Analysis of loss of heterozygosity of the tumor

Journal of Natural Sciences Research www.iiste.org
ISSN 2224-3186 (Paper) ISSN 2225-0921 (Online)
Vol.2, No.8, 2012

ANALYSIS OF LOSS OF HETEROZYGOSITY OF THE TUMOR
SUPPRESSOR GENES IN PAPILLARY THYROID CARCINOMA
(PTC)
Hesat Aliu, Nexhbedin Beadini, Sheqibe Beadini, Gazmend Iseni
Faculty of Medical Sciences
Department of Molecular Biology and Biochemistry
State University of Tetova, Macedonia
*E-mail of the corresponding author: arburim.iseni@unite.edu.mk
Abstract
The loss of heterozygosity in a cell implies a loss in the normal functioning of the allele of a given gene in which the
other allele has previously been deactivated. This phenomenon is usual in different tumors, which shows the lack of a
tumor suppressor gene in the lost region. The aim of this study was to examine the loss of heterozygosity in papillary
thyroid carcinoma (PTC). Sequences, in which certain tumor suppressor genes are seen, have been analyzed, as is the
gene that codifies the M6P/IGFIIR receptor as well as three specific loci of chromosome 11. A total 98 samples have
been analyzed. The half of those samples were taken from persons with papillary thyroid carcinoma and the other half
were controls from tissues around the respective tumors. The micro-satellite markers in the M6P/IGFIIR gene region
as well as in the three loci of chromosome 11 were multiplied by using the PCR method, whereas the analysis of allelic
situation as well as the LOH phenomenon was done after the completion of the gel electrophoresis in the
polyacrilamide (PAA). In the M6P/IGFII gene region, 49% of the samples were heterozygote, i.e. informative,
whereas in the three regions of the chromosome 11 the percentage of heterozygotes varied between 53 and 63%. The
phenomenon of the loss of heterozygosity was not present in any of the analyzed samples for the respective
micro-satellite markers. Even though the number of informative heterozygote samples was above 50%, the loss of
heterozygosity did not occur in any of them. We can therefore conclude that the percentage of heterozygosity is not
necessarily related to the loss of heterozygosity; the papillary thyroid carcinoma in these patients was not caused by the
LOH phenomenon in the given regions.
Keywords: Papillary carcinoma of the thyroid gland (PTC); Loss of heterozygosity (LOH); M6P/IGF2R gene;
microsatellite markers

INTRODUCTION
The papillary thyroid carcinoma is the most frequent type of the thyroid gland cancer and it covers up to 80 or 90% of
the cases (1). It is generally accepted that the pathogenesis of cancer involves accumulation of multiple molecular
abnormalities over time. Those alterations can be classified in the following 6 functional sets: self-sufficiency in
growth signals due to mutations in proto-oncogenes, insensitivity to antiproliferative signals as result of mutations
affecting the tumor suppressor genes, evading of apoptosis by up-regulation of antiapoptotic or down-regulation of
proapoptotic molecules, limitless replicative potential due to activation of telomerase, sustained angiogenesis and
capability for tissue invasion ant consequent metastasis (2).

The main function of the TSGs is to regulate the cell cycle, control the proliferation processes, differentiate and
maintain full genomic stability, etc. The loss or deactivation of suppressor tumor genes plays an important role in the
development and advancement of many tumors. One of the characteristics of the TSGs is that both alleles of the gene
have to be damaged in order for the transformation to take effect. TSGs can be deactivated by point mutations and
partial or full deletions (3). TSGs can also be deactivated at a post-transcriptional level (4).
The M6P/IGFIIR receptor gene is localized on the long side of chromosome 6 (6q26-27) (5). It has already been
confirmed that head and neck malign tumors emerge as a result of the loss of heterozygosity for the M6P/IGFIR2 gene
(6). In the liver cells, the locus in which this gene is situated is supposed to be behaving as a tumor suppressor gene (7,
8).

46

Vol.2, No.8, 2012

The genetic studies of the cervical cancer have proven frequent loss of heterozygosity by affecting multiple
chromosomal regions, such as 3p, 5p, 6p, and 11q – something that shows the presence of tumor suppressor genes in
these regions. The majority of studies show that chromosome 11 in different regions such as 11q13 and 11q22-23
reveals LOH (9).

In the chromosome 11 and more precisely locus 11q23-24 has been identified as a frequently-deletive region in a great
number of tumors, including breast tumor, lung tumor and ovarian cancer from 45 to 63% (10). The fact that locus
11q22-23 is the most frequent target of the LOH phenomenon in many tumors, suggests that this region includes one or
more tumor suppressor genes (11).

One of the ways to analyze the tumor suppressor genes is the detection of LOH (12). In order to analyze the LOH, the
polymorph regions of DNA are used, known as microsatellites. Microsatellites are tandemic sequences repeated in two
to four nucleotides (mostly CA dinucletoides), which are present in different loci along all the chromosomes.

Due to the high level of microsatellite loci polymorphism, an individual can possess a different number of repetitions in
the homolog chromosome pair known as heterozygote. In order to find the LOH, it is necessary to compare the DNA of
the tumoral tissue and the constitutive DNA of the healthy tissue in the same individual.

If there are two alleles of the given microsatellite locus in the healthy tissue and one in the tumoral tissue, we can say
that the LOH has occurred in that tumor. The LOH phenomenon shows a deletion of a molecule sequence of the DNA
and the loss of the tumor suppressor gene (TSG) which is situated in that region.

By analyzing the microsatellites in tumoral tissues we can also detect the microsatellite instability (MIS), which means
that the size of the microsatellite allele in the tumor is different from the healthy tissue (13).

The aim of this study was to examine: a) the heterozygosity frequency of the M6P/IGF2R gene and three loci in
chromosome 11; b) LOH for the gene in the respective loci.

MATERIALS AND METHODS

Tissue samples
The research material samples were taken from the tumor bank (-80°C) at the Molecular Medicine Laboratory – Rudjer
Boshkovic Institute in Zagreb, Croatia (14). Ninety eight (98) samples were examined in total – forty nine (49) taken
from individuals with papillary thyroid carcinoma and forty nine (49) taken from tissues surrounding the respective
tumors (non-tumoral).

All of the patients agreed in a written form to allow the usage of their removed tissues for scientific-research aims
(informed consent). The patients’ age was between 14 and 72, with an average of 48. The phenol-chloroform and
KSDS standard proteinase procedure was used to isolate the DNA (15).

The isolated DNA was detected by the gel electrophoresis in 2% agarose and then was photographed. The
microsatellite marker amplification was carried out by the polymerase chain reaction (PCR) using the Perkin Elmer
Thermal Cycler 2400.

The amplification reaction volume of the DNA was 25uL, and contains “master mix” 5 x puffer TaqMaster, 10 puffer,
dNTP (10mM), basic oligonucleotides 8 pmol/ µL (0,32 µM), genomic DNA 200 ng, Taq polymerase 0,05 µL (5 U/
µL), sterilized and deionized water up to 25 µL.

Eight (8) different basic oligonucleotides (primers) were used in the PCR. The primer composition, anilination
temperature and the size of alleles has been illustrated in Table 1 (16). The amplification was done by following this
program: the initial DNA molecule denaturation lasts for three minutes at 96°C and then in the following 35 cycles

47

Vol.2, No.8, 2012

denaturation occurs at 96°C in every 30 seconds; the repeated hybridization of oligonucleotides lasts 35 seconds at
57°C (JJMI; D11S1353; D114094; D114144) and the elongation of basic oligonucleotides (primers) in 30 seconds
with an additional second in every consequent cycle at 72°C. the final elongation was done at 72°C in 7 minutes.

After the completion of the PCR reaction, the size and quality of PCR products was tested in 2% gel agarose. The
amplifiers were paired in the polyacrilamide gel (PAA) 12%-14% with dimensions 20cm x 30cm. A pair consists of a
PCR product, a normal tissue and a tumoral tissue of the same individual.

The longitude of the electrophoresis in the PAA gel in a puffer 1xTBE at tension of P = 35W is between 18 and 20
hours, whereas a xylene – cyanol colour marker was used to monitor the process of agarose gel electrophoresis and
polyacrilamide gel electrophoresis (migrates at the speed of a 110 base pair DNA fragment) and a blue bromphenol
(migrates at the speed of a 140 base pair DNA fragment) (17). After the completion of electrophoresis, the gel was
separated from the glass and was put in ethanol 10%. After some 20-30 minutes the ethanol was removed by a water
pump and a nitrite acid 1% was added in the dish. The gel is oxidized for 5 minutes in this composition.

After the brief flushing, distilled water is again used to clean it at least three times whereas in the gel dish a 0.2% silver
nitrate is added. The gel is incubated in it for the following 30 minutes. Then the gel is flushed well with distilled water
and a cooled (+4 °C) amplifier is added to the dish. After the DNA stripes become visible, the amplifier is removed and
a 5% acetic acid is added in order to stop the reaction (18). By comparing the sizes of tumoral and normal markers we
can conclude the presence of two different microsatellite stripes (two different alleles) in the tumor and the controlling
sample, i.e. heterozygosity is present (Het) and exactly these two cases were informative for the analysis of the LOH;
on the other hand, the presence of a stripe (two identical alleles) in the tumor and the controlling sample is known as
homozygosity (Hom) which is not informative for purposes of LOH analysis. The LOH was expected to be confirmed
only if the allele from the normal sample was missing in the tumoral one.

Table 1. The composition of primers, anilination temperature and the size of used alleles to detect the LOH

Amplified sequence Alignment and composition of bases 5’ to Annealing Allele size
3’ temperature (pb)
JJMIF
JJMIR 5'-TTGCCGGCTGGTGAATTCAA 57°C 160
M6P/IGF2R 5'-CTCTTCAGGTTCTCATGATA

D11S4094 F
D11S4094 R F 5’ CTAAAGAACAGCCAGTCA 57°C 200
For the long arm of chromosome R 5’ GGAGTCGGGGAATTTCTAA
11

D11S1353 F
D11S1353 R F 5’ GATATGTCCCCAAATCCA 57°C 180
For the long arm of chromosome R 5’ CCAACGCTTAAAATGTTAGC
11

D11S4144 F
D11S4144 R F 5’ AGACAGGTCTTCACCACAGC 57°C 200
For the long arm of chromosome R 5’ ATGGCTTCCAGGTTAGTGC
11

48

Vol.2, No.8, 2012

RESULTS

In Photo 1 we can see some of the DNA samples isolated with phenol/chloroform from the normal and tumoral tissues
with a size of 23310 base pairs (bp) and fractioned in 2% agarose gel and diluted with Tris EDTA.

Photo 1. Isolated DNA samples from normal tissues (N1) and tumoral tissues (T1) with a size of 23310 base pairs (bp)
The second photo shows PCR products of the four analyzed loci, in 2% agarose gel, with a size from 160 to 200 bp.

Photo 2. PCR products in 2% agarose gel; ST-Standart loci M6P/IGF2R, D11S4094, D11S4144, D11S1353

49

Vol.2, No.8, 2012

Table 2 shows the number of patients, respective records for each of the individuals, microsatellite markers for
chromosome 11, D11S1353 F/R, D114144 F/R, D114094 F/R and marker microsatellites for IGF2R of chromosome 6;
JJMIF/JJMIR and the allelic status for each of microsatellite in the polyacrilamide gel.

Table 2. Patient data and allelic status for every sample

Isolated DNA samples PCR product in 12-14% polyacrilamide gel from 0,5 Isolated DNA samples PCR product in 12-14% polyacrilamide gel from 0,5 -

- 2µL 2µL

Normal Tumoral D11S1353 D114144 D114094 JJMIF Normal Tumoral D11S1353 D114144 D114094 JJMIF

N.R tissue tissue F/R F/R F/R JJMIR N.R tissue tissue F/R F/R F/R JJMIR

1 NT– Ć T-Ć Het Het Het* Hom˟

2 N–T T-T Hom Het Het Hom 26 NT23 T23 het Hom Het Het

3 NT-M T-M Hom Hom Hom Het 27 NT24 T24 Hom Hom Het Het

4 NT – MA T – MA Hom het Hom Hom 28 NT25 T25 Het Hom Het Het

5 NT-P T-P Het Het Hom Het 29 NT26 T26 Het Het Het Hom

6 NT-MAR T-MAR Het Hom Het Hom 30 NT27 T27 Het Hom Het Het

7 NT-J T-J Het Hom Het Hom 31 NT28 T28 Het Het Het Het

8 NT SB T SB Hom Het Hom Het 32 NT29 T29 Het Het Het Het

9 NT S TS Het Het Het Het 33 NT30 T30 Hom Hom Hom Hom

10 1N 1T Hom Hom Het Hom 34 NT31 T31 Het Hom Hom Hom

11 2N 2T Het Hom Het Hom 35 NT32 T32 Hom Hom Hom Hom

12 3N 3T Hom Het Hom Hom 36 NT33 T33 Hom Hom Hom Hom

13 ŠN 1 ŠT 1 Het Het Het Hom 37 NT40 T40 Hom Het Hom Hom

14 ŠN 2 ŠT 2 Het Het Het Het 38 NT41 T41 Het Hom Het Hom

15 SN4 ST4 Het Het Het Het 39 NT42 T42 Hom Hom Het Hom

16 SN5 ST5 Hom Het Hom Hom 49 NT43 T43 Het Hom Het Het

17 SN7 ST7 Hom Het Hom Hom 41 D.LN D.T Hom Hom Het Hom

18 SN8 ST8 Hom Het Hom Het 42 NT44 T44 Het Het Hom Hom

19 NT13 T13 Hom Het Hom Het 43 NT45 T45 Het Het Het Het

20 NT15 T15 Het Het Het Het 44 NT46 T46 Het Het Hom Hom

21 NT16 T16 het Hom Het Hom 45 NT48 T48 Het Hom Het Hom

22 NT17 T17 Het Het Het Het 46 NT49 T49 Het Het Hom Het

23 NT19 T19 het Hom Het Hom 47 NT50 T50 Hom Het Het Het

24 NT20 T20 hom Hom Het Het 48 NT51 T51 Het Hom Hom Het

25 NT22 T22 hom Hom Het Het 49 NT53 T53 Hom Het Het Het

50

Vol.2, No.8, 2012

Het* informative heterozygote; Hom˟ informative homozygote

The Het abbreviation refers to the heterozygote state whereas the Hom abbreviation refers to the homozygote state.
The allelic status is always the same for a normal and tumoral respective sample. But, based on the results, it seems that
the same individual has a different allelic status for different microsatellites. E.g. the individual N-T/T-T is
homozygote for two loci of the chromosome and for another two is heterozygote.

Table 3 shows the percentage of heterozygote informative samples for each of the microsatellite markers. We can see
that there is a lower percentage of heterozygotes for the microsatellite marker JJMIF/JJMIR in 24 of 49 cases or 49%,
and a higher percentage of heterozygotes has been recorded for the D114049F/R microsatellite marker, i.e. 31 out of 49
cases or 63%.

Table 3. The percentage of heterozygotes for each microsatellite marker
Basic oligonucleotides (primers) Percentage of heterozygotes
JJMIF 24/49 49%
JJMIR
D11S1353 F/R 28/49 57%
D114094 F/R 31/49 63%
D114144 F/R 26/49 53%

51

Vol.2, No.8, 2012

Photo 3. PCR products in polyacrilamide gel 12%, ST (Standard), 1N-Normal, 1T-tumoral (informative)

A total of 49 samples of tissues with tumor of the papillary carcinoma of the thyroid gland were analyzed along with 49
non-tumoral samples. The DNA molecules, amplified with the chain proliferase reaction were fractioned in a 12-14%
gel as shown in Photo 3.

The section of informative samples (heterozygote) in our study for the M6PR/IGFIIR gene was 49% or 24 out of 49
cases, whereas in the region of the chromosome 11 we had the following situation: D11S1353 F/R 57% or 28/49 of the
cases, D11S4049 63% 31/49, D11S4144 53% or 26/49 of the cases.

We were not able to identify the LOH for the M6P/IGFIIR gene as well as the three primer pairs for the described
11q22-23 and D11S4049, D11S4144, and D11S1353 chromosome regions in any of the informative heterozygote
sample cases.

DISCUSSION

The M6PR/IGFIIR gene codes the multifunctional protein which is included in the lysosome biogenesis, fetal
organogenesis as well as the lymphocyte-inducted apoptosis T. It is known nowadays that this gene is a tumor
suppressor (19).

52

Vol.2, No.8, 2012

The loss of this receptor has been confirmed to cause an increase in the cell proliferation and reduces apoptosis, i.e. a
phenomenon that show that the M6P/IGF2R gene functions as a tumor suppressor gene (20).

The analysis of the LOH is an ideal means for the study of TSGs which always behave in compliance with the
Knudson’s hypothesis over two hits: the deletion of one allele (the first hit) and the mutation of the second allele (the
second hit) (21).

The frequent LOH within the genetically defined regions has been considered as a proof of the existence of the alleged
TSGs. The deletion of the long arm of the chromosome 6 has been recorded in a considerable number of cancers,
including the cervical cancer, breast cancer, lung cancer, melanoma, as well as hematological cancers such as the acute
lymphoblastic leukemia (22).

The frequent allelic loss of the human chromosome in the 11q23-q24 region occurs in a great number of cancers,
suggesting that this region is a shelter of the TSGs. The frequency of LOH in the LOH11CR2 region extends from 40%
to 60% in the breast cancer, lung cancer, cervical cancer and thyroid gland, suggesting that the genes that reside in
these regions can be considered as responsible candidate tumor suppressor genes, whose deactivation is needed in
order to cause the above-mentioned tumors (23).

Although the LOH in the papillary carcinoma of the thyroid gland has been examined in this paper, this phenomenon
was not detected at any given moment. From our data, we can confirm that the papillary carcinoma of the thyroid
gland for the given samples was not necessarily related to the LOH phenomenon; this might be due to the small number
of samples used in this study, which will have to be proved in the future.

However, a study on genetic irregularities in PTC and Hashimoto Thyroiditis (HT) and LOH for the hOGG1 gene
(8-oxoguanine glycosylase), in 17 out of 18 cases (94%) the LOH in PTC occurred, and 11/15 (73%) of the cases were
with LOH for HT (24).

The data show that LOH affects the majority of TSGs. However, the results from our study on the given loci did not
affirm this for the M6P/IGF2R gene in the 11q23-q24 region. This means that the papillary thyroid carcinoma in the
given samples could have been caused by other genetic irregularities.

CONCLUSION
The LOH for the M6P/IGF2R gene in the chromosome 6 and the 11q23-q24 region of the chromosome 11 in the
papillary thyroid carcinoma was not detected in any of the samples.
The LOH analysis results for the M6P/IGF2R gene and the 11q23 region of the chromosome 11 for the given samples
show that LOH is not the cause of the papillary carcinoma of the thyroid gland. Our study is consistent with the results
of other authors.
The majority of reports (25, 26) as our results have proved that LOH on the respective loci is not a common feature in
PTC.
The results conclude that the cancerogenesis of the papillary thyroid carcinoma is a multi-level process which includes
many genetic modifications. In order to fully explain the molecular genetic base of this process, we should examine
other genes that are part of the cell cycle.

ACKNOWLEDGMENTS

This study was supported by the head of the Laboratory for Epigenomics, MD, Ph.D Koraljka Gall Troselj in Zagreb,
Croatia.
REFERENCES
1. N. Al-Brahim, S.L. Asa, Papillary thyroid carcinoma: An overview, Arch. Pathol. Lab. Med. 130 (2006)
pp.1057-1062
2. Hanahan D, Weinberg RA. The hallmarks of cancer. Cell, 2000, 100: pp.57-70.

53

Vol.2, No.8, 2012

3. Hye Seung Lee et al. Tumour suppressor gene expression correlates with gastric cancer prognosis. Journal of
Pathology J Pathol 2003; 200: pp.39–46.
4. Philipp-Staheli J, Payne SR, Kemp CJ. p27Kip1; Regulation and function of a haploinsufficient tumour suppressor
and its misregulation in cancer. Exp Cell Res 2001; 264: pp.148–168.
5. C.K. Hu, S. Mccall, J. Madden, H. Huang, R. Clough, R.L. Jirtle, M.S. Anscher. Loss of heterozygosity of
M6P/IGF2R gene is an early event in the development of prostate cancer, Prostate Cancer Prostatic. Dis. 9 (2006) pp.
62-67.
6. Jamieson et al. M6P/IGF2R loss of heterozygosity in head and neck cancer associated with poor patient prognosis.
BMC Cancer 2003, 3, pp. 1-9.
7. Oka et al. M6P/IGF2R Tumor Suppressor Gene Mutated in Hepatocellular Carcinomas in Japan. Hepatology Vol.
35, No.5, 2002; 1153-1163.
8. Jang et al. Clinical significance of LOH for M6P/IGF2R in patients with primary hepatocellular carcinaoma. World
journal of gastroenterology; 2008; 14; 9; 1394-1398.
9. Pulido et al. Identification of a 6-cM Minimal Deletion at 11q23.1–23.2 and Exclusion of PPP2R1B Gene as a
Deletion Target in Cervical Cancer. Cancer Research; 2000; 60, 6677-6682.
10. Martin et al. The BCSC-1 locus at chromosome 11q23-q24 is a candidate tumor suppressor gene. PNAS; 2003; vol.
100; no. 20; 11517–115222.
11. Pulido et al. Identification of a 6-cM Minimal Deletion at 11q23.1–23.2 and Exclusion of PPP2R1B Gene as a
Deletion Target in Cervical Cancer. Cancer Research; 2000; 60, 6677-6682.
12. Ying Huang et al. Loss of Heterozygosity Involves Multiple Tumor Suppressor Genes in Human
Esophageal Cancers, Cancer research 52. (1992) 6525-6530.
13. Bojana Petrović, Milica Perović, Ivana Novaković, Jasmina Atanacković, Branka Popović, Ljiljana Luković,
Spasoje Petković, Analysis of loss of heterozygosity of the tumor suppressor genes p53 andBRCA1 in ovarial
carcinomas, Vojnisanitetski pregled 63. (2006) 813-818.
14. Grbesa et al., Loss of IGF2 and maintenance of H19 imprinting in papillary thyroid carcinoma. Elsevier Editorial
System(tm) for Cancer Letters, 2008. (Manuscript)
15. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells.
Nucleic Acids Res. 16. (1988) 1215.
16. Aliu, H. Humbja e heterozigotetit nё karcinomёn papilare tё gjёndrёs tiroide, Tezё magjistrature (2010), 49.
17. Anderson LA, Friedman L, Osborne-Lawrence S, Lynch E, Weissenbach J, Bowcock A, et al. High-density genetic
map of the BRCA1 region of chromosome 17q12-q21 (1993) Genomics.
18. S. Creste, A. Tulmann Neto and A. Figueira. Detection of Single Sequence Repeat Polymorphisms in Denaturing
PolyacrylamideSequencing Gels by Silver Staining. Plant Molecular Biology Reporter 19: 299–306, December
2001
19. Killlian et al. Manose 6-receptor phosphate/insulin–like growth factor 2 receptor (M6P/IGF2R) variants in
American and Japanese populations. Hum Mutat 2001; 18: 25-31.
20. Yamada et al. Loss of the gene encoding mannose 6-phosphate/insulin-like growth factor II receptor is an early
event in liver carcinogenesis. PNAC.USA. Vol. 94; 10351-10355.
21. Troselj GK. Doctoral thesis, 2000.
22. Cesari et al. Prakin. A gene imolicated in autosomal recessive juvenile parkinsonism, is a candidate tumor
suppressor gene on chromosome 6q25-q27. PNAS; Vol 100; no 10, 5956-5961.
23. Martin et al. The BCSC-1 locus at chromosome 11q23-q24 is a candidate tumor suppressor gene. PNAS; 2003; vol.
100; no. 20; 11517–115222.
24. Herman et al. Cytogenetic and molecular genetic studies of follicular and papillary thyroid cancers. J.C.I. 1991
25. R.Ramirez-Lorca et al., Loss of heterozygosity and genetic association analyses within 11q13.5-q14 chromosomal
region in papillary thyroid carcinoma. Endocrine Abstracts (2006) 11 P791
26. Ewa Brzeziańska et al., Loss of heterozygosity and microsatellite instability in the 3p24.2~3pter region in papillary
thyroid carcinoma. Arch Med Sci 2007; 3, 3: 192-199

54

This academic article was published by The International Institute for Science,
Technology and Education (IISTE). The IISTE is a pioneer in the Open Access
Publishing service based in the U.S. and Europe. The aim of the institute is
Accelerating Global Knowledge Sharing.

More information about the publisher can be found in the IISTE’s homepage:
http://www.iiste.org

CALL FOR PAPERS

The IISTE is currently hosting more than 30 peer-reviewed academic journals and
collaborating with academic institutions around the world. There’s no deadline for
submission. Prospective authors of IISTE journals can find the submission
instruction on the following page: http://www.iiste.org/Journals/

The IISTE editorial team promises to the review and publish all the qualified
submissions in a fast manner. All the journals articles are available online to the
readers all over the world without financial, legal, or technical barriers other than
those inseparable from gaining access to the internet itself. Printed version of the
journals is also available upon request of readers and authors.

IISTE Knowledge Sharing Partners

EBSCO, Index Copernicus, Ulrich's Periodicals Directory, JournalTOCS, PKP Open
Archives Harvester, Bielefeld Academic Search Engine, Elektronische
Zeitschriftenbibliothek EZB, Open J-Gate, OCLC WorldCat, Universe Digtial
Library , NewJour, Google Scholar

Analysis of loss of heterozygosity of the tumor

Recomendados

Recomendados

Mais conteúdo relacionado

Mais procurados

Mais procurados (20)

Semelhante a Analysis of loss of heterozygosity of the tumor

Semelhante a Analysis of loss of heterozygosity of the tumor (20)

Mais de Alexander Decker

Mais de Alexander Decker (20)

Analysis of loss of heterozygosity of the tumor