (Applied Biosystems).
Sequencing raw data were trimmed and assembled using ChromasPro program version 1.5. The assembled
data were BLASTED with genomic data that has been registered in NCBI / National Center for Biotechnology
Information (http://www.ncbi.nlm.nih.gov/BLAST/). Some data sequence which is a result of blast nearest
species and is a type strains of each species were taken from the data in the NCBI gene bank. Then the data were
analyzed again with the sequence aligment using MEGA version5.0 program (Tamura et al. 2011) and boostrap
used is 1000 replications (Felsenstein, 1985).

94
Journal of Biology, Agriculture and Healthcare
ISSN 2224-3208 (Paper) ISSN 2225-093X (Online)
Vol.3, No.17, 2013

www.iiste.org

3. Results and Discussion
3.1. Fungal Isolates
There are 10 fungal isolates were obtained from isolation of fungi associated with the stem disease of dragon
fruits grown in Sobangan Village, Bali Indonesia. Based on the Koch's postulates test, there were two isolates
of Fusarium sp. namely isolate w1 (from H. undatus) and isolate w2 (from H. polyrhizus) caused the stem rot
disease with the symptom similar to the symptom occurred in the field. The symptom appeared on stem as dark
brown stem rot as shown in Figure 1.

Figure 1. Symptoms of the stem rot diseases on Hylocereus sp. under field conditions.
3.2. Macroscopic Characteristic
Fusarium sp. isolate w1 grown on PDA produced abundant mycelium (sometimes in aerial, depends on cultural
condition), white colony appearance, cream colony reverse, yellow to brown pigmentations, and fast growing
(3.75-4.45 cm in 3 days) whereas Fusarium sp. isolate w2 produced abundant-powdery mycelium (sometimes in
aerial), white colony appearance, yellow colony reverse, yellow pigmentations, and fast growing (4.35-5.25 cm
in 3 days).
In a similar study, Chandran and Kumar (2012) studied for cultural, morphological variability in 13 isolates
of Fusarium solani (Mart.) Sacc., incitant of dry root-rot of citrus, they reported that F. solani isolates were
characterized as fast growing, moderately growing, and slow growing. The five isolates produced pale pink to
dusky red color pigmentation in PDA medium and potato dextrose broth culture. The remaining all isolates
produced pale yellow to dark yellow pigmentation. Most of the isolates produced profuse sporulation, whereas
others produced moderate sporulation. Madhukeshwara (2000) has studied cultural variability among six isolates
of F. udum causing wilt of pigeon pea. All the isolates varied with each other in terms of growth, mycelium,
pigmentation, and sporulation. Most of the isolates produced cottony white raised mycelium, pale yellow to
dusky red color pigmentation and moderate to profuse sporulation on PDA medium.
3.3. Microscopic Characteristics
Microscopic characters such as size, shape, septation, and color of conidia were studied using PDA medium.
Fusarium sp. isolate w1 had longer macroconidia (1-4 septates; 18.4-31.7 µm in length), curved in shaped with
hyaline in color, whereas Fusarium sp. isolate w2 had shorter macroconidia (1-3 septates; 15.3-24.8 µm in
length), curved in shaped with hyaline in color. Fusarium sp. isolate w1 produced less microconidia while
Fusarium sp. isolate w2 produces abundant microconidia (1 septate; 5.7- 8.5 µm in length), round to oval in
shaped. Furthermore both the fungi had the septate hyphae and clamydospores in pairs with hyaline in color and
located in the middle of hyphae as presented in Figure 2.
Pitt and Hocking (1997) reported that the main characters used to distinguish species of Fusarium are the
size and shape of the macroconidia; the presence or absence of microconidia; and the presence of
chlamydospora. Kawuri et al. (2012) reported that Fusarium oxysporum had macroconidia curved in shaped with
four septates and foot cell, 31μm length and smooth surface, whereas microconidia has rough surface at 4.6 μm
length. Chandran and Kumar (2012) reported that the number of septa in macro conidia and micro conidia of
Fusarium solani (Mart.) Sacc. are 3-5 and 0-1 respectively and the color is hyaline. The shape of macro conidia
is sickle shaped with blunt ends and micro conidia is round to oval shaped. The chlamydospores located in
middle of hyphae (intercalary), on tip of the hyphae (terminal) and some chlamydospores were seen in middle of
macro conidia.

A

B

95
Journal of Biology, Agriculture and Healthcare
ISSN 2224-3208 (Paper) ISSN 2225-093X (Online)
Vol.3, No.17, 2013

www.iiste.org

Figure 2. Microscopic characteristics of Fusarium sp. isolate w1 (A) macro conidia (B) septated hypae (C)
Chlamydospore. Bars = 10 m.
3.4. Molecular Characteristics of the Pathogenic Fungus
PCR amplification of 18S rDNA of Fusarium sp. isolates w1 and w2 with primers ITS5 (F: 5`GGAAGTAAAAGTCGTAACAAGG -3`) and ITS4 (R: 5`-TCCTCCGCTTATTGATATGC- 3') produced about
560 bp of DNA fragments, it is corresponding to 18S rDNA (Figure 3). The fragments then sequenced to
determine the species of fungus based on the similarity with other references of identified species.
Based on the 18S rDNA analysis showed that Fusarium sp. isolates w1 and w2 have a close relationship
with Fusarium solani. This can be seen in the phylogenetic tree shown in Figure 5. Fusarium sp. isolates w1 and
w2 have 99% similarity with Fusarium solani strain 68 18S ribosomal RNA gene (Accession Number Gen
Bank: JX897001.1), Fusarium solani strain H8 18S ribosomal RNA gene (Accesion Number Gen Bank:
JF323002.1), and Fusarium solani genomic DNA containing partial 18S rRNA gene (Accession Number Gen
Bank: FR691777.1). They have a larger similarity (100%) with Fusarium sp. r323 18S ribosomal RNA gene,
partial sequence (Accession Number Gen Bank: HQ649839.1), and Fusarium solani strain M146 18S ribosomal
RNA gene(Accession Number Gen Bank: JN127379.1) (Table 1).

Figure 3. PCR amplification of the ITS gene with primer ITS_5F and primer ITS_4R. M = marker 1 Kb
ladder (Fermentas), 1 = PCR product of Fusarium sp. isolate w2, and 2 = PCR product of Fusarium sp.
isolate w2

96
Journal of Biology, Agriculture and Healthcare
ISSN 2224-3208 (Paper) ISSN 2225-093X (Online)
Vol.3, No.17, 2013

www.iiste.org

Fusarium sp. isolat w1
Fusarium sp. isolat w2
Fusarium sp. r323
100

Fusarium solani strain 68
Fusarium solani strain M146
Fusarium solani strain H8
Fusarium solani DNA containing
Fusarium sp. r104
Mel anelixia aff. Fuliginosa Crespo 6005o
100

Mel anelixia Fuliginosa voucher Robertson 7140

Leptodiscella sp. FMR 10885
Leptodiscella chlamydospora

100

0.05

Figure 4. Phylogenetic relationship constructed from ITS sequences of the characterized clone library of
Fusarium. Bootstrap value greater than 50% are shown at each node.
Table 1.comparisons of 18S rDNA gene similarity levels of Fusarium sp. isolates w1 and w2 with multiple
sequences in GenBank using BLAST program
Isolates
% Similarity
Accession
Fusarium solani strain 68 18S ribosomal RNA gene,
99
JX897001.1
Fusarium solani strain H8 18S ribosomal RNA gene,
99
JF323002.1
Fusarium solani genomic DNA containing partial 18S rRNA gene
99
FR691777.1
Fusarium sp. r323 18S ribosomal RNA gene, partial sequence
100
HQ649839.1
Fusarium solani strain M146 18S ribosomal RNA gene
100
JN127379.1
From the Table 1 and Figure 4, it can be seen that Fusarium sp. isolates w1 and w2 are closely related to
the Fusarium solani strain 68 18S ribosomal RNA gene, Fusarium solani strain H8 18S, Fusarium solani
genomic DNA containing partial 18S rRNA gene, Fusarium sp. r323 18S ribosomal RNA gene, and Fusarium
solani strain M146 18S ribosomal RNA gene. Ronquillo (2012) reported that the Fusarium solani strain H8 18S
caused bud rot in the oil palm in Ecuador. Shahnazi et al. (2012) investigated that Fusarium solani strain H8 18S
caused yellowing disease of black pepper (Piper nigrum L.) in Malaysia. Sarmiento-Ramirez et al. (2010)
reported that Fusarium solani genomic DNA containing partial 18S rRNA gene was responsible for mass
mortalities in nests of logger head sea turtle. Fusarium sp. r323 18S ribosomal RNA gene was associated with
Roots of Halophytic and Non-halophytic Plant Species was reported by Macia-Vicente et al. (2012). In addition,
Rosado-Rodriguez et al. (2011) reported that Fusarium solani strain M146 18S ribosomal RNA gene was
associated with Leatherback Sea Turtle (Dermochelys coriacea) Nests in the Mayaguez-Anasco Bay Coast,
Western Puerto Rico.
Fusarium solani is one of the most frequently isolated fungi from soil and plant material, where they act as
decomposers, but they are also host-specific pathogens of a number of agriculturally important plants, including
sweet potato, cucurbits, and pea. Moreover, they are increasingly associated with opportunistic infections of
humans and other animals, causing systemic infections with a high mortality rate, as well as localized infections
in the skin and other body parts (Zhanget al., 2006). Mycotoxin trichothecenes produced by Fusarium is very
toxic for human (Miller and Trenholm, 1994). This toxin can cause cancer, hemorrhage, edema and immune
deficiency (Alexoupolos et al., 1996). WHO (1979) reported that mycotoxins are hazardous to human and
animal health.
4. Conclusion
Based on the results of present study, it can be concluded that the causal agent of the stem rot disease on dragon
fruits (Hylocereus sp.) in Bali is identified as Fusarium solani. Hard efforts must be done to control the disease
in order to reduce the losses of dragon fruit production and the risk of mycotoxins contamination which are
probably produced by Fusarium solani.
Acknowledgement
Authors wish to express their appreciation to the Laboratory of Biopesticide, Faculty of Agriculture Udayana

97
Journal of Biology, Agriculture and Healthcare
ISSN 2224-3208 (Paper) ISSN 2225-093X (Online)
Vol.3, No.17, 2013

www.iiste.org

University, Bali for financial support under research grant No. 05/biop-IV/2012.
References
Alexoupolos, C.J., C.W. Mims and M. Blackwell, 1996. Introductory Mycology.John Wiley and Sons.Inc.
Singapore.
Atkins, S.D. and I.M. Clark, 2004. Fungal molecular diagnostics: a mini review, J. Appl. Genet., 45: 3-15.
Chandran, M.R. and M.R. Kumar, 2012.Studies on cultural, morphological variability in isolates of Fusarium
solani (Mart.) Sacc., incitant of dry root-rot of Citrus. Current Biotica, 6: 152-162.
Felsenstein. J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution, 39: 783–
791.
He, P.F., H. Ho, X. Wu, M.S. Hou, and Y.Q. He, 2012. Bipolaris cactivora causing fruit rot of dragon fruit
imported from Vietnam. Plant Pathology & Quarantine, 2: 31-35.
Hawa, M.M, B. Salleh and Z. Latiffah, 2010. Characterization and intraspecific variation of Fusarium
semitectum (Berkeley and Ravenel) associated with red-fleshed dragon fruit (Hylocereus polyrhizus
[Weber] Britton and Rose) in Malaysia. African Journal of Biotechnology, 9: 273–284.
Iida, S., T. Imai, T. Oguri, K. Okuzumi, A. Yamanaka, M.L. Moretti-Branchini, K. Nishimura, and Y. Mikami,
2005.Genetic Diversity of the Internal Transcribed Spacer (ITS) and 5.8S sRNA Genes among The
Clinical Isolates of Candida parapsilosis in Brazil and Japan.Jpn. J. Med., 46: 1333-137.
Kawuri, R., D.N. Suprapta, Y. Nitta, and T. Homma, 2012. Destructive Leaf Rot Disease Caused by Fusarium
oxysporum on Aloe barbadensis Miller in Bali. Agricultural Science Research Journal, 2: 295–301. [cited:
2013 July 15]. Available online from http://www.resjournals.com/ARJ
Lin, C.C., W.B. Guo and S.F. Cai, 2006. Diseases of red dragon fruit in Taiwan. Good Year (Chinese), 56: 38–
42.
Macia-Vicente, J.G., V. Ferraro, S. Burruano and L.V. Lopez-Llorca, 2012. Fungal Assemblages Associated
with Roots of Halophytic and Non-halophytic Plant Species Vary Differentially Along a Salinity
Gradient. Microb. Ecol., 64: 668-679.
Madhukeshwara, S. S., 2000. Studies on variation and management of Fusarium wilt of igeonpea (Cajanus
cajan). M.Sc., Thesis, UAS, GKVK, Bangalore pp: 85-94.
Masyahit, M., K. Sijam, Y. Awang, M. Ghazali and M. Satar, 2009. The First Report of the Occurrence of
Anthracnose Disease Caused by Colletotrichum gloeosporioides (Penz.) Penz. & Sacc.on Dragon Fruit
(Hylocereus spp.) in Peninsular Malaysia. American Journal of Applied Sciences, 6 : 902-912.
Mishra, P.K., R.T.V. Fox and A. Culham, 2003. Development of a PCR-based assay for rapid and reliable
identification of pathogenic Fusaria. FEMS Microbiology Letters, 218: 329-332.
O’Donnell, K., D.A. Sutton, A. Fothergill, D. McCarthy, M.G. Rinaldi, M.E. Brandt, N. Zhang and D.M. Geiser,
2008. Molecular Phylogenetic Diversity, Multilocus Haplotype Nomenclature, and In Vitro Antifungal
Resistance within the Fusarium solani Species Complex, J. Clin. Microbiol., 46 : 2477-2490.
Pit, J.I. and A.D. Hocking, 1997. Fungi and Food Spoiladge. 2nd Edition. Blackie Academic and Professional
Press. Pp. 137-139.
Ronquillo, M.P., 2012. Etiology of Bud Rot in the Oil Palm in Ecuador. Crop Protection,
2.http://getentry.ddbj.nig.ac.jp/getentry/na/JX897001/?filetype =html.
Rosado-Rodriguez,G., 2011. Mycelial Fungal Diversity Associated with Leatherback Sea Turtle (Dermochelys
coriacea) Nests in the Mayaguez-Anasco Bay Coast, Western Puerto Rico. Biology,
http://getentry.ddbj.nig.ac.jp/getentry/na/JN127379/?filetype=html
Sarmiento-Ramirez, J.M., E. Abella, M.P. Martin, M.T. Telleria, L.F. Lopez-Jurado, A. Marco, and J. DieguezUribeondo, 2010. Fusarium solani is responsible for mass mortalities in nests of loggerhead sea turtle,
Caretta caretta, in Boavista, Cape Verde. FEMS Microbiol Lett. 312 : 192-200.
Shahnazi, S., S. Meon, G. Vadamalai, K. Ahmad and N. Nejat, 2012. Morphological and molecular
characterization of Fusarium spp. associated with yellowing disease of black pepper (Piper nigrum L.) in
Malaysia. J. Gen Plant Pathol.,78: 160-169.
Suga, H., T. Hasegawa, H. Mitsui, K. Kageyama and M. Hyakumachi, 2000. Phylogeneticanalysis of the
phytopathogenic fungus Fusarium solani based on the rDNA-ITS region. Mycol. Res., 104: 1175-1183.
Tamura, K., D. Peterson, N. Peterson, N. Stecher, M. Nei and S. Kumar, 2011. MEGA5: Molecular
Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum
Parsimony Methods. Mol Biol Evo. [cited 2013 July 15]. Available online at:
http://mbe.oxfordjournals.org/content/early/2011/08/17/.
Tarnowski, T. L. B., A.J. Palmateer and J.H. Crane, 2010. First Report of Fruit Rot on Hylocereusundatus
Caused by in South Florida. The American Phytopathological Society, 94: 1605.2.
Tippery, N.P. and D.H. Les, 2008. Phylogenetic analysis of the internal transcribed spacer (ITS) region in

98
Journal of Biology, Agriculture and Healthcare
ISSN 2224-3208 (Paper) ISSN 2225-093X (Online)
Vol.3, No.17, 2013

www.iiste.org

Menyanthaceae using predicted secondary structure. Molecular Phylogenetics and Evolution, 49: 526–
537.
Wang, D.F., Q. Wei, R. Yang, W.J. Sang, G.Q. Fan and Y.L. Jin, 2007 – Preliminary identification of disease of
pitaya in Luodian Country. Journal of Mountain Agriculture and Biology (Chinese), 26: 267–270.
White, T.J., T. Bruns, Lee and S.J. Taylor, 1990. Amplification and direct sequencing of fungal ribosomal RNA
genes for phylogenetics. In MA Innis, DH Gelfand, JJ Sninsky; T. J. White, (Eds). PCR Protocols: a
Guide to Methods and Applications. Pp. 315-322. Academic Press, San Diego, CA.
World Health Organization (WHO). 1979. Mycotoxins, Environment, Health Criteria No. 11, Geneva.
Zainoldin, K.H. and A.S. Baba, 2009. The Effect of Hylocereus polyrhizus and Hylocereus undatuson
Physicochemical, Proteolysis, and Antioxidant Activity in Yogurt. World Academy of Science,
Engineering and Technology, 60: 361-366.
Zhang, N., K. O’Donnell, D.A. Sutton, F.A. Nalim, R.C. Summerbell, A.A. Padhye and D.M. Geiser, 2006.
Members of the Fusarium solani Species Complex That Cause Infections in Both Humans and Plants Are
Common in the Environment. J. Clin. Microbiol., 44: 2186-2190.
Zheng, W., B. Wang and Y.Q. Cai, 2009. Inhibitory test for Septogloeum sp. causing stem lesion of pitaya with
fungicides. Jiangsu Agricultural Sciences (Chinese), 5:151–152.

99
This academic article was published by The International Institute for Science,
Technology and Education (IISTE). The IISTE is a pioneer in the Open Access
Publishing service based in the U.S. and Europe. The aim of the institute is
Accelerating Global Knowledge Sharing.
More information about the publisher can be found in the IISTE’s homepage:
http://www.iiste.org
CALL FOR JOURNAL PAPERS
The IISTE is currently hosting more than 30 peer-reviewed academic journals and
collaborating with academic institutions around the world. There’s no deadline for
submission. Prospective authors of IISTE journals can find the submission
instruction on the following page: http://www.iiste.org/journals/
The IISTE
editorial team promises to the review and publish all the qualified submissions in a
fast manner. All the journals articles are available online to the readers all over the
world without financial, legal, or technical barriers other than those inseparable from
gaining access to the internet itself. Printed version of the journals is also available
upon request of readers and authors.
MORE RESOURCES
Book publication information: http://www.iiste.org/book/
Recent conferences: http://www.iiste.org/conference/
IISTE Knowledge Sharing Partners
EBSCO, Index Copernicus, Ulrich's Periodicals Directory, JournalTOCS, PKP Open
Archives Harvester, Bielefeld Academic Search Engine, Elektronische
Zeitschriftenbibliothek EZB, Open J-Gate, OCLC WorldCat, Universe Digtial
Library , NewJour, Google Scholar

More Related Content

What's hot

Isolation of endophytes from potato and their antagonist effect against Fusar...
Isolation of endophytes from potato and their antagonist effect against Fusar...Isolation of endophytes from potato and their antagonist effect against Fusar...
Isolation of endophytes from potato and their antagonist effect against Fusar...
Innspub Net
 
Antimicrobial Activity of Actinomycetes from Soil Samples of Some 6(35)April ...
Antimicrobial Activity of Actinomycetes from Soil Samples of Some 6(35)April ...Antimicrobial Activity of Actinomycetes from Soil Samples of Some 6(35)April ...
Antimicrobial Activity of Actinomycetes from Soil Samples of Some 6(35)April ...
Ravindragouda Patil
 
A study of antibiotic resistance of Extended-Spectrum Beta-Lactamases produci...
A study of antibiotic resistance of Extended-Spectrum Beta-Lactamases produci...A study of antibiotic resistance of Extended-Spectrum Beta-Lactamases produci...
A study of antibiotic resistance of Extended-Spectrum Beta-Lactamases produci...
Premier Publishers
 
Tritrophic relationships
Tritrophic relationshipsTritrophic relationships
Tritrophic relationships
mayank_aau
 
Antibiotic Enteric Resistant Bacteria are Abundant on Lettuce from Urban Agri...
Antibiotic Enteric Resistant Bacteria are Abundant on Lettuce from Urban Agri...Antibiotic Enteric Resistant Bacteria are Abundant on Lettuce from Urban Agri...
Antibiotic Enteric Resistant Bacteria are Abundant on Lettuce from Urban Agri...
YogeshIJTSRD
 

What's hot (20)

Download our publication archive list
Download our publication archive listDownload our publication archive list
Download our publication archive list
 
Austin Journal of Plant Biology
Austin Journal of Plant BiologyAustin Journal of Plant Biology
Austin Journal of Plant Biology
 
Insect plant interactions
Insect plant interactionsInsect plant interactions
Insect plant interactions
 
Bacteriological Assessment of Lettuce Vended in Benin City Edo State, Nigeria
Bacteriological Assessment of Lettuce Vended in Benin City Edo State, NigeriaBacteriological Assessment of Lettuce Vended in Benin City Edo State, Nigeria
Bacteriological Assessment of Lettuce Vended in Benin City Edo State, Nigeria
 
Biochemical Monitoring of Detoxifying Enzyme Levels in Field Population of Mo...
Biochemical Monitoring of Detoxifying Enzyme Levels in Field Population of Mo...Biochemical Monitoring of Detoxifying Enzyme Levels in Field Population of Mo...
Biochemical Monitoring of Detoxifying Enzyme Levels in Field Population of Mo...
 
FAU Frontiers in Science Lecture: Anti-infective drugs from nature - 2014
FAU Frontiers in Science Lecture: Anti-infective drugs from nature - 2014FAU Frontiers in Science Lecture: Anti-infective drugs from nature - 2014
FAU Frontiers in Science Lecture: Anti-infective drugs from nature - 2014
 
Identification of Ralstonia Solanacearum in Kyrgyzstan’s Potato Fields and th...
Identification of Ralstonia Solanacearum in Kyrgyzstan’s Potato Fields and th...Identification of Ralstonia Solanacearum in Kyrgyzstan’s Potato Fields and th...
Identification of Ralstonia Solanacearum in Kyrgyzstan’s Potato Fields and th...
 
Tritrophic Interactions Mediated By Herbivore Induced Plant Volatiles: Their...
 Tritrophic Interactions Mediated By Herbivore Induced Plant Volatiles: Their... Tritrophic Interactions Mediated By Herbivore Induced Plant Volatiles: Their...
Tritrophic Interactions Mediated By Herbivore Induced Plant Volatiles: Their...
 
Isolation of endophytes from potato and their antagonist effect against Fusar...
Isolation of endophytes from potato and their antagonist effect against Fusar...Isolation of endophytes from potato and their antagonist effect against Fusar...
Isolation of endophytes from potato and their antagonist effect against Fusar...
 
Antimicrobial Activity of Actinomycetes from Soil Samples of Some 6(35)April ...
Antimicrobial Activity of Actinomycetes from Soil Samples of Some 6(35)April ...Antimicrobial Activity of Actinomycetes from Soil Samples of Some 6(35)April ...
Antimicrobial Activity of Actinomycetes from Soil Samples of Some 6(35)April ...
 
American Journal of Pharmacology & Therapeutics
American Journal of Pharmacology & TherapeuticsAmerican Journal of Pharmacology & Therapeutics
American Journal of Pharmacology & Therapeutics
 
Seb bruce insect-plant interactions
Seb bruce insect-plant interactionsSeb bruce insect-plant interactions
Seb bruce insect-plant interactions
 
TRITROPHIC INTERACTIONS IN INSECT PESTS OF RICE
TRITROPHIC INTERACTIONS IN INSECT PESTS OF RICETRITROPHIC INTERACTIONS IN INSECT PESTS OF RICE
TRITROPHIC INTERACTIONS IN INSECT PESTS OF RICE
 
Identification and characterization of actinomycetes for
Identification and characterization of actinomycetes forIdentification and characterization of actinomycetes for
Identification and characterization of actinomycetes for
 
A study of antibiotic resistance of Extended-Spectrum Beta-Lactamases produci...
A study of antibiotic resistance of Extended-Spectrum Beta-Lactamases produci...A study of antibiotic resistance of Extended-Spectrum Beta-Lactamases produci...
A study of antibiotic resistance of Extended-Spectrum Beta-Lactamases produci...
 
Clinical use of botulinum toxins in oral and maxillofacial surgery
Clinical use of botulinum toxins in oral and maxillofacial surgeryClinical use of botulinum toxins in oral and maxillofacial surgery
Clinical use of botulinum toxins in oral and maxillofacial surgery
 
The Edge of Tomorrow — Plant Health in the 21st Century
The Edge of Tomorrow — Plant Health in the 21st CenturyThe Edge of Tomorrow — Plant Health in the 21st Century
The Edge of Tomorrow — Plant Health in the 21st Century
 
Tritrophic relationships
Tritrophic relationshipsTritrophic relationships
Tritrophic relationships
 
An investigation of the lethality of picralima nitida, family apocynaceae in ...
An investigation of the lethality of picralima nitida, family apocynaceae in ...An investigation of the lethality of picralima nitida, family apocynaceae in ...
An investigation of the lethality of picralima nitida, family apocynaceae in ...
 
Antibiotic Enteric Resistant Bacteria are Abundant on Lettuce from Urban Agri...
Antibiotic Enteric Resistant Bacteria are Abundant on Lettuce from Urban Agri...Antibiotic Enteric Resistant Bacteria are Abundant on Lettuce from Urban Agri...
Antibiotic Enteric Resistant Bacteria are Abundant on Lettuce from Urban Agri...
 

Similar to First report on fusarium solani, a pathogenic fungus causing stem rot disease on dragon fruits (hylocereus sp.) in bali

Morphological diversity, pathogenicity and biofungicides efficacity on Cercos...
Morphological diversity, pathogenicity and biofungicides efficacity on Cercos...Morphological diversity, pathogenicity and biofungicides efficacity on Cercos...
Morphological diversity, pathogenicity and biofungicides efficacity on Cercos...
Open Access Research Paper
 
Pseudomonas fluorescens as plant growth promoting Rhizo- Bacteria and biologi...
Pseudomonas fluorescens as plant growth promoting Rhizo- Bacteria and biologi...Pseudomonas fluorescens as plant growth promoting Rhizo- Bacteria and biologi...
Pseudomonas fluorescens as plant growth promoting Rhizo- Bacteria and biologi...
Innspub Net
 
The Production of Triploid Clariobranchus in Indoor Hatchery
The Production of Triploid Clariobranchus in Indoor HatcheryThe Production of Triploid Clariobranchus in Indoor Hatchery
The Production of Triploid Clariobranchus in Indoor Hatchery
IOSR Journals
 
Isolation, identification of antagonistic rhizobacterial strains obtained fro...
Isolation, identification of antagonistic rhizobacterial strains obtained fro...Isolation, identification of antagonistic rhizobacterial strains obtained fro...
Isolation, identification of antagonistic rhizobacterial strains obtained fro...
Shazia Shahzaman
 
Epidemiology, etiology and management of fusarium wilt of muskmelon
Epidemiology, etiology and management of fusarium wilt of muskmelonEpidemiology, etiology and management of fusarium wilt of muskmelon
Epidemiology, etiology and management of fusarium wilt of muskmelon
Nageshb11
 
Management of potato virus Y (PVY) in potato by some biocontrol agents under ...
Management of potato virus Y (PVY) in potato by some biocontrol agents under ...Management of potato virus Y (PVY) in potato by some biocontrol agents under ...
Management of potato virus Y (PVY) in potato by some biocontrol agents under ...
Open Access Research Paper
 

Similar to First report on fusarium solani, a pathogenic fungus causing stem rot disease on dragon fruits (hylocereus sp.) in bali (20)

Morphological diversity, pathogenicity and biofungicides efficacity on Cercos...
Morphological diversity, pathogenicity and biofungicides efficacity on Cercos...Morphological diversity, pathogenicity and biofungicides efficacity on Cercos...
Morphological diversity, pathogenicity and biofungicides efficacity on Cercos...
 
Pseudomonas fluorescens as plant growth promoting Rhizo- Bacteria and biologi...
Pseudomonas fluorescens as plant growth promoting Rhizo- Bacteria and biologi...Pseudomonas fluorescens as plant growth promoting Rhizo- Bacteria and biologi...
Pseudomonas fluorescens as plant growth promoting Rhizo- Bacteria and biologi...
 
Pseudomonas alcaligenes, potential antagonist against fusarium oxysporum f.s...
Pseudomonas alcaligenes, potential  antagonist against fusarium oxysporum f.s...Pseudomonas alcaligenes, potential  antagonist against fusarium oxysporum f.s...
Pseudomonas alcaligenes, potential antagonist against fusarium oxysporum f.s...
 
The Production of Triploid Clariobranchus in Indoor Hatchery
The Production of Triploid Clariobranchus in Indoor HatcheryThe Production of Triploid Clariobranchus in Indoor Hatchery
The Production of Triploid Clariobranchus in Indoor Hatchery
 
Assessment of Endophytic Fungal Flora Responsible for Plant Growth Promotion...
Assessment of Endophytic Fungal Flora Responsible for Plant  Growth Promotion...Assessment of Endophytic Fungal Flora Responsible for Plant  Growth Promotion...
Assessment of Endophytic Fungal Flora Responsible for Plant Growth Promotion...
 
Publication4
Publication4Publication4
Publication4
 
Isolation and Identification of Fungi from fast food restaurants in Langa Bazar
Isolation and Identification of Fungi from fast food restaurants in Langa BazarIsolation and Identification of Fungi from fast food restaurants in Langa Bazar
Isolation and Identification of Fungi from fast food restaurants in Langa Bazar
 
Study on mycoflora associated with
Study on mycoflora associated withStudy on mycoflora associated with
Study on mycoflora associated with
 
Occurrence, Etiology and Molecular Characterization of Phytoplasma Diseases o...
Occurrence, Etiology and Molecular Characterization of Phytoplasma Diseases o...Occurrence, Etiology and Molecular Characterization of Phytoplasma Diseases o...
Occurrence, Etiology and Molecular Characterization of Phytoplasma Diseases o...
 
Identification and characterization of actinomycetes for
Identification and characterization of actinomycetes forIdentification and characterization of actinomycetes for
Identification and characterization of actinomycetes for
 
Applications of bioinformatics
Applications of bioinformaticsApplications of bioinformatics
Applications of bioinformatics
 
At18 (1)
At18 (1)At18 (1)
At18 (1)
 
At18 (1)
At18 (1)At18 (1)
At18 (1)
 
Prevalence, occurrence and biochemical characterization of Xanthomonas campes...
Prevalence, occurrence and biochemical characterization of Xanthomonas campes...Prevalence, occurrence and biochemical characterization of Xanthomonas campes...
Prevalence, occurrence and biochemical characterization of Xanthomonas campes...
 
Isolation, identification of antagonistic rhizobacterial strains obtained fro...
Isolation, identification of antagonistic rhizobacterial strains obtained fro...Isolation, identification of antagonistic rhizobacterial strains obtained fro...
Isolation, identification of antagonistic rhizobacterial strains obtained fro...
 
Epidemiology, etiology and management of fusarium wilt of muskmelon
Epidemiology, etiology and management of fusarium wilt of muskmelonEpidemiology, etiology and management of fusarium wilt of muskmelon
Epidemiology, etiology and management of fusarium wilt of muskmelon
 
B.cepacia2
B.cepacia2B.cepacia2
B.cepacia2
 
Management of potato virus Y (PVY) in potato by some biocontrol agents under ...
Management of potato virus Y (PVY) in potato by some biocontrol agents under ...Management of potato virus Y (PVY) in potato by some biocontrol agents under ...
Management of potato virus Y (PVY) in potato by some biocontrol agents under ...
 
Study of naturally sourced bacteria with antifungal activities
Study of naturally sourced bacteria with antifungal activitiesStudy of naturally sourced bacteria with antifungal activities
Study of naturally sourced bacteria with antifungal activities
 
IMPACT-OF-GENOMICS-ON-AGRICULTUR.pptx
IMPACT-OF-GENOMICS-ON-AGRICULTUR.pptxIMPACT-OF-GENOMICS-ON-AGRICULTUR.pptx
IMPACT-OF-GENOMICS-ON-AGRICULTUR.pptx
 

More from Alexander Decker

Abnormalities of hormones and inflammatory cytokines in women affected with p...
Abnormalities of hormones and inflammatory cytokines in women affected with p...Abnormalities of hormones and inflammatory cytokines in women affected with p...
Abnormalities of hormones and inflammatory cytokines in women affected with p...
Alexander Decker
 
A usability evaluation framework for b2 c e commerce websites
A usability evaluation framework for b2 c e commerce websitesA usability evaluation framework for b2 c e commerce websites
A usability evaluation framework for b2 c e commerce websites
Alexander Decker
 
A universal model for managing the marketing executives in nigerian banks
A universal model for managing the marketing executives in nigerian banksA universal model for managing the marketing executives in nigerian banks
A universal model for managing the marketing executives in nigerian banks
Alexander Decker
 
A unique common fixed point theorems in generalized d
A unique common fixed point theorems in generalized dA unique common fixed point theorems in generalized d
A unique common fixed point theorems in generalized d
Alexander Decker
 
A trends of salmonella and antibiotic resistance
A trends of salmonella and antibiotic resistanceA trends of salmonella and antibiotic resistance
A trends of salmonella and antibiotic resistance
Alexander Decker
 
A transformational generative approach towards understanding al-istifham
A transformational  generative approach towards understanding al-istifhamA transformational  generative approach towards understanding al-istifham
A transformational generative approach towards understanding al-istifham
Alexander Decker
 
A time series analysis of the determinants of savings in namibia
A time series analysis of the determinants of savings in namibiaA time series analysis of the determinants of savings in namibia
A time series analysis of the determinants of savings in namibia
Alexander Decker
 
A therapy for physical and mental fitness of school children
A therapy for physical and mental fitness of school childrenA therapy for physical and mental fitness of school children
A therapy for physical and mental fitness of school children
Alexander Decker
 
A theory of efficiency for managing the marketing executives in nigerian banks
A theory of efficiency for managing the marketing executives in nigerian banksA theory of efficiency for managing the marketing executives in nigerian banks
A theory of efficiency for managing the marketing executives in nigerian banks
Alexander Decker
 
A systematic evaluation of link budget for
A systematic evaluation of link budget forA systematic evaluation of link budget for
A systematic evaluation of link budget for
Alexander Decker
 
A synthetic review of contraceptive supplies in punjab
A synthetic review of contraceptive supplies in punjabA synthetic review of contraceptive supplies in punjab
A synthetic review of contraceptive supplies in punjab
Alexander Decker
 
A synthesis of taylor’s and fayol’s management approaches for managing market...
A synthesis of taylor’s and fayol’s management approaches for managing market...A synthesis of taylor’s and fayol’s management approaches for managing market...
A synthesis of taylor’s and fayol’s management approaches for managing market...
Alexander Decker
 
A survey paper on sequence pattern mining with incremental
A survey paper on sequence pattern mining with incrementalA survey paper on sequence pattern mining with incremental
A survey paper on sequence pattern mining with incremental
Alexander Decker
 
A survey on live virtual machine migrations and its techniques
A survey on live virtual machine migrations and its techniquesA survey on live virtual machine migrations and its techniques
A survey on live virtual machine migrations and its techniques
Alexander Decker
 
A survey on data mining and analysis in hadoop and mongo db
A survey on data mining and analysis in hadoop and mongo dbA survey on data mining and analysis in hadoop and mongo db
A survey on data mining and analysis in hadoop and mongo db
Alexander Decker
 
A survey on challenges to the media cloud
A survey on challenges to the media cloudA survey on challenges to the media cloud
A survey on challenges to the media cloud
Alexander Decker
 
A survey of provenance leveraged
A survey of provenance leveragedA survey of provenance leveraged
A survey of provenance leveraged
Alexander Decker
 
A survey of private equity investments in kenya
A survey of private equity investments in kenyaA survey of private equity investments in kenya
A survey of private equity investments in kenya
Alexander Decker
 
A study to measures the financial health of
A study to measures the financial health ofA study to measures the financial health of
A study to measures the financial health of
Alexander Decker
 

More from Alexander Decker (20)

Abnormalities of hormones and inflammatory cytokines in women affected with p...
Abnormalities of hormones and inflammatory cytokines in women affected with p...Abnormalities of hormones and inflammatory cytokines in women affected with p...
Abnormalities of hormones and inflammatory cytokines in women affected with p...
 
A validation of the adverse childhood experiences scale in
A validation of the adverse childhood experiences scale inA validation of the adverse childhood experiences scale in
A validation of the adverse childhood experiences scale in
 
A usability evaluation framework for b2 c e commerce websites
A usability evaluation framework for b2 c e commerce websitesA usability evaluation framework for b2 c e commerce websites
A usability evaluation framework for b2 c e commerce websites
 
A universal model for managing the marketing executives in nigerian banks
A universal model for managing the marketing executives in nigerian banksA universal model for managing the marketing executives in nigerian banks
A universal model for managing the marketing executives in nigerian banks
 
A unique common fixed point theorems in generalized d
A unique common fixed point theorems in generalized dA unique common fixed point theorems in generalized d
A unique common fixed point theorems in generalized d
 
A trends of salmonella and antibiotic resistance
A trends of salmonella and antibiotic resistanceA trends of salmonella and antibiotic resistance
A trends of salmonella and antibiotic resistance
 
A transformational generative approach towards understanding al-istifham
A transformational  generative approach towards understanding al-istifhamA transformational  generative approach towards understanding al-istifham
A transformational generative approach towards understanding al-istifham
 
A time series analysis of the determinants of savings in namibia
A time series analysis of the determinants of savings in namibiaA time series analysis of the determinants of savings in namibia
A time series analysis of the determinants of savings in namibia
 
A therapy for physical and mental fitness of school children
A therapy for physical and mental fitness of school childrenA therapy for physical and mental fitness of school children
A therapy for physical and mental fitness of school children
 
A theory of efficiency for managing the marketing executives in nigerian banks
A theory of efficiency for managing the marketing executives in nigerian banksA theory of efficiency for managing the marketing executives in nigerian banks
A theory of efficiency for managing the marketing executives in nigerian banks
 
A systematic evaluation of link budget for
A systematic evaluation of link budget forA systematic evaluation of link budget for
A systematic evaluation of link budget for
 
A synthetic review of contraceptive supplies in punjab
A synthetic review of contraceptive supplies in punjabA synthetic review of contraceptive supplies in punjab
A synthetic review of contraceptive supplies in punjab
 
A synthesis of taylor’s and fayol’s management approaches for managing market...
A synthesis of taylor’s and fayol’s management approaches for managing market...A synthesis of taylor’s and fayol’s management approaches for managing market...
A synthesis of taylor’s and fayol’s management approaches for managing market...
 
A survey paper on sequence pattern mining with incremental
A survey paper on sequence pattern mining with incrementalA survey paper on sequence pattern mining with incremental
A survey paper on sequence pattern mining with incremental
 
A survey on live virtual machine migrations and its techniques
A survey on live virtual machine migrations and its techniquesA survey on live virtual machine migrations and its techniques
A survey on live virtual machine migrations and its techniques
 
A survey on data mining and analysis in hadoop and mongo db
A survey on data mining and analysis in hadoop and mongo dbA survey on data mining and analysis in hadoop and mongo db
A survey on data mining and analysis in hadoop and mongo db
 
A survey on challenges to the media cloud
A survey on challenges to the media cloudA survey on challenges to the media cloud
A survey on challenges to the media cloud
 
A survey of provenance leveraged
A survey of provenance leveragedA survey of provenance leveraged
A survey of provenance leveraged
 
A survey of private equity investments in kenya
A survey of private equity investments in kenyaA survey of private equity investments in kenya
A survey of private equity investments in kenya
 
A study to measures the financial health of
A study to measures the financial health ofA study to measures the financial health of
A study to measures the financial health of
 

Recently uploaded

Why Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire businessWhy Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire business
panagenda
 

Recently uploaded (20)

TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data DiscoveryTrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
 
Apidays Singapore 2024 - Modernizing Securities Finance by Madhu Subbu
Apidays Singapore 2024 - Modernizing Securities Finance by Madhu SubbuApidays Singapore 2024 - Modernizing Securities Finance by Madhu Subbu
Apidays Singapore 2024 - Modernizing Securities Finance by Madhu Subbu
 
Emergent Methods: Multi-lingual narrative tracking in the news - real-time ex...
Emergent Methods: Multi-lingual narrative tracking in the news - real-time ex...Emergent Methods: Multi-lingual narrative tracking in the news - real-time ex...
Emergent Methods: Multi-lingual narrative tracking in the news - real-time ex...
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Script
 
Boost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfBoost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdf
 
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWER
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWEREMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWER
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWER
 
ICT role in 21st century education and its challenges
ICT role in 21st century education and its challengesICT role in 21st century education and its challenges
ICT role in 21st century education and its challenges
 
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
 
DBX First Quarter 2024 Investor Presentation
DBX First Quarter 2024 Investor PresentationDBX First Quarter 2024 Investor Presentation
DBX First Quarter 2024 Investor Presentation
 
A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?
 
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
 
AXA XL - Insurer Innovation Award Americas 2024
AXA XL - Insurer Innovation Award Americas 2024AXA XL - Insurer Innovation Award Americas 2024
AXA XL - Insurer Innovation Award Americas 2024
 
Web Form Automation for Bonterra Impact Management (fka Social Solutions Apri...
Web Form Automation for Bonterra Impact Management (fka Social Solutions Apri...Web Form Automation for Bonterra Impact Management (fka Social Solutions Apri...
Web Form Automation for Bonterra Impact Management (fka Social Solutions Apri...
 
MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
 
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
 
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemkeProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
 
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt Robison
 
Manulife - Insurer Transformation Award 2024
Manulife - Insurer Transformation Award 2024Manulife - Insurer Transformation Award 2024
Manulife - Insurer Transformation Award 2024
 
Why Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire businessWhy Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire business
 

First report on fusarium solani, a pathogenic fungus causing stem rot disease on dragon fruits (hylocereus sp.) in bali

  • 1. Journal of Biology, Agriculture and Healthcare ISSN 2224-3208 (Paper) ISSN 2225-093X (Online) Vol.3, No.17, 2013 www.iiste.org First Report on Fusarium solani, a Pathogenic Fungus Causing Stem Rot Disease on Dragon Fruits (Hylocereus sp.) in Bali Wiwik Susanah Rita1, Dewa Ngurah Suprapta2*, I Made Sudana2, I Made Dira Swantara3 1.Doctorate Program in Agricultural Science, School for Postgraduate Udayana University. 2.Laboratory of Biopesticide Faculty of Agriculture, Udayana University, Jl. PB. Sudirman Denpasar Bali Indonesia. 3.Laboratory of Chemistry, Faculty of Natural Science and Mathematic, Udayana University *Email of corresponding author : biop@dps.centrin.net.id Abstract In recent years, dragon fruit crop (Hylocereus spp.) has become increasingly important in Bali Indonesia due to its high nutrient content and healing properties. However, the dragon fruit was reported to be seriously infected with several complex diseases caused by fungi and causing serious losses to the farmers. The study on morphological and molecular characterization the fungal pathogen was conducted to confirm the species of the fungi. Koch Postulate was applied to confirm the causal agent of the disease. There were two isolates of fungi isolated from the stems of diseased plants, namely isolate w1 (from stem of H. undatus) and isolate w2 (from stem of H. polyrhizus). Based on macroscopic and microscopic characteristics, and analysis of 18S rDNA, both of them were identified as Fusarium solani. This is the first report on the F. solani the cause of stem rot disease on dragon fruits in Bali. Keywords : stem rot disease, dragon fruit, Fusarium solani 1. Introduction Dragon Fruits (Hylocereus spp.), which are also known as pitaya, are the fruits of cactus species, especially of the genus Hylocereus. There are three species which have high commercial valuable fruits are the species of Hylocereus undatus, (red rind, white flesh), Hylocereus polyrhizus (red rind, red flesh), and Hylocereus costaricensis (red rind, super red flesh). Hylocereus spp. is grown commercially in Vietnam, Spain, Malaysia, Japan, Mexico and other tropical and subtropical areas because of its high nutrient content and healing properties. In recent years, this fruit has become increasingly important in Bali Indonesia. The dragon fruit is rich in vitamin, it helps the digestive process due to its fiber, prevent colon cancer and diabetes, neutralize toxic substances such as heavy metals, and helps to reduce cholesterol levels and high blood pressure (He et al., 2012; Zainoldin and Baba, 2009). Recently, dragon fruit has been reported to be seriously infected with several complex diseases caused by fungi and causing serious losses to farmers. Several dragon fruit plants grown in Sobangan Village, Bali Indonesia showed severe symptom of stem rot disease. The disease caused significant yield losses. Isolation of the fungi associated with the diseased-plants showed that Fusarium sp. was the most frequent found on the stems showing brown rot symptom. Various diseases caused by fungi have been reported on dragon fruit in tropical and subtropical countries, such as fruit rot (Bipolaris cactivora) (Tarnowski et al., 2010; He et al. 2012), stem rot (Fusarium semitectum, Fusarium oxysporium, Fusarium moniliforme) (Hawa et al., 2010), anthracnose (Colletotrichum gloeosporioides) (Masyahit et al., 2009), brown spot (Botryodiplodia sp.), basal rot (Pythium sp.) (Lin et al., 2006), wilt (Fusarium oxysporium), stem blight (Diplodia sp., Ascochyta sp., and Phoma sp.), black spot (Alternaria sp.), speck blight (Nectriella sp.), (Wang et al.,2007), and stem lesion (Septogloeum sp.) (Zheng et al., 2009). In order to control the disease, it is necessary to identify the causal agent of the disease. The fungal pathogen can be identified based on cultural and morphological characters. However it could be highly variable depending on the media and cultural conditions that could be the problems in fungal identification. In recent years, the increasing use of molecular methods in fungal identification has emerged as a possible answer to the problems associated with the existing phenotypic identification systems (Mishra et al., 2003). One of the molecular approaches to fungal identification is based on Polymerase Chain Reaction (PCR). The main area for the development of fungal identification is ribosomal genes, present in all organisms and at high copy numbers aiding detection and the sensitivity of the PCR reaction. The fungal nuclear ribosomal DNA (rDNA) consist of three genes, the large subunit gene (25S), the small subunit gene (18S), and the 5.8S gene, separated by internal transcribed spacer (ITS) regions, in a unit repeated many times. The ITS region is an area of particular importance to fungal identification. It has areas of high conservation and areas of high variability and is an ideal starter for the development of specific PCR primers for identification of fungal species (Atkins and Clark, 2004). Sequences of the ITS regions ITS1 and ITS2 have been used widely in molecular phylogenetic studies because of their relatively high variability and facility of amplification. For phylogenetic 93
  • 2. Journal of Biology, Agriculture and Healthcare ISSN 2224-3208 (Paper) ISSN 2225-093X (Online) Vol.3, No.17, 2013 www.iiste.org applications, most researchers use sequence alignments that are based on nucleotide similarity (Tippery and Les, 2008). Suga et al. (2000) has investigated phylogenetic relationships of Fusarium solani using sequences from the rDNA-ITS region. Mishra et al. (2003) has developed a fluorescent-based polymerase chain reaction in ITS region to identify five toxigenic and pathogenic Fusarium species. Abd-Elsalam et al. (2003) have developed two taxon-selective primers for quick identification of the Fusarium genus. These primers, ITS-Fu-f and ITS-Fur were designed by comparing the aligned sequences of internal transcribed spacer regions (ITS) of a range of Fusarium species. Zhang et al. (2006) and O'Donnell et al. (2008) have studied phylogeni of Fusarium solani Species Complex (FSSC) that cause infection in both humans and plants based on three genes of the ribosomal DNA. The ITS region including 5.8S rDNA sequence of 58 isolates Candida parapsilosis in Brazil and Japan was analyzed by Iida et al. (2005). This paper reports on identification of fungal pathogen causing stem rot disease from dragon fruits planted in Bali based on morphological and molecular methods using sequences from rDNA-ITS region. 2. Materials and Methods 2.1. Fungal Pathogen Isolation and Virulence Test Fungi were isolated from the diseased stem of H. undatus and H. polyrhizus from dragon fruit’s orchard in Sobangan village, Mengwi Bali. Surface sterilization was carried out by cleaning the symptom margins with 70% ethanol and cut into small blocks (ca 1.5 x 1.5 x 1.5 cm), soaked in 1% sodium hypochlorite (NaOCI) for 3 min, and rinsed in several changes of sterile distilled water (each 1 min). All sterilized samples were placed onto Potato Dextrose Agar (PDA) and incubated at 25 ± 2°C for 7 days. Mycelium growing after 3 days of incubation was transferred to a new PDA to obtain pure fungal cultures. The pure culture was inoculated on healthy dragon fruit stems to confirm the similarity of symptoms in the field. For this purpose the Koch's postulates test was carried out. Dragon fruit stems (30 days in age) were injured with a sterile needle and inoculated by spraying with a suspension of spores of 1.5x106 spores/mL. Three plants were inoculated with a fungal isolate. For control, dragon fruit stems were pierced with a sterile needle and sprayed with sterile water. Symptoms were observed for a week after inoculation. The symptoms were compared with the symptoms of the disease in the field. After that, the isolation of pathogenic fungi on infected stem was performed again. Pure cultures of pathogenic fungi were inoculated again on dragon fruit plants and the same inoculation procedure was done to obtain the similarity of symptoms. Fungal isolates obtained can be regarded as the cause of the disease and were used for further identification. 2.2. Morphological Characterization Characterization of the main fungal pathogens was carried out macroscopically, by observing the fungal colony color, colony reverse color, no lines or concentric radier, issued exudates or not, media pigmentation, colony surface, and how the growth of fungi (fast or slow). Microscopic identification was also carried out by observing the shape of hyphae or spores under a microscope, and then the results were confirmed using fungal identification book (Pit and Hocking, 1997). 2.3. DNA Extraction Fusarium sp. isolates w1 and w2 were grown on potato dextrose agar (PDA) medium for 3 days at room temperature. The mycelium grown was harvested and grown to a fine powder in a sterile mortar with liquid nitrogen. DNA was extracted by using PhythopureTM DNA Extraction Kit (GE Healthcare, UK) according to manufacturer’s instructions. 2.4. Molecular identification and phylogenetic relationships of fungal pathogen Identification of fungal isolates was performed based on molecular genetic analysis using the internal transcribed spacer region (ITS). PCR amplification used ITS 5 F: 5`- GGAAGTAAAAGTCGTAACAAGG - 3` and ITS 4 R: 5 `- TCCTCCGCTTATTGATATGC - 3 '(White et al. 1990). Amplification was performed on a volume of 25 L with the reaction mixture: 10 µL nuclease free water, 12.5 µL Go taq green master mixTM, ITS5 and ITS4 each 0.5 µL, 0.5 µL DMSO, and 1 µL of DNA template. PCR amplification for regional ITS consists of: pre denaturation 95 ºC for 90 seconds, followed by 95 ºC for 30 seconds with 35 cycles, annealing 55 ºC in 30 seconds, extension 72 ºC in 90 seconds, and final extension 72 ºC for 5 minutes. The product was purified and then sequenced. The nitrogen base sequence was analyzed using automated DNA sequencer (ABI PRISM 3130 Genetic Analyzer) (Applied Biosystems). Sequencing raw data were trimmed and assembled using ChromasPro program version 1.5. The assembled data were BLASTED with genomic data that has been registered in NCBI / National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/BLAST/). Some data sequence which is a result of blast nearest species and is a type strains of each species were taken from the data in the NCBI gene bank. Then the data were analyzed again with the sequence aligment using MEGA version5.0 program (Tamura et al. 2011) and boostrap used is 1000 replications (Felsenstein, 1985). 94
  • 3. Journal of Biology, Agriculture and Healthcare ISSN 2224-3208 (Paper) ISSN 2225-093X (Online) Vol.3, No.17, 2013 www.iiste.org 3. Results and Discussion 3.1. Fungal Isolates There are 10 fungal isolates were obtained from isolation of fungi associated with the stem disease of dragon fruits grown in Sobangan Village, Bali Indonesia. Based on the Koch's postulates test, there were two isolates of Fusarium sp. namely isolate w1 (from H. undatus) and isolate w2 (from H. polyrhizus) caused the stem rot disease with the symptom similar to the symptom occurred in the field. The symptom appeared on stem as dark brown stem rot as shown in Figure 1. Figure 1. Symptoms of the stem rot diseases on Hylocereus sp. under field conditions. 3.2. Macroscopic Characteristic Fusarium sp. isolate w1 grown on PDA produced abundant mycelium (sometimes in aerial, depends on cultural condition), white colony appearance, cream colony reverse, yellow to brown pigmentations, and fast growing (3.75-4.45 cm in 3 days) whereas Fusarium sp. isolate w2 produced abundant-powdery mycelium (sometimes in aerial), white colony appearance, yellow colony reverse, yellow pigmentations, and fast growing (4.35-5.25 cm in 3 days). In a similar study, Chandran and Kumar (2012) studied for cultural, morphological variability in 13 isolates of Fusarium solani (Mart.) Sacc., incitant of dry root-rot of citrus, they reported that F. solani isolates were characterized as fast growing, moderately growing, and slow growing. The five isolates produced pale pink to dusky red color pigmentation in PDA medium and potato dextrose broth culture. The remaining all isolates produced pale yellow to dark yellow pigmentation. Most of the isolates produced profuse sporulation, whereas others produced moderate sporulation. Madhukeshwara (2000) has studied cultural variability among six isolates of F. udum causing wilt of pigeon pea. All the isolates varied with each other in terms of growth, mycelium, pigmentation, and sporulation. Most of the isolates produced cottony white raised mycelium, pale yellow to dusky red color pigmentation and moderate to profuse sporulation on PDA medium. 3.3. Microscopic Characteristics Microscopic characters such as size, shape, septation, and color of conidia were studied using PDA medium. Fusarium sp. isolate w1 had longer macroconidia (1-4 septates; 18.4-31.7 µm in length), curved in shaped with hyaline in color, whereas Fusarium sp. isolate w2 had shorter macroconidia (1-3 septates; 15.3-24.8 µm in length), curved in shaped with hyaline in color. Fusarium sp. isolate w1 produced less microconidia while Fusarium sp. isolate w2 produces abundant microconidia (1 septate; 5.7- 8.5 µm in length), round to oval in shaped. Furthermore both the fungi had the septate hyphae and clamydospores in pairs with hyaline in color and located in the middle of hyphae as presented in Figure 2. Pitt and Hocking (1997) reported that the main characters used to distinguish species of Fusarium are the size and shape of the macroconidia; the presence or absence of microconidia; and the presence of chlamydospora. Kawuri et al. (2012) reported that Fusarium oxysporum had macroconidia curved in shaped with four septates and foot cell, 31μm length and smooth surface, whereas microconidia has rough surface at 4.6 μm length. Chandran and Kumar (2012) reported that the number of septa in macro conidia and micro conidia of Fusarium solani (Mart.) Sacc. are 3-5 and 0-1 respectively and the color is hyaline. The shape of macro conidia is sickle shaped with blunt ends and micro conidia is round to oval shaped. The chlamydospores located in middle of hyphae (intercalary), on tip of the hyphae (terminal) and some chlamydospores were seen in middle of macro conidia. A B 95
  • 4. Journal of Biology, Agriculture and Healthcare ISSN 2224-3208 (Paper) ISSN 2225-093X (Online) Vol.3, No.17, 2013 www.iiste.org Figure 2. Microscopic characteristics of Fusarium sp. isolate w1 (A) macro conidia (B) septated hypae (C) Chlamydospore. Bars = 10 m. 3.4. Molecular Characteristics of the Pathogenic Fungus PCR amplification of 18S rDNA of Fusarium sp. isolates w1 and w2 with primers ITS5 (F: 5`GGAAGTAAAAGTCGTAACAAGG -3`) and ITS4 (R: 5`-TCCTCCGCTTATTGATATGC- 3') produced about 560 bp of DNA fragments, it is corresponding to 18S rDNA (Figure 3). The fragments then sequenced to determine the species of fungus based on the similarity with other references of identified species. Based on the 18S rDNA analysis showed that Fusarium sp. isolates w1 and w2 have a close relationship with Fusarium solani. This can be seen in the phylogenetic tree shown in Figure 5. Fusarium sp. isolates w1 and w2 have 99% similarity with Fusarium solani strain 68 18S ribosomal RNA gene (Accession Number Gen Bank: JX897001.1), Fusarium solani strain H8 18S ribosomal RNA gene (Accesion Number Gen Bank: JF323002.1), and Fusarium solani genomic DNA containing partial 18S rRNA gene (Accession Number Gen Bank: FR691777.1). They have a larger similarity (100%) with Fusarium sp. r323 18S ribosomal RNA gene, partial sequence (Accession Number Gen Bank: HQ649839.1), and Fusarium solani strain M146 18S ribosomal RNA gene(Accession Number Gen Bank: JN127379.1) (Table 1). Figure 3. PCR amplification of the ITS gene with primer ITS_5F and primer ITS_4R. M = marker 1 Kb ladder (Fermentas), 1 = PCR product of Fusarium sp. isolate w2, and 2 = PCR product of Fusarium sp. isolate w2 96
  • 5. Journal of Biology, Agriculture and Healthcare ISSN 2224-3208 (Paper) ISSN 2225-093X (Online) Vol.3, No.17, 2013 www.iiste.org Fusarium sp. isolat w1 Fusarium sp. isolat w2 Fusarium sp. r323 100 Fusarium solani strain 68 Fusarium solani strain M146 Fusarium solani strain H8 Fusarium solani DNA containing Fusarium sp. r104 Mel anelixia aff. Fuliginosa Crespo 6005o 100 Mel anelixia Fuliginosa voucher Robertson 7140 Leptodiscella sp. FMR 10885 Leptodiscella chlamydospora 100 0.05 Figure 4. Phylogenetic relationship constructed from ITS sequences of the characterized clone library of Fusarium. Bootstrap value greater than 50% are shown at each node. Table 1.comparisons of 18S rDNA gene similarity levels of Fusarium sp. isolates w1 and w2 with multiple sequences in GenBank using BLAST program Isolates % Similarity Accession Fusarium solani strain 68 18S ribosomal RNA gene, 99 JX897001.1 Fusarium solani strain H8 18S ribosomal RNA gene, 99 JF323002.1 Fusarium solani genomic DNA containing partial 18S rRNA gene 99 FR691777.1 Fusarium sp. r323 18S ribosomal RNA gene, partial sequence 100 HQ649839.1 Fusarium solani strain M146 18S ribosomal RNA gene 100 JN127379.1 From the Table 1 and Figure 4, it can be seen that Fusarium sp. isolates w1 and w2 are closely related to the Fusarium solani strain 68 18S ribosomal RNA gene, Fusarium solani strain H8 18S, Fusarium solani genomic DNA containing partial 18S rRNA gene, Fusarium sp. r323 18S ribosomal RNA gene, and Fusarium solani strain M146 18S ribosomal RNA gene. Ronquillo (2012) reported that the Fusarium solani strain H8 18S caused bud rot in the oil palm in Ecuador. Shahnazi et al. (2012) investigated that Fusarium solani strain H8 18S caused yellowing disease of black pepper (Piper nigrum L.) in Malaysia. Sarmiento-Ramirez et al. (2010) reported that Fusarium solani genomic DNA containing partial 18S rRNA gene was responsible for mass mortalities in nests of logger head sea turtle. Fusarium sp. r323 18S ribosomal RNA gene was associated with Roots of Halophytic and Non-halophytic Plant Species was reported by Macia-Vicente et al. (2012). In addition, Rosado-Rodriguez et al. (2011) reported that Fusarium solani strain M146 18S ribosomal RNA gene was associated with Leatherback Sea Turtle (Dermochelys coriacea) Nests in the Mayaguez-Anasco Bay Coast, Western Puerto Rico. Fusarium solani is one of the most frequently isolated fungi from soil and plant material, where they act as decomposers, but they are also host-specific pathogens of a number of agriculturally important plants, including sweet potato, cucurbits, and pea. Moreover, they are increasingly associated with opportunistic infections of humans and other animals, causing systemic infections with a high mortality rate, as well as localized infections in the skin and other body parts (Zhanget al., 2006). Mycotoxin trichothecenes produced by Fusarium is very toxic for human (Miller and Trenholm, 1994). This toxin can cause cancer, hemorrhage, edema and immune deficiency (Alexoupolos et al., 1996). WHO (1979) reported that mycotoxins are hazardous to human and animal health. 4. Conclusion Based on the results of present study, it can be concluded that the causal agent of the stem rot disease on dragon fruits (Hylocereus sp.) in Bali is identified as Fusarium solani. Hard efforts must be done to control the disease in order to reduce the losses of dragon fruit production and the risk of mycotoxins contamination which are probably produced by Fusarium solani. Acknowledgement Authors wish to express their appreciation to the Laboratory of Biopesticide, Faculty of Agriculture Udayana 97
  • 6. Journal of Biology, Agriculture and Healthcare ISSN 2224-3208 (Paper) ISSN 2225-093X (Online) Vol.3, No.17, 2013 www.iiste.org University, Bali for financial support under research grant No. 05/biop-IV/2012. References Alexoupolos, C.J., C.W. Mims and M. Blackwell, 1996. Introductory Mycology.John Wiley and Sons.Inc. Singapore. Atkins, S.D. and I.M. Clark, 2004. Fungal molecular diagnostics: a mini review, J. Appl. Genet., 45: 3-15. Chandran, M.R. and M.R. Kumar, 2012.Studies on cultural, morphological variability in isolates of Fusarium solani (Mart.) Sacc., incitant of dry root-rot of Citrus. Current Biotica, 6: 152-162. Felsenstein. J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution, 39: 783– 791. He, P.F., H. Ho, X. Wu, M.S. Hou, and Y.Q. He, 2012. Bipolaris cactivora causing fruit rot of dragon fruit imported from Vietnam. Plant Pathology & Quarantine, 2: 31-35. Hawa, M.M, B. Salleh and Z. Latiffah, 2010. Characterization and intraspecific variation of Fusarium semitectum (Berkeley and Ravenel) associated with red-fleshed dragon fruit (Hylocereus polyrhizus [Weber] Britton and Rose) in Malaysia. African Journal of Biotechnology, 9: 273–284. Iida, S., T. Imai, T. Oguri, K. Okuzumi, A. Yamanaka, M.L. Moretti-Branchini, K. Nishimura, and Y. Mikami, 2005.Genetic Diversity of the Internal Transcribed Spacer (ITS) and 5.8S sRNA Genes among The Clinical Isolates of Candida parapsilosis in Brazil and Japan.Jpn. J. Med., 46: 1333-137. Kawuri, R., D.N. Suprapta, Y. Nitta, and T. Homma, 2012. Destructive Leaf Rot Disease Caused by Fusarium oxysporum on Aloe barbadensis Miller in Bali. Agricultural Science Research Journal, 2: 295–301. [cited: 2013 July 15]. Available online from http://www.resjournals.com/ARJ Lin, C.C., W.B. Guo and S.F. Cai, 2006. Diseases of red dragon fruit in Taiwan. Good Year (Chinese), 56: 38– 42. Macia-Vicente, J.G., V. Ferraro, S. Burruano and L.V. Lopez-Llorca, 2012. Fungal Assemblages Associated with Roots of Halophytic and Non-halophytic Plant Species Vary Differentially Along a Salinity Gradient. Microb. Ecol., 64: 668-679. Madhukeshwara, S. S., 2000. Studies on variation and management of Fusarium wilt of igeonpea (Cajanus cajan). M.Sc., Thesis, UAS, GKVK, Bangalore pp: 85-94. Masyahit, M., K. Sijam, Y. Awang, M. Ghazali and M. Satar, 2009. The First Report of the Occurrence of Anthracnose Disease Caused by Colletotrichum gloeosporioides (Penz.) Penz. & Sacc.on Dragon Fruit (Hylocereus spp.) in Peninsular Malaysia. American Journal of Applied Sciences, 6 : 902-912. Mishra, P.K., R.T.V. Fox and A. Culham, 2003. Development of a PCR-based assay for rapid and reliable identification of pathogenic Fusaria. FEMS Microbiology Letters, 218: 329-332. O’Donnell, K., D.A. Sutton, A. Fothergill, D. McCarthy, M.G. Rinaldi, M.E. Brandt, N. Zhang and D.M. Geiser, 2008. Molecular Phylogenetic Diversity, Multilocus Haplotype Nomenclature, and In Vitro Antifungal Resistance within the Fusarium solani Species Complex, J. Clin. Microbiol., 46 : 2477-2490. Pit, J.I. and A.D. Hocking, 1997. Fungi and Food Spoiladge. 2nd Edition. Blackie Academic and Professional Press. Pp. 137-139. Ronquillo, M.P., 2012. Etiology of Bud Rot in the Oil Palm in Ecuador. Crop Protection, 2.http://getentry.ddbj.nig.ac.jp/getentry/na/JX897001/?filetype =html. Rosado-Rodriguez,G., 2011. Mycelial Fungal Diversity Associated with Leatherback Sea Turtle (Dermochelys coriacea) Nests in the Mayaguez-Anasco Bay Coast, Western Puerto Rico. Biology, http://getentry.ddbj.nig.ac.jp/getentry/na/JN127379/?filetype=html Sarmiento-Ramirez, J.M., E. Abella, M.P. Martin, M.T. Telleria, L.F. Lopez-Jurado, A. Marco, and J. DieguezUribeondo, 2010. Fusarium solani is responsible for mass mortalities in nests of loggerhead sea turtle, Caretta caretta, in Boavista, Cape Verde. FEMS Microbiol Lett. 312 : 192-200. Shahnazi, S., S. Meon, G. Vadamalai, K. Ahmad and N. Nejat, 2012. Morphological and molecular characterization of Fusarium spp. associated with yellowing disease of black pepper (Piper nigrum L.) in Malaysia. J. Gen Plant Pathol.,78: 160-169. Suga, H., T. Hasegawa, H. Mitsui, K. Kageyama and M. Hyakumachi, 2000. Phylogeneticanalysis of the phytopathogenic fungus Fusarium solani based on the rDNA-ITS region. Mycol. Res., 104: 1175-1183. Tamura, K., D. Peterson, N. Peterson, N. Stecher, M. Nei and S. Kumar, 2011. MEGA5: Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol Biol Evo. [cited 2013 July 15]. Available online at: http://mbe.oxfordjournals.org/content/early/2011/08/17/. Tarnowski, T. L. B., A.J. Palmateer and J.H. Crane, 2010. First Report of Fruit Rot on Hylocereusundatus Caused by in South Florida. The American Phytopathological Society, 94: 1605.2. Tippery, N.P. and D.H. Les, 2008. Phylogenetic analysis of the internal transcribed spacer (ITS) region in 98
  • 7. Journal of Biology, Agriculture and Healthcare ISSN 2224-3208 (Paper) ISSN 2225-093X (Online) Vol.3, No.17, 2013 www.iiste.org Menyanthaceae using predicted secondary structure. Molecular Phylogenetics and Evolution, 49: 526– 537. Wang, D.F., Q. Wei, R. Yang, W.J. Sang, G.Q. Fan and Y.L. Jin, 2007 – Preliminary identification of disease of pitaya in Luodian Country. Journal of Mountain Agriculture and Biology (Chinese), 26: 267–270. White, T.J., T. Bruns, Lee and S.J. Taylor, 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In MA Innis, DH Gelfand, JJ Sninsky; T. J. White, (Eds). PCR Protocols: a Guide to Methods and Applications. Pp. 315-322. Academic Press, San Diego, CA. World Health Organization (WHO). 1979. Mycotoxins, Environment, Health Criteria No. 11, Geneva. Zainoldin, K.H. and A.S. Baba, 2009. The Effect of Hylocereus polyrhizus and Hylocereus undatuson Physicochemical, Proteolysis, and Antioxidant Activity in Yogurt. World Academy of Science, Engineering and Technology, 60: 361-366. Zhang, N., K. O’Donnell, D.A. Sutton, F.A. Nalim, R.C. Summerbell, A.A. Padhye and D.M. Geiser, 2006. Members of the Fusarium solani Species Complex That Cause Infections in Both Humans and Plants Are Common in the Environment. J. Clin. Microbiol., 44: 2186-2190. Zheng, W., B. Wang and Y.Q. Cai, 2009. Inhibitory test for Septogloeum sp. causing stem lesion of pitaya with fungicides. Jiangsu Agricultural Sciences (Chinese), 5:151–152. 99
  • 8. This academic article was published by The International Institute for Science, Technology and Education (IISTE). The IISTE is a pioneer in the Open Access Publishing service based in the U.S. and Europe. The aim of the institute is Accelerating Global Knowledge Sharing. More information about the publisher can be found in the IISTE’s homepage: http://www.iiste.org CALL FOR JOURNAL PAPERS The IISTE is currently hosting more than 30 peer-reviewed academic journals and collaborating with academic institutions around the world. There’s no deadline for submission. Prospective authors of IISTE journals can find the submission instruction on the following page: http://www.iiste.org/journals/ The IISTE editorial team promises to the review and publish all the qualified submissions in a fast manner. All the journals articles are available online to the readers all over the world without financial, legal, or technical barriers other than those inseparable from gaining access to the internet itself. Printed version of the journals is also available upon request of readers and authors. MORE RESOURCES Book publication information: http://www.iiste.org/book/ Recent conferences: http://www.iiste.org/conference/ IISTE Knowledge Sharing Partners EBSCO, Index Copernicus, Ulrich's Periodicals Directory, JournalTOCS, PKP Open Archives Harvester, Bielefeld Academic Search Engine, Elektronische Zeitschriftenbibliothek EZB, Open J-Gate, OCLC WorldCat, Universe Digtial Library , NewJour, Google Scholar