Marcadores moleculares em plantas

12.413 visualizações

Publicada em

Marcadores moleculares em plantas

  1. 1. Aplicação dos marcadores moleculares em plantas Profa. Adriana Cibele de Mesquita Dantas
  2. 2. Biotecnologias em plantas• Biologia Celular • Biologia Molecular •Micropropagação • Marcadores moleculares •Embriogenese somática • Análise da diversidade genética •Resgate de embriões • Mapeamento genético de ligação •Semente sintética •Seleção assistida •Fusão de protoplasto •Genômica funcional •Haplodiploidização • Transformação genética •Variação somaclonal •Proteoma
  3. 3. Genética Genética deMelhoramento populações tradicional mendeliana Marcadores genéticos Genética Organização do Transferência molecular genoma gênica Sequenciamento
  4. 4. Métodos aplicados ao melhoramento Métodos de melhoramento genético de plantas Germoplasma Seleção Indução à mutação Variação somaclonal Hibridação convencional Hibridação somática Transformação genética (Fusão de protoplastos) Seleção e avaliação agronômica Variedade comercial
  5. 5. Melhoramento tradicional• Seleção de genótipos em plantas são necessários vários ciclos de seleções e recombinações;• Características de interesse são geralmente poligênicas,• Herança complexa, difícil identificação;• Grande número de cruzamentos;• Muito esforço e planejamento;• Polimorfismo limitado para ligação gênica
  6. 6. Melhoramento TradicionalReceptividade do estigmaestádio balão EmasculaçãoEstoque de pólen -20°C Polinização manual
  7. 7. Até 1960 – Marcadores morfológicos2. Primeira versões dos mapas genéticos;3. Associação das marcas com características fenotípicas;4. Restrito a poucas plantas (tomate, ervilha, milho);5. Número reduzido de marcadores para um enorme espectro de espécies vegetais;6. Influência do ambiente e ação gênica;7. Identificados a nivel de planta inteira ou adulta.
  8. 8. DETECÇÃO DO DOGMA CENTRAL genes ambiente FENÓTIPODNA armazena RNA transfere Proteína executaa informação a informação a função
  9. 9. Ampliação dos marcadores moleculares MARCADORES Morfológicos Bioquímicos DNA RNA Marcadores moleculares
  10. 10. Marcador genético é uma característica que é capaz de detectar diferenças entre dois ou mais indivíduos ou organismos. deve ser capaz de diferenciar progenitores deve ser reproduzido com precisão na progênieDo ponto de vista molecular, um marcador genético (ou loco marcador)serve para identificar um local ou uma região de um cromossomo.Um marcador genético ideal deve apresentar uma série de atributos:alto nível de polimorfismoestabilidade em diferentes ambientesdetectar grande número de locos não ligado
  11. 11. C T G G A C TCCTGATGGATCGCGTACGTTGTACGCACAGTGTCGAAAAAGCATACGGGGACTGCACGTACACGTAGCACGGCGTCGATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
  12. 12. Marcadores moleculares• São neutros em relação a efeitos epistáticos ou pleitrópicos;• Identificação de genótipos em estádios iniciais da planta;• Acelera o processo de seleção e de recombinações desejáveis.• Todo e qualquer fenótipo molecular proveniente de um gene expresso (isoenzimas, proteínas, RNAm);• ou de um segmento específico de DNA (regiões expressas ou não do genoma).
  13. 13. Três grandes aplicações• Análise da diversidade genética entre indivíduos• Construção de mapas genéticos de ligação• Seleção assistida por marcadores moleculares (SAM)
  14. 14. Classes dos marcadores Isoenzimas bioquímicos Proteinas de sementes restrição e hibridação de RFLP, minissatélites sequências de (VNTR) dna reação polimerase em RAPD, SSR, rDNA - ITS cadeia (PCR) PCR + restrição + DNA AFLP; cDNA+AFLP recombinante PCR específicos MitDNA, cpSSR em organelas
  15. 15. Ferramentas PCR Eletroforese Termociclador
  16. 16. Eletroforese•O termo eletroforese foi criadopor Michaelis em 1909, descrevemigração de moléculas sob ainfluência de um campo elétrico;•Separação dos fragmentos damolécula de DNA, RNA eproteínas em gel•Separação em função de suascargas elétricas, de seus pesosmoleculares e de suasconformações.
  17. 17. Carregando o gel com asamostras
  18. 18. Revelando gel de agarose em U.V. – brometo de etídeo
  19. 19. Eletroforese de isoenzimas* Isoenzimas - diferentes formas moleculares (variantes) de umamesma enzima, apresentando função idêntica ou similar,presente num mesmo indivíduo (Markert & Moller, 1959). 6PGDH -CMCo-dominância Gel de Araucaria angustifolia MANTOVANI, 2003
  20. 20. Isoenzimas• Distintas formas de uma mesma enzima, as isoenzimas, codificadas por diferentes alelos, podem ser detectadas em diferentes regiões do gel, caso apresentem diferentes mobilidades eletroforéticas• Cada banda revelada no gel se constitui num marcador genético, pois entende-se por marcador genético a constituição genotípica de um loco num determinado indivíduo
  21. 21. Aplicações das isoenzimas• Kessel e Milchemore (1986) e Falcão e Contel (1991) - abordam que as variações isoenzimáticas são de grande importância nos estudos genéticos:• Indicadores dos níveis de polimorfismo• Relacionamento filogenético• Identificação de raças, espécies e populações• Valiosa ferramenta para estudos evolutivos e taxonômicos.
  22. 22. Fosfoglucomutase (PGM) monomérica alelo 1 alelo 2 alelo 3Resultado da presença de mais de um gene codificando cada uma das enzimas MANTOVANI, 2003
  23. 23. Estrutura genética de populações
  24. 24. Genética de Populações Teorema de Hardy-Weinberg Em populações infinitamente grandes,com cruzamentos ao acaso (panmítica),que não estiverem sofrendo influência dosfatores evolutivos (mutações, seleçãonatural, migrações), não haverá alteração dopool gênico, isto é, as freqüências gênicas egenotípicas se manterão constantes.
  25. 25. ORGANIZAÇÃO DA VARIABILIDADE GENÉTICA• Base para um programa pré-melhoramento• Caracterização morfológica e molecular• Caracterização de bancos de germoplasma• Coleções e seleções disponíveis em programas de melhoramento• Cultivares comerciais
  26. 26. Análise da variabilidade genética
  27. 27. Reação de polimerase em cadeia (PCR)Técnica usada para amplificar uma região específica deDNA visando produzir quantidade de DNA suficiente Amplificação do DNA
  28. 28. Extração de DNA (Doyle e Doyle, 1987) Sol. extratora Adição de CIA Adição de CIA 1.5 1.5 1.5 1.0 1.0 1.0 Centrifugação 0.5 0.5 0.5Amostra 0.1 Adição de etanol RNAse 1.5 1.0 0.5 0.1 pellet
  29. 29. Constatações• Logo após Kary Mullis ter descoberto a Polymerase Cadeia Reação (PCR) ele percebeu que primers curtos ligariam a vários locais em um genoma e assim poderiam produzir fragmentos múltiplos.• Welsh & McClelland (1990) e Williams et al. (1990) desenvolveram Random Amplified Polymorphic DNA (RAPD) - técnica que utiliza primer com 10 bases,• O uso da reação da polimerização em cadeia (PCR) proporciona a amplificação de um segmento de DNA, delimitado por dois iniciadores (primers) com 10 pares de bases, que são complementares a dois sítios, um em cada fita do DNA, posicionados inversamente a uma distância geralmente não superior a 4kb.
  30. 30.  Primer se anela a muitos locais no DNA Quando primer se anela em direção oposta – amplificação DNA Primers encontram-se na mesma direção, amplificação NÃO acontecerá
  31. 31. RAPD Dominante DNA 100 - 1,500 basesPrimers são separados em pouca distância, fragmento É AMPLIFICADO
  32. 32. RAPD (Random Amplified Polymorphic DNA) A BA B
  33. 33. Marcadores “dominantes” A1A1 A1A2 A2A2
  34. 34. Marcadores “dominantes” 01 02 03 04 05 06 07 08 09 10 Ind. L1 L2 L3 L4 L5 L6 L7 L8 01 0 1 0 1 1 0 1 1 02 1 0 0 0 1 1 0 1 03 0 0 1 1 1 0 0 1L1L2 04 0 1 1 1 0 1 0 1L3 05 1 1 0 0 1 1 0 1L4 06 0 0 1 0 1 0 0 1L5 07 0 1 1 0 1 0 0 0L6 08 0 1 0 1 0 1 0 1L7 09 1 0 1 0 0 0 0 1L8 10 0 1 0 1 1 0 0 1
  35. 35. Análise em gel de RAPDQUAIS AS POLIMÓRFICAS? QUAIS AS (CO)SEGREGANTES?
  36. 36. Onde estão localizados no genoma os marcadores? Genoma Genes e sequências DNA extragênico relacionadas DNA codificante DNA não DNA repetitivo codificanteRAPDs Introns Repetições em Repetições Fragmentos de tandem dispersasAFLPs genesoutros Transposons Satélites Sequências de inserção Microssatélites Minissatélites
  37. 37. Microsatélites• SSR – Simple Sequence Repeats – Pequenas sequências (“sequence motif”) com 1 a 4 nucleotídeos repetidos em tandem - Amplificados via PCR – Classe de marcadores moleculares mais polimórficos Sinonímias SSR (Simple Sequence Repeats); STMS (Sequence Tagged Microsatellites); SSLP (Single Sequence Length Polymorphisms); Onde são encontrados ??? Mamíferos: (CA)n ( 50.000 a 100.000 vezes no genoma) Plantas: (AT)n Mitocôndrias Cloroplastos
  38. 38. M homozigoto heterozigoto Marcador co-dominante Marcador multialélico
  39. 39. Marcadores “co-dominantes” A1 A1 A1 A2 A2 A2
  40. 40. Marcadores “co-dominantes” Ind. L1 01 1/3 02 3/4 01 02 03 04 05 06 07 08 09 10 03 2/3 04 3/3 05 1/3 06 1/11 07 1/323 08 1/4 09 3/34 10 1/2
  41. 41. Sequenciamento de regiões microssatélites
  42. 42. Mapeamento genético de ligação• Identificar marcadores genéticos ligados aos genes de interesse,nos respectivos cromossomos;•Disponibilizados para as principais espécies de importânciaagronômica;•QTLs e/ou QRLs rastreados e etiquetados, visando uma melhoria na eficiência da seleção. AFLP Gene Vf (Sarna) Xu & Korban, 2000
  43. 43. CARACTERIZAÇÃO BIOLÓGICA Fenotipagem (Locos de resistência)• Melrose x Gala – 86 plantas• M13/91 x Gala - 129 plantas• M13/91 x M46/94 -185 plantas
  44. 44. M9 x Marubakaido - 85 F1 (QTLs - loci quantitativos) A B Perfilhos uniformespulgão espinhos tipo spur Perfilhos uniformes
  45. 45. Marcas segregantesProgênie F1 (Santa Rosa x Chatard) S C M
  46. 46. 840marcadores:475 AFLPs235 RAPDs129 SSRs
  47. 47. Caracterização molecularIdentificação de marcas candidatas
  48. 48. Desenvolvimento de um SCAR (Sequence characterized amplified RAPD)• identificação de um iniciador que confere polimorfismo a dois bulks de DNA com fenótipos contrastantes,• o isolamento e a clonagem do fragmento amplificado em um vetor (plasmideo),• sequenciamento do fragmento isolado,• desenho dos iniciadores de tamanho maior que os decâmeros,• teste final em plantas.
  49. 49. Validação das Marcas – Desenvolvimentos demarcadores específicos (Clonagem por mapeamento)
  50. 50. Marcador Primer Gene Referencia RAPDS OPM18900 CACCATCCGT Vf Koller et al.,1994 OPU01400 ACGGACGTA Vf Koller et al.,1994 OPD20500 ACCCGGTCAC Vf Yang & Kruger, 1994 OPC081100 TGGACCGGTG Vf Tartarini 1996 OPC09900 CTCACCGTCC Vf Tartarini 1996 OPAL07580 CCGTCCATCC Vf Tartarini 1996 OPAM192200 CCAGGTCTTC Vf Tartarini 1996 OPA15900 TTCCGAACCC Vf Durham and Korban 1994 OPO141700 AGCATGGCTC Vf King et al. 1998 OPAF132000 CCGAGGTGAC Vf King et al. 1998 OPAG051900 CCCACTAGAC Vf King et al. 1998 OPAG12800 CTCCCAGGGT Vf King et al. 1998 SSR CH05e03 For:CGAATATTTTCACTCTGACTGGG Vbj M.Gygax (Frey et al.,2004) Rev:CAAGTTGTTGTACTGCTCCGA CH02B10 For: CAAGGAAATCATCAAAGATTCAAG Vr Hemmat et al.,2002 Rev: CAAGTGGCTTCGGATAGT CHVf1 For: ATCACCACCAGCAGCAAAG Vf C.Gessler (Frey et al.,2004) Rev: CATACAAATCAAAGCACAACCC CH02c06 For: TGACGAAATCCACTACTAATGCA Vr Baldi et al.,2004 Rev: GATTGCGCGCTTTTTAACAT CH02C02a For: CTTCAAGTTCAGCATCAAGACAA Vr2 Patocchi et al., 2003 Rev: TAGGGCACACTTGCTGGTC CH02B07 For: CCAGACAAGTCATCACAACACTC Vd Calenge et al., 2005 Rev: ATGTCGATGTCGCTCTGTTG Primers específicos Vf Vfa1 For: TCTATCTCAGTAGTTTCTATAATTCC Vf Xu & Korban (2002) Rev:GTAGTTACTCTCAAGATTAAGAACTT Vfa2 For: CTCAATCTCAGTAGTTTCTATGGA Vf Xu & Korban (2002) Rev: CCCCCGAGATTAAGAGTTG Vfa3 For:ATATTAGTAGTTTCTATAATCTGAAGG Vf Xu & Korban (2002) Rev:CCCCCGAGATTAAGAGATG Vfa4 For:TATCTCAATCTCAGTAGTAATAGTATC Vf Xu & Korban (2002) Rev:GACCTTGGAAACCACAATC AL07/SCAR 450 464 For: TCCTTACTGAGGAGGAAACCAG Tartarini et al. (1999) Rev: CAAGGGAACTGATCTTTCGTTG ARGH ARGH 25/CH02B07 For:CAAACATCATCGTAATTTTGACG Vd Baldi et al.,2004 Rev:CATACTCTTCATGAGGATAATTC ARGH37 For:TGCACGACATTAGCAACACTG Vr2 Baldi et al.,2004 Rev:GAAACAACTTCTTTTGAGAGTTC ARGH17 For:TTGCCGACGTTCGTGATGCT Vr2 Baldi et al.,2004 Rev:GATATCCTTTGTTTGGACAACC ARGH 34/CHVf1 For:TGTATGACCAGCCGAAGGTG Vf1 Baldi et al.,2004 REv:CCAGGACAACAATGTACCTCSeleção assistida por marcadores (SAM)
  51. 51. ProteínasAtributos Isoenzimas de sementes RFLPs RAPDs Microssatélites AFLPsNível de baixo alto baixo-alto baixo-alto muito alto muito altoPolimorfismoEstabilidade moderada alta alta alta alta altaambientalNúmero de locos moderado (<50) baixo (<10) alto alto alto altoExpressão genética co-dominate co-dominante co-dominante dominante co-dominante dominanteNúmero de alelos por 2-5 multialélico multialélico 2 multialélico 2locoDistribuição no regiões de cópia regiões de cópia várias ao acaso ao acaso ao acasogenoma única únicaAcessibilidade muito alta muito alta média muito alta muito baixa médiatecnológicaAplicabilidade no rápido, rápido, lento, rápido, baixo lento, custo alto rápido, customelhoramento baixo custo baixo custo custo médio custo baixoIdentificação de baixa baixa alta muito alta muito alta muito altagenótiposAvaliação de média baixa alta alta alta muito altagermoplasmaMapeamento baixa muito baixa alta alta muito alta altagenéticoMapeamento de baixa inadequado média muito alta média muito altaregiões específicasMapeamento baixa inadequado muito alta baixa alta baixacomparativoGenética de baixa baixa média alta muito alta muito altaAutógamasGenética de média baixa média alta muito alta muito altaAlógamasAnálise Filogenética média baixa muito alta média alta médiaAdaptado de Gepts (1993) e Ferreira & Grattapaglia (1995).
  52. 52. Melhoramento molecular (molecular breeding)Populações segregantes Expressão gênica - RNAm Marcador molecular Bibliotecas cDNA Polimorfismo Banco de dados Mapeamento de QRL/ QTL Seleção assistida Proteôma

×