Prof. Dra. Adriana DantasUERGS – Bento Gonçalves
• Watson e Crick propuseram, em  1953, um modelo de molécula de  DNA, que seria em DUPLA  DNA  HÉLICE e em ESPIRAL, com  d...
Informações disponíveis, quais eram:1- a molécula de DNA era grande, longa, fina e composta de nucleotídeos:   adenina; gu...
Difração de Raios-X   Estrutura Molecular                      34A
O ÁcidoDesoxirribonucléico é umpolinucleotídeo formadopor duas “fitas” ou hélicesligadas entre si por pontesde hidrogênio...
Polímero longo:         Base            1     1. A ligação entre a base        Pentose   nitrogenada e a pentose é        ...
Portanto:                               :            1)    ÁCIDOS      NUCLEICOS        são            compostos por nucle...
Adenina                 Guanina                  PurinasCitosina          Timina                Uracil                Piri...
A Importância do DNA-Transportar muita informação, de célula para célula e de geraçãopara geração;-Capacidade de produzir ...
As seqüências ose-fosfato sãorepresentadas pelaslinhas, e as seqüênciasde pares de bases éaleatória
 Se replicação é semi-conservativa e a  polimerização deve ser sempre no sentido 5  ´→3´ Mas o DNA é antiparalelo ou sej...
   A dupla hélice é como um zíper que se abre,    começando por uma ponta, a deselicoidizaçao    dos dois filamentos irá ...
Replicação  do DNAO mecanismo dereplicação estábaseado nopareamento dasbases da duplahélice do DNA.A estrutura doDNA conté...
Origens de replicação   A replicação da E. coli começa a partir de uma origem    fixa, progride bi-direcionalmente   A f...
OriC -cromossomode E.coli
Nos eucariotos são abertos várias "bolhasde replicação" ou replicons
   Autoradiografias feitas por J.    Cairns (1963) em DNA de E.    coli tratadas com meio    contendo Trimidina    compro...
A replicação do cromossomo circular
Replicon: Unidade do DNA onde está ocorrendo umevento de replicaçãoReplicon:• Origem + Término• Ativados apenas uma única ...
O genoma bacteriano circular constitui um único replicon                                           Origem da replicação   ...
O genoma eucariótico constitui vários replicons   A velocidade da forquillha de replicação eucariótica é 2000pb/min   Os r...
   A síntese de DNA deve ser iniciada com um primer,    oligonucleotideos curtos, que gera um segmento de DNA    duplex;...
   A primase de E. coli forma um complexo com o    molde de DNA e proteínas adicionais, com dnaB,    dnaT, priB e priC. O...
   O novo filamento cresce em sentido oposto da    forquilha de replicação   Em E.coli a poli III faz a maior parte da s...
Polimerases de DNA:As enzimas quesintetizam DNA A síntese de DNA ocorrepela adição de nucleotídeosa extremidade 3´OH daca...
DNA polimerase•A DNA polimerase estendem a cadeia,(polimerização) mas não podem iniciar a polimerizaçãocadeia•DNA polimera...
As enzimas e suas ações   Polimerases: todas podem tanto adicionar    como remover nucleotídeos, somente no    sentido 5’...
Desoxiribonucleosídeo 5´trifosfato (precursor)Fita sendopolimerizadaFita molde
As DNA-polimerases sempre requerem um iniciadorpreviamente pareado ao molde que será copiado
Atividade revisora 3’ → 5’ garante a fidelidade da replicação
Tipo                 FunçãoDNA Polimerase I     Catalisa o crescimento da cadeia no sentido                     5´3´      ...
   Helicases são enzimas que rompem pontes de hidrogênio que    unem os dois filamentos de DNA na dupla hélice;   Entre ...
   Proteínas de iniciação identificam a origem da replicação e    participam da ligação da DNA helicase ao DNA;   A prot...
   A primase (que é uma RNA-polimerase) constrói o primer de    RNA em uma região não coberta pelas SSB;   A topo isomer...
   Os Fragmentos de Okazaki (complementam o filamento lagging);   É formado um primer de RNA pela enzima primase;   Os ...
   Duas DNA polimerases III ficam unidas e trabalham    conjuntamente, a helicase e a primase movem-se ao longo    do DNA...
A subunidadeBeta daDNA-polimeraseIII envolve oduplex dasfitas-filhas
Proteínas presentes na origem de Replicação de E.coliDnaA                 Reconhece a origem e abre a dupla fita em       ...
A síntese do DNA é semi-descontínua e requer um            iniciador (primer) de RNA                  Síntese da Fita desc...
Fragmentosde Okasakiocorrem na fitadescontínua  A DNApolimerase IIIé responsávelpela síntese damaior parte doDNA   A DNApo...
A DNA ligase sela as quebras
Proteínas presentes na forquilha de Replicação de E.coliSSB                  Liga a fita simples de DNADnaB (helicase)    ...
O complexo dereplicação  A proteína DNA B(helicase) é responsávelpelo movimento parafrente da forquilha  Cada core catalít...
Forquilha         Forquilhasentido           sentidoantihorário       horário   Terminação   Terminação
   A replicaçao do DNA de bacterias como a E. coli,    segue bidirecionalmente ao redor do    cromossomo.   Duas forquil...
DNA Polimerase em   FunçãoeucariotosDNA Polimerase α    Replicação do cromossomo                    nuclear (fita lagging)...
 Nos fragmentos de Okasaky, os primers de  RNA são removidos por uma Rnase que é  complementado por uma polimerase de  re...
voltar
TRANSCRIÇÃO : EUCARIOTO X PROCARIOTOEUCARIOTOS              PROCARIOTOS
 Fita complementar de RNA a partir de uma  DNA TRÊS tipos de RNA em procariotos:     RNA mensageiro – codifica a inform...
   RNA polimerase liga-se ao DNA em local denominado    promotor. Somente uma das duas fitas serve de molde para    sínte...
Transcrição   Gene ativo                          RNA polimerase     5’               T G CA C         3’                 ...
Tradução           Cada códon é traduzido num AA específico                                                         AA liv...
Gly   His                             Phe                       Glu                 Asp     Met     Ala   Cys5’           ...
Ile            Met               His            Ala         Gly            Cys            Asp            Glu              ...
Met                      Ala                      Cys                      Asp                      Glu          Asn      ...
Ala Cys Asp Glu Phe                 Met               Gly                                   His                           ...
Ala Cys Asp Glu Phe                    Met                Gly                                     His                     ...
Ala Cys Asp Glu Phe   Met                Gly                    His                   Ile       Gln       Lys        Pro  ...
Exemplo hipotético de uma mutação pontual Gene Normal = Proteína Normal                   5’               T G CA C       ...
A Tradução   O RNAm transcrito no núcleo    chega ao citoplasma e se liga    a um ou mais ribossomos.   O ribossomo “lê”...
Ala Cys Asp Glu Phe   Met                Gly                    His                   Ile       Gln       Lys        Pro  ...
Replicacao e transcriçao DNA procariotos
Replicacao e transcriçao DNA procariotos
Replicacao e transcriçao DNA procariotos
Replicacao e transcriçao DNA procariotos
Replicacao e transcriçao DNA procariotos
Próximos SlideShares
Carregando em…5
×

Replicacao e transcriçao DNA procariotos

46.070 visualizações

Publicada em

Publicada em: Educação
6 comentários
14 gostaram
Estatísticas
Notas
Sem downloads
Visualizações
Visualizações totais
46.070
No SlideShare
0
A partir de incorporações
0
Número de incorporações
7
Ações
Compartilhamentos
0
Downloads
583
Comentários
6
Gostaram
14
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Replicacao e transcriçao DNA procariotos

  1. 1. Prof. Dra. Adriana DantasUERGS – Bento Gonçalves
  2. 2. • Watson e Crick propuseram, em 1953, um modelo de molécula de DNA, que seria em DUPLA DNA HÉLICE e em ESPIRAL, com duas cadeias de nucleotídeos ligados por PONTES DE HIDROGÊNIO.
  3. 3. Informações disponíveis, quais eram:1- a molécula de DNA era grande, longa, fina e composta de nucleotídeos: adenina; guanina; timina e citosina;2- Os estudos de difração de raios X, realizados por Maurice King e Rosalind Franklin sugeriam a forma helicoidal;3- Linus Pauling (1950), descreveu a estrutura helicoidal com um filamento mantida por pontes de hidrogênio em proteínas e sugeriu que o mesmo pudesse ocorrer com o DNA;4- Erwin Chargaff havia demonstrado que a proporção entre os nucleotídeos A e T era de 1:1, o mesmo acontecendo entre G e C.
  4. 4. Difração de Raios-X Estrutura Molecular 34A
  5. 5. O ÁcidoDesoxirribonucléico é umpolinucleotídeo formadopor duas “fitas” ou hélicesligadas entre si por pontesde hidrogênio entre as basesnitrogenadas.O pareamento das basessempre segue a mesmaordem: Adenina com Timinae Guanina com Citosina.
  6. 6. Polímero longo: Base 1 1. A ligação entre a base Pentose nitrogenada e a pentose é feita covalentemente através de uma ligação N-glicosídica com a hidroxila ligada ao carbono-1 da pentose.4 1 22 •2. Os nucleotídeos são unidos por ligações fosfodiéster covalentes que ligar o carbono 5´de um grupo desoxirribose (pentose + base) ao carbono 3´do próximo
  7. 7. Portanto: : 1) ÁCIDOS NUCLEICOS são compostos por nucleotídeos ligados entre si através de ligação covalente. 2) NUCLEOTÍDEOS são as unidades fundamentais dos ácidos nucléicos. Cada nucleotídeo é constituído por um grupo fosfato, uma pentose e uma base. Purinas: Adenina, Guanina BASESDNA ≠ RNA Pirimidinas: Citosina, Timina, Uracila
  8. 8. Adenina Guanina PurinasCitosina Timina Uracil Pirimidinas
  9. 9. A Importância do DNA-Transportar muita informação, de célula para célula e de geraçãopara geração;-Capacidade de produzir cópias exatas de si mesmo, pois oscromossomos são copiados em cada divisão celular;-Capacidade de “replicar erros” de cópia, como se fossem o geneoriginal;-Apresenta mecanismo de decodificação da informaçãoarmazenada, traduzindo-as através da produção deenzimas/proteínas;-O DNA é chamado de “molécula da vida” pois contém o códigopra construção das proteínas em todos os seres vivos;-Nos eucariontes, o DNA é encontrado no núcleo celular formandoos cromossomos e também nas mitocôndrias e nos cloroplastos;-Nos procariontes encontra-se uma molécula de DNA circular(cromossomo bacteriano) e outras moléculas circulares chamadasplasmídeos;
  10. 10. As seqüências ose-fosfato sãorepresentadas pelaslinhas, e as seqüênciasde pares de bases éaleatória
  11. 11.  Se replicação é semi-conservativa e a polimerização deve ser sempre no sentido 5 ´→3´ Mas o DNA é antiparalelo ou seja, uma fita ocorre no sentido 5’ → 3’ e a outra no sentido 3’ → 5’ Como ocorre então a replicação nos dois sentidos?
  12. 12.  A dupla hélice é como um zíper que se abre, começando por uma ponta, a deselicoidizaçao dos dois filamentos irá expor as bases isoladas de cada filamento. Cada base exposta irá se parear apenas com sua base complementar; Um dos filamentos isolados irá agir como molde e começará a formar uma dupla hélice idêntica a que foi aberta; Os nucleotídeos será adicionados supostamente vem de reservatório livre presentes na células
  13. 13. Replicação do DNAO mecanismo dereplicação estábaseado nopareamento dasbases da duplahélice do DNA.A estrutura doDNA contém ainformaçãonecessária paraperpetuar suaseqüência debases
  14. 14. Origens de replicação A replicação da E. coli começa a partir de uma origem fixa, progride bi-direcionalmente A forquilha se move em ambas as partes, terminando num local chamado término A origem única é chamada oriC , tem 245 pb de comprimento; Seqüência em tandem com 13 pb, chamada seqüência de consenso; Seqüência de pontos de ligação com uma proteína, onde
  15. 15. OriC -cromossomode E.coli
  16. 16. Nos eucariotos são abertos várias "bolhasde replicação" ou replicons
  17. 17.  Autoradiografias feitas por J. Cairns (1963) em DNA de E. coli tratadas com meio contendo Trimidina comprovaram que a replicação é semi-conservativa, bidirecional e que o DNA e circular.
  18. 18. A replicação do cromossomo circular
  19. 19. Replicon: Unidade do DNA onde está ocorrendo umevento de replicaçãoReplicon:• Origem + Término• Ativados apenas uma única vez em cada ciclo celular• O genoma de uma célula procariótica constitui um único replicon• Cada cromossomo eucariótico constitui vários replicons e todos são ativados uma única vez no ciclo celular ainda que não simultaneamente
  20. 20. O genoma bacteriano circular constitui um único replicon Origem da replicação Forquilhas de replicação Fitas novas Fitas velhas• A velocidade da forquillha de replicação bacteriana é 50000pb/min• Um única origem de replicação em E.coli (OriC, 245 pb)
  21. 21. O genoma eucariótico constitui vários replicons A velocidade da forquillha de replicação eucariótica é 2000pb/min Os replicons eucarióticos tem 40-100 kb e são iniciados emtempos diferentes Fase S demora ~ 6hrs em uma célula somática
  22. 22.  A síntese de DNA deve ser iniciada com um primer, oligonucleotideos curtos, que gera um segmento de DNA duplex; A replicação de cromossomos de E. coli usa primers de RNA, são sintetizados ou pela RNA polimerase ou pela enzima primase; Primase sintetiza um trecho curto (aproximadamente 30 pb) de RNA complementar a uma região especifica do cromossomo; A Cadeia de RNA é então amplificada com DNA pela DNA polimerase
  23. 23.  A primase de E. coli forma um complexo com o molde de DNA e proteínas adicionais, com dnaB, dnaT, priB e priC. O complexo total é chamado de primossomo; DNA polimerase sintetizam novas cadeias no sentido 5’- 3’; Devido a polaridade inversa da molécula de DNA, movem-se no sentido 3’- 5’no filamento molde; Enquanto o filamento leading(novo) é sintetizado continuamente, o lagging é sintetizado em segmentos curtos e descontínuos
  24. 24.  O novo filamento cresce em sentido oposto da forquilha de replicação Em E.coli a poli III faz a maior parte da síntese do DNA em ambos os filamentos, a poli I completa os espaço deixados no filamento lagging, que então são fechados pela DNA ligase Fita contínua (líder) Fita descontínua
  25. 25. Polimerases de DNA:As enzimas quesintetizam DNA A síntese de DNA ocorrepela adição de nucleotídeosa extremidade 3´OH dacadeia em crescimento. O precursor da síntese éo desoxiribonucleosídeo 5´trifosfato Sentido da síntesesempre é 5’ → 3’ A replicação é umprocesso extremamente fiel. As DNA-polimerases tematividade revisora
  26. 26. DNA polimerase•A DNA polimerase estendem a cadeia,(polimerização) mas não podem iniciar a polimerizaçãocadeia•DNA polimerase - enzima que catalisa areação de replicação•Reação funciona com as formas detrifosfato dos nucleotídeos•Quantidade total de DNA ao final dareação pode ser de até 20 vezes aquantidade original de DNA.
  27. 27. As enzimas e suas ações Polimerases: todas podem tanto adicionar como remover nucleotídeos, somente no sentido 5’ → 3’; Quando removem do final do filamento são chamadas de exonucleases Se os removem em algum outro lugar do filamento, são chamadas de endonucleases . A remoção é feita no sentido inverso, ou seja 3’ → 5’.
  28. 28. Desoxiribonucleosídeo 5´trifosfato (precursor)Fita sendopolimerizadaFita molde
  29. 29. As DNA-polimerases sempre requerem um iniciadorpreviamente pareado ao molde que será copiado
  30. 30. Atividade revisora 3’ → 5’ garante a fidelidade da replicação
  31. 31. Tipo FunçãoDNA Polimerase I Catalisa o crescimento da cadeia no sentido 5´3´ Atividade de exonuclease 3´5´ e 5´3´ Preenche pedaços pequenos de DNA durante a replicação e processo de reparoDNA Polimerase II Polimerase alternativa de reparo, mas também pode replicar DNA quando o filamento molde é danificadoDNA Polimerase III Catalisa o crescimento da cadeia no sentido 5 ´3´. É a polimerase primária durante a replicação normal do DNA
  32. 32.  Helicases são enzimas que rompem pontes de hidrogênio que unem os dois filamentos de DNA na dupla hélice; Entre as helicases de E.coli estão a proteína dnaB e rep; Gera torções no DNA circular que tem que ser removidas para permitir que a replicação continue; A superelicoidizaçao pode ser criada ou relaxada por enzimas chamadas topoisomerases; As topoisomerases podem induzir ou remover alças, ou ligações em uma cadeia.
  33. 33.  Proteínas de iniciação identificam a origem da replicação e participam da ligação da DNA helicase ao DNA; A proteína de iniciação acoplada à DNA helicase abre o DNA na junção “Y”. As pontes de H se rompem e a molécula se abre como um zíper e se desespiraliza e a ela unem-se a primase e outras proteínas (DNA helicase + primase + outras proteínas = primossomo) As fitas se mantêm separadas durante a replicação graças à ação de uma proteína a Single-strand binding proteins - SSB
  34. 34.  A primase (que é uma RNA-polimerase) constrói o primer de RNA em uma região não coberta pelas SSB; A topo isomerase alivia a tensão da espiralização provocada pela abertura do DNA Ex. DNA girase; A DNA polimerase (III) sintetiza as novas cadeias. Capturam os nucleotídeos, prontos com um trifosfato, os levam ao molde, retiram dois fosfatos e os ligam ao C 3’ do nucleotídeo anterior. A polimerização ocorre muito rapidamente (100.000 nucl./min). nucl./min) Outras DNA polimerases preenchem as falhas e corrigem erros.
  35. 35.  Os Fragmentos de Okazaki (complementam o filamento lagging); É formado um primer de RNA pela enzima primase; Os primers são continuados pela DNA polimerase III até o primer do próximo fragmento de Okasaki; DNA polimerase I retira o primer de RNA e completa o pedaço com nucleotídeos corretos; Os fragmentos são ligados pelas DNA ligases.
  36. 36.  Duas DNA polimerases III ficam unidas e trabalham conjuntamente, a helicase e a primase movem-se ao longo do DNA; O filamento leading é alimentado imediatamente pela polimerase; O filamento lagging não é complementado pela polimerase até que um primer seja colocado sobre o filamento.; Isto significa: que um longo pedaço de DNA fica aberto significa durante o processo e que a replicação que ocorre primeiro no filamento leading enquanto a do filamento
  37. 37. A subunidadeBeta daDNA-polimeraseIII envolve oduplex dasfitas-filhas
  38. 38. Proteínas presentes na origem de Replicação de E.coliDnaA Reconhece a origem e abre a dupla fita em sítios específicosDnaB (helicase) Desenrola o DNADnaC Auxilia a ligação de DnaB na origemHU Proteína do tipo histona que estimula a iniciaçãoPrimase (DnaG) Sintetiza os primers de RNASingle strand binding Liga a fita simples de DNA(SSB)RNA polimerase Facilita a ação da DnaADNA girase Alivia a tensão torsional gerada pela abertura da dupla-fitaDam Metilase Metila as sequências GATC na OriC
  39. 39. A síntese do DNA é semi-descontínua e requer um iniciador (primer) de RNA Síntese da Fita descontínua Fita descontínua Fita contínua Síntese da Fita Contínua
  40. 40. Fragmentosde Okasakiocorrem na fitadescontínua A DNApolimerase IIIé responsávelpela síntese damaior parte doDNA A DNApolimerase Iremove oprimer de RNAe preenche aslacunas A DNAligase sela asquebras
  41. 41. A DNA ligase sela as quebras
  42. 42. Proteínas presentes na forquilha de Replicação de E.coliSSB Liga a fita simples de DNADnaB (helicase) Desenrola o DNAPrimase (DnaG) Sintetiza os primers de RNADNA Polimerase III Sintese da fita novaDNA Polimerase I Preenche as lacunas e excisa os primersDNA Ligase Liga os fragmentosDNA girase Superenrolamento
  43. 43. O complexo dereplicação A proteína DNA B(helicase) é responsávelpelo movimento parafrente da forquilha Cada core catalíticoda DNA PolIII sintetizauma das fitas-filhas O primossomo afastauma das fitas molde Proteínas SSBmantem as fitasparentais separadas
  44. 44. Forquilha Forquilhasentido sentidoantihorário horário Terminação Terminação
  45. 45.  A replicaçao do DNA de bacterias como a E. coli, segue bidirecionalmente ao redor do cromossomo. Duas forquilhas de replicação movem-se em direções opostas, para longe da origem de replicação Como cromossomo bacteriano é um alça fechada, as forquilhas de replicação acabam se encontrando quando a replicação esta completa Após a replicação cada célula filha recebe uma copia da molécula nova de DBA, isto é – um cromossomo completo.
  46. 46. DNA Polimerase em FunçãoeucariotosDNA Polimerase α Replicação do cromossomo nuclear (fita lagging)DNA Polimerase β Reparo de DNA no preenchimento de espaços do cromossomo nuclear. Análoga a Polimerase IDNA Polimerase γ Replicação de DNA mitocondrialDNA Polimerase δ Replicação do filamento leader a da lagging do cromossomo nuclearDNA Polimerase ε Reparo do DNA do cromossomo nuclearDNA Polimerase ζ Aparentemente reparo de DNA
  47. 47.  Nos fragmentos de Okasaky, os primers de RNA são removidos por uma Rnase que é complementado por uma polimerase de reparo. A finalização da replicação é feita com a formação de estruturas complexas no topo do cromossomo, os telômeros Os telômeros são replicados com a ajuda das telomerases.
  48. 48. voltar
  49. 49. TRANSCRIÇÃO : EUCARIOTO X PROCARIOTOEUCARIOTOS PROCARIOTOS
  50. 50.  Fita complementar de RNA a partir de uma DNA TRÊS tipos de RNA em procariotos:  RNA mensageiro – codifica a informação  RNA ribossômico – maquina para síntese protéica  RNA de transferência
  51. 51.  RNA polimerase liga-se ao DNA em local denominado promotor. Somente uma das duas fitas serve de molde para síntese de RNA para um dado gene O RNA é sintetizado na direção 5’- 3’ RNA polimerase monta nucleotídeos livres em uma cadeia nova, utilizando o pareamento complementar A medida que a cadeia nova de RNA cresce, RNA polimerase se move ao longo do DNA A síntese de RNA continua até que a RNA polimerase atinja um local no DNA denominado terminador. A RNA polimerase e o mRNA recém-formado de fita simples são liberados do DNA
  52. 52. Transcrição Gene ativo RNA polimerase 5’ T G CA C 3’ A 3’ ATGGC A AU TACCG GC A T TA 3’ C G T 5’ 5’ C AU GG DNA - Fita moldeMolécula de RNA nascente complementar a fita molde•Fita única•No lugar da Timina haverá uma Uracila
  53. 53. Tradução Cada códon é traduzido num AA específico AA livre Ribossomo His Gly Phe GluProteína Asp Met Ala Cys tRNA 5’ 3’ AUGGCAUGCGACGAAUUCGGACACAUAMolécula de mRNA codon Direção do avanço do ribossomo
  54. 54. Gly His Phe Glu Asp Met Ala Cys5’ 3’ AUGGCAUGCGACGAAUUCGGACACAUA
  55. 55. Ile Met His Ala Gly Cys Asp Glu Phe5’ 3’ AUGGCAUGCGACGAAUUCGGACACAUA
  56. 56. Met Ala Cys Asp Glu Asn Phe Gly His Ile Lys Leu Met5’ 3’ GACGAAUUCGGACACAUAAAAUUAAUG
  57. 57. Ala Cys Asp Glu Phe Met Gly His Ile Lys Leu Met Asn Pro Gln5’ STOP 3’ AUAAAAUUAAUGAACCCACAAUAATAC
  58. 58. Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn Met5’ 3’ AUAAAAUUAAUGAACCCACAAUAATAC RNAm será degradado
  59. 59. Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn MetPROTEÍNA NORMAL
  60. 60. Exemplo hipotético de uma mutação pontual Gene Normal = Proteína Normal 5’ T G CA C 3’ ATGGC A A TACCG T T A C G T 3’ 5’ 3’ 5’ AUGGCAUGCGACGAAUUCGGACACAUA mRNA AlaninaGene Mutado =Proteína Anormal - G T 5’ T G CA C 3’ A ATGGA A TACCT TA T 3’ C G T 5’ 5’ 3’ AUGGAAUGCGACGAAUUCGGACACAUA mRNA Acido Glutâmico
  61. 61. A Tradução O RNAm transcrito no núcleo chega ao citoplasma e se liga a um ou mais ribossomos. O ribossomo “lê” o primeiro códon e um RNAt com o anticódon correspondente transporta um aminoácido e se liga ao códon. O ribossomo se desloca, no sentido 5’3’ e lê o próximo códon. Os aminoácidos são unidos por ligações peptídicas. Ao final da tradução o polipeptídeo se desliga e se constituí na proteína.
  62. 62. Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn Met e p Glu Ph G ly As sPROTEÍNA NORMAL Cy His Glu I le t Lys Me Leu G ln t ro P sn Me A PROTEÍNA DEFEITUOSA

×