Genética molecular 1

3.187 visualizações

Publicada em

Publicada em: Educação
2 comentários
3 gostaram
Estatísticas
Notas
Sem downloads
Visualizações
Visualizações totais
3.187
No SlideShare
0
A partir de incorporações
0
Número de incorporações
4
Ações
Compartilhamentos
0
Downloads
167
Comentários
2
Gostaram
3
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Genética molecular 1

  1. 1. Aplicação de marcadores moleculares na agriculturaProf. Adjunta Adriana DantasEngenharia de Bioprocessos e BiotecnologiaUERGS, Bento Gonçalves, RS
  2. 2. DOGMA CENTRAL genes ambiente FENÓTIPODNA armazena RNA transfere Proteína executaa informação a informação a função
  3. 3. MARCADORES ⇒ MARCAS ⇒ GENES? MARCADORESMorfológicos Bioquímicos DNA RNA Marcadores moleculares
  4. 4. Ferramentas da Biologia MolecularEnzima de restrição PCR Eletroforese Termociclador DNA ligase CA AR L S CO AR CAS COL
  5. 5. Ferramentas da Biologia MolecularEnzima de restrição PCR Eletroforese Termociclador DNA ligase CA AR L S CO AR CAS COL
  6. 6. Enzimas de restrição ENZIMA DE RESTRIÇÃOGENOMA fragmentos do genoma
  7. 7. M ic r o r g a n is m o E n z im a S e q u ê n c ia A lv o G A A T T C E s c h e r ic h ia c o li E coR I C T T A A G G G A T C C B a c illu s a m y lo liq u e fa c ie n s H Bam H I C C T A G G A G A T C T B a c illu s g lo b ig ii B g lI I T C T A G A Pu G C G C P i H a e m o p h ilu s a e g y p tiu s H a eII P iy C G C G Pu A A G C T T H a e m o p h ilu s a e g y p tiu s H in d III T T C G A A C T G C A G P ro v id e n c ia s tu a r tii P s tI G A C G T C G T C G A C S tre p to c o c c u s a lb u s G S a lI C A G C T G T C G A T h e r m u s a q u a tic u s TaqI A G C T T G G C C A B re v ib a c te r iu m a lb id iu m B a lI A C C G G T A G G C C T H a e m o p h ilu s a e g y p tiu s H a e III T C C G G A C C C G G G S e r r a tia m a rc e s c e n s Sm aI G G G C C CTabela 1. Algumas endonuclease de restrição: origem e sítios de clivagem. A seta indica o localde clivagem. Pu e Pi referem-se, respectivamente, a qualquer purina e pirimidina.
  8. 8. A clivagem do DNA –cortam o DNA em sítios específicos DNA na célula - moléculas muito grandes Endonucleases de restrição ou enzimas de restriçãoClivam o DNA somente em determinadas seqüências denucleotídeos, normalmente curtas, 4 – 8 pares de bases.Cada enzima reconhece um sítio de clivagem específico!!!
  9. 9. a ) C liv a g e m n o e ix o d e s im e t r ia b ) C liv a g e m s im é t r ic a m e n te s it u a d a a o r e d o r d o e ix o d e s im e tr ia...TC GA... ...GAA TTC......AG CT... ...CTT AAG... 3 ’ 5 ’ + 5 ’ 3 ’ 3 ’ 5 ’ + 5 ’ 3 ’M o lé c u la s c o m e x tr e m id a d e s a b r u p t a s M o lé c u la s c o m e x tr e m id a d e s c o e s iv a sFigura 1. Dois tipos de clivagem feitas por enzimas de restrição. As setas indicam os sítiosde clivagem. As linhas pontilhadas representam o centro de simetria da sequência.
  10. 10. A separação dos fragmentos damolécula de DNA em gel deeletroforeseCaracterísticas do DNASeparação por tamanho
  11. 11. Ferramentas da Biologia MolecularEnzima de restrição PCR Eletroforese Termociclador DNA ligase CA AR L S CO AR CAS COL
  12. 12. DNA ligase C A AR S L CO Liga o cDNA AR C AS em vetores CO L apropriados
  13. 13. Fragmento de DNA a ser clonadoDNA vetor Ligação catalisada pela DNA ligase DNA recombinante Transformação DNA recombinante Cromossomo bacteriano
  14. 14. T GC A A CGT Plasmídeo DNA de TGCA TGCA E.coli ACGT ACGT Enzima Enzima GCA T T ACG DNA ligase CA T T AC G TG G CA AC GT Plasmídeo híbridoConstrução de uma molécula de DNA híbrida a partir de fragmentos dediferentes organismos obtidos com o uso de enzima de restrição.
  15. 15. A E c o R I C la I H in d II I B am H I Estrutura do plasmídeo pBR322, um típico vetor S a lI P s tl de clonagem. A seta indica R e s is tê n c ia a a m p ic il in a pB R 322 a direção da replicação do R e s is tê n c ia a t e t r a c i c l in a O r ig e m d a r e p l ic a ç ã o d o p la s m í d e o DNA a partir da sua origem (A). Método da inativação insercional paraB S í t io B am H I isolar plasmídeos contendo A m p R pB R 322 TcR DNA exógeno. S í t io B a m H I A insersão do DNA B am H I exógeno no plasmídeo D N A E xógeno B am H I pBR322 causa inativação da resistência à D N A lig a s e tetraciclina, permitindo o isolamento de T cR transformantes contendo o A m pR T cR A m pR fragmento de DNA clonado (B). P la s m íd e o h ib r id o c o n te n d o D N A E xógeno pB R 322 r e c i r c u la c iz a d o T r a n s f o r m a ç ã o d e E . c o li T r a n s f o r m a n t e s r e s is t e n t e s T r a n s f o r m a n t e s r e s is t e n t e s a a m p ic il in a e t e t r a c ic lin a a a m p ic il in a m a s s e n s í v e l a t e t r a c i c lin a
  16. 16. CARTUCHO DE CLONAGEM - Polylinker Ligação com várias enzimas diferentes, vários sítios de clonagem
  17. 17. Ferramentas da Biologia MolecularEnzima de restrição PCR Eletroforese Termociclador DNA ligase CA AR L S CO AR CAS COL
  18. 18. Eletroforese (Michaelis, 1909)GéisAmido —AgaroseAcrilamidaSoluções-tampões + O sentido e a velocidade de migração é determinado pelo tamanho e carga das moléculas
  19. 19. O princípio básico envolvido na obtenção edetecção de cada classe de marcadorbioquímico ou de DNA reside no uso deeletroforese.O termo eletroforese foi criado por Michaelisem 1909, para descrever migração decolóides sob a influência de um campoelétrico.Seu princípio é simples: moléculas de carganegativa migram para o pólo positivo, emoléculas com carga positiva migram para opólo negativo. A eletroforese visa à separação demoléculas em função de suas cargaselétricas, de seus pesos moleculares ede suas conformações, em suportesporosos (géis) e soluções-tampões(estabilizam o pH do meio e permitem o fluxode corrente elétrica).
  20. 20. AGAROSE
  21. 21. Carregando o gel com asamostras
  22. 22. Revelando gel de agarose em U.V. – brometo de etídeo
  23. 23. Gel acrilamida
  24. 24. Análise DNA forenseExemplo, de caso resolvido pelo gelvertical de acrilamida corado com nitratode prataSangue retirado de chapéu e jeansS = suspeitoV- vítima
  25. 25. Tipos de marcadores genéticos isoenzimas RAPD MICROSSATÉLITES - SSR AFLP RFLP-PCR cDNA+AFLP ESTs SNPs Marcadores específicos (SCARs, OGMs, etc. )
  26. 26. Eletroforese de isoenzimas* Isoenzimas - diferentes formas moleculares (variantes) deuma mesma enzima, apresentando função idêntica ousimilar, presente num mesmo indivíduo (Markert & Moller,1959). 6PGDH -CMCo-dominância Gel de Araucaria angustifolia MANTOVANI, 2003
  27. 27. Isoenzimas Fosfoglucomutase (PGM) monomérica alelo 1 alelo 2 alelo 3Resultado da presença de mais de um gene codificando cada uma das enzimas MANTOVANI, 2003
  28. 28. Figura 1. Zimograma de PGM de couve. Início na parte inferior, ânodo no topo.1 = Ribeirão Pires 2620com bandas na região A e B: B, E, G, H; 2 = 1811 C, G; 3 = Roxa B, C, G, H; 4 = São Roque A, C, E, G,H; 5 = Gigante 915 C, D, F, G, H; 6 = 916 C, G, H; 7 = Crespa Piracicaba A, E, G, H; 8 = Ribeirão Pires2446 C, G, H; 9 = Crespa Capão Bonito C, E, G; 10 = Tupi B, G, H; 11 = Jundiaí C, F, I; 12 = Mococa C,E, I; 13 = São José C, G, H; 14 = Roxa Monte Alegre A, C, F, I; 15 = Verde-Escura A, C, E, F,
  29. 29. Figura 2. Zimograma de PRX de couve. Início na parte inferior, ânodo no topo. 1 = Ribeirão Pires 2620 combandas na região A: B1 Região B com banda monomórfica; 2 = 1811 B1; 3 = Roxa B1; 4 = São Roque A1 eB1; 5 = Gigante 915 A1; 6 = 916 B1; 7 = Crespa Piracicaba B1; 8 = Ribeirão Pires 2446 B1; 9 = Crespa CapãoBonito A1 e B1; 10 = Tupi B1; 11 = Jundiaí B1; 12 = Mococa B1; 13 = São José B1; 14 = Roxa Monte AlegreB1; 15 = Verde-Escura A1.
  30. 30. Aplicações
  31. 31. Análise da variabilidade genética
  32. 32. Reação de polimerase em cadeia (PCR) – princípio e aplicação da técnicaTécnica usada para amplificar uma região específica de DNA em visando produzir quantidade de DNA suficiente Replicação do DNA
  33. 33. PCRTemperatura 100 Desnatura 94 oC 50 0 Tempo 3’ 5’ 5’ 3’
  34. 34. PCRTemperatura 100 Desnatura 94 oC 50 0 Tempo 3’ 5’ Calor 5’ 3’
  35. 35. PCRTemperatura 100 Desnatura Desnatura 94 oC Extende 94 oC Anela Primers 72 oC 50 50 oC 0 Tempo 3’ 5’ 5’ 5’ 5’ 3’
  36. 36. PCRTemperatura 100 Desnatura Desnatura 30x 94 oC Extende 94 oC Anela Primers 72 oC 50 50 oC 0 Tempo 3’ 5’ Calor 5’ 5’ Calor 5’ 5’ 3’
  37. 37. PCRTemperatura 100 Desnatura Desnatura 30x 94 oC Extende 94 oC Anela Primers 72 oC 50 50 oC 0 Tempo 3’ 5’ 5’ 5’ 5’ 5’ 5’ 5’ 5’ 3’
  38. 38. PCR Temperatura 100 Desnatura Desnatura 30x 94 oC Extende 94 oC Anela Primers 72 oC 50 50 oC 03’ 5’ 5’ Tempo 5’ 5’5’ 3’ Calor 5’ 5’ Calor 5’
  39. 39. PCR Temperatura 100 Desnatura Desnatura 30x 94 oC Extende 94 oC Anela Primers 72 oC 50 50 oC 03’ 5’ 5’ Tempo 5’ 5’ 5’5’ 3’ 5’ 5’ 5’ 5’ 5’ 5’
  40. 40. PCR Temperatura 100 Desnatura Denatura 30x 94 oC 94 oC Anela Extenção Primers 72 oC 50 50 oC 03’ 5’ 5’ Tempo 5’ 5’5’ 3’ 5’ 5’ 5’ Fragmento de tamanho 5’ definido 5’ 5’ 5’
  41. 41. DNA dobra a cada cicloNúmero de ciclos 2 4 8 16 32 640 1 2 3 4 5 6Ciclos
  42. 42. 5´ TAGAACATAAGGCCTA GGAATGGCCATATGAT ATCTTGTATTCCGGAT CCTTACCGGTATACTA 5´5´ TAGAACATAAGGCCGG GGAATGGCCATATGAT ATCTTGTATTCCGGCC CCTTACCGGTATACTA 5´ 3´- CCTTACCGGTATACTA -5´ 5´ TAGAACATAAGGCCTA GGAATGGCCATATGAT 5´-TAGAACATAAGGCCTA-3 SIM ATCTTGTATTCCGGAT CCTTACCGGTATACTA 5´ 5´ TAGAACATAAGGCCGG GGAATGGCCATATGAT 3´- CCTTACCGGTATACTA -5´ ATCTTGTATTCCGGCC CCTTACCGGTATACTA 5´ NÃO 5´-TAGAACATAAGGCCTA-3´
  43. 43. Reação de PCR Como funciona MESMO?? Do que precisa??? O que imita????
  44. 44. Extração de DNA (Doyle e Doyle, 1987) Sol. extratora Adição de CIA Adição de CIA 1.5 1.5 1.5 1.0 1.0 1.0 Centrifugação 0.5 0.5 0.5Amostra 0.1 Adição de etanol RNAse 1.5 1.0 0.5 0.1 pellet
  45. 45. Quantificação de DNA Quantificação DNA (gel agarose 0,8%)20 50 100
  46. 46. Constatações• Logo após Kary Mullis ter descoberto a Polymerase Cadeia Reação (PCR) ele percebeu que primers curtos ligariam a vários locais em um genoma e assim poderiam produzir fragmentos múltiplos• Williams et al. (1990) desenvolveu Random Amplified Polymorphic DNA (RAPD) - uma técnica que utiliza 10 primers de base muito curto para gerar fragmentos de DNAs• Fragmentos de RAPD podem ser separados e usado como marcadores genéticos ou um tipo de impressão digital
  47. 47. RAPDs (Random Amplified Polymorphic DNA) A BA B
  48. 48. RAPD DNA Primer se liga a muitos locais no DNA Só quando primer locais que liga em direção oposta – amplificação
  49. 49. RAPD DNAPrimers encontram-se na mesma direção, amplificação NÃO acontecerá
  50. 50. RAPD DNA > 2,000 bases
  51. 51. RAPD Dominante DNA 100 - 1,500 basesPrimers são separados em pouca distância, fragmento É AMPLIFICADO
  52. 52. Marcadores “dominantes”A1A1 A1A2 A2A2
  53. 53. Marcadores “dominantes” 01 02 03 04 05 06 07 08 09 10 Ind. L1 L2 L3 L4 L5 L6 L7 L8 01 0 1 0 1 1 0 1 1 02 1 0 0 0 1 1 0 1 03 0 0 1 1 1 0 0 1L1L2 04 0 1 1 1 0 1 0 1L3 05 1 1 0 0 1 1 0 1L4 06 0 0 1 0 1 0 0 1L5 07 0 1 1 0 1 0 0 0L6 08 0 1 0 1 0 1 0 1L7 09 1 0 1 0 0 0 0 1L8 10 0 1 0 1 1 0 0 1
  54. 54. Marcadores “co-dominantes”A1 A1 A1 A2 A2 A2
  55. 55. O problema da “dominância” 01 02 03 01 02 031 12 1/1 1/2 2/2 1/? 1/? 2/2 1 1 0
  56. 56. Marcadores “co-dominantes” Ind. L1 01 1/3 02 3/4 01 02 03 04 05 06 07 08 09 10 03 2/3 04 3/3 05 1/3 06 1/11 07 1/323 08 1/4 09 3/34 10 1/2
  57. 57. OQUE É IMPORTANTE?QUAIS AS MONOMÓRFICAS? QUAIS AS SEGREGANTES?QUAIS AS POLIMÓRFICAS?
  58. 58. Marcador genético é uma característica que é capaz de detectar diferenças entre dois ou mais indivíduos ou organismos. deve ser capaz de diferenciar progenitores deve ser reproduzido com precisão na progênieDo ponto de vista molecular, um marcador genético (ou loco marcador)serve para identificar um local ou uma região de um cromossomo.Um marcador genético ideal deve apresentar uma série de atributos:alto nível de polimorfismoestabilidade em diferentes ambientesdetectar grande número de locos não ligadosherança simples
  59. 59. RAPDs(Randomly Amplified Polymorphic DNA) Amplificação de um segmento de DNA delimitado por dois iniciadores (ou primers, ou oligonucleotídeos), comumente com 10 pares de bases, que são complementares a dois sítios de nucleotídeos, um em cada fita do DNA, posicionados inversamente a uma distância geralmente não superior a 4kb.
  60. 60. Marcador molecularTodo e qualquer fenótipo molecular proveniente de umgene expresso, (isoenzimas, proteinas, RNAm)ou de um segmento específico de DNA (regiõesexpressas ou não do genoma).
  61. 61. Onde moram os marcadores??? Genoma Genes e sequências DNA extragênico relacionadas DNA codificante DNA não DNA repetitivo codificanteRAPDs Introns Repetições em Repetições Fragmentos de tandem dispersasAFLPs genesoutros Transposons Satélites Sequências de inserção Microssatélites Minissatélites
  62. 62. GGCTATCAAAGACCTGAAGAAGCCCAGTATAACCTTAGGAAAAGCTCCTGATTTGAATAAGCATACAAATCAATTNTATCTGGCATGAATGCAGCCAAACTCGACCCTGATGATGTATGCCTTATCTGGCTGCCGCGATGCAGTTCTTTGAGGGATCATGTCCTGAGGACTGGACTAGCT GGAATCCTGATAGCTCGGAAGGGAGACAAGATCACTCCGGATTCTCTTGTGGACATAAG ?ACGTACTGATGTGGAAGGGAATTGGGCTCTAACAGGGGGCATGGAGTTGACAAGGGACCTACTGTTTCAGAGCATGCATCTCTCTCTCTTCCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTGTTTCAGAGCATGC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCGACCCTACTGTTTC CTCTCTCTCGACCCTACTGTTTCATGTGCGCTAACTGGAGTACCATACCAAATTTCAGATTCCTGGCTGGGGCTATCAAAGAC GAAGAAGCCCAGTATAACCTTAGGAAAAGCTCCTGATTTGAATAAAGCATACAAATCAA NTATCTGGCATGAATGCAGCCAAACTCGACCCTGATGATGTATGCTCTTATCTGGCTGC CTGAGGACTGGCGATGCAGTTCTTTGAGGGATCATGTCCTGAGGACTGGACTAGCTATGGAATCCTGATAGCTCGGAAGGGAGACAAGATCACTCCGGATTCTCTTGTGGACATAAGACGTACTGATGTG CTGAGGACTGGAAGGGAATTGGGCTCTAACAGGGGGCATGGAGTTGACAAGGGACCCTACTGTTTCAGACATGCATCTCTGGTTGGCCTTCTCTTGAGTTTATATAGGTTGAGCAAAATCTCCGGGCAG TACCGGCAATTACAAGACAAACATCGCGGATACGAATAGAGCAGATTTTTGAGACAGCC CTTTGCAAAAATCGTAGAACATCATACTTTGATGACGACCCACAAAATGTGCGCTAACTGAGTACCATACCAAATTTCAGATTCCTGGCTGGGGCTATCAAAGACCTGAAGAAGCCCAG TAACCTTAGGAAAAGCTCCTGATTTGAATAAAGCATACAAATCAATTNTATCTGGCATGATGCAGCCAAACTCGACCCTGATGATGTATGCTCTTATCTGGCTGCCGCGATGCAGTTCT GAGGGATCATGTC CTGAACTGTAGACTAGCTATGGAATCCTGATAGCTCGGAAGGGAG CTGAGGACTGCAAGATCACTCCGGATTCTCTTGTGGACATAAGACGTACTGATGTGGAAGGGAATTGGGCCTAACAGGGGGCATGGAGTTGACAAGGGACCCTACTGTTTCAGAGCATGCATCTCTGGTTGGCCTTCTCTTGAGTTTATATAGGTTGAGCAAAATCTCCGGGCAGAATACCGGCAATTAC GACAAACATCGCGGATACGAATAGAGCAGATTTTTGAGACAGCCCCCTTTGCAAAAATC AGAACATCATACTTTGATGACGACCCACAAAATGTGCGCTAACTGGAGTACCATACCAA A
  63. 63. Microssatélites
  64. 64. Consistem de pequenas seqüências (“sequencemotif”) com 1 a 4 nucleotídeos de comprimento, repetidas em tandem. Mononucleotídeos TGCATTGAAAAAAAAAAAAAAACTGGATC Dinucleotídeos TGCATTGTATATATATATATATACTGGATC Trinucleotídeos TGCATTGTGATGATGATGATGACTGGATC Tetranucleotídeos TGCATTGTGACTGACTGACTGACCTGGATC
  65. 65. CaracterísticasM homozigoto heterozigoto Marcador co-dominante Marcador multialélico
  66. 66. Detecção de locos SSR CACACA CACACACACAC ACACA (CA)3 (CA)3 (CA)5 GTGTGT GTGTGTGTGTG TGTGT CACACACACAC ACACA CACACACACA (CA)5 (CA)5 (CA)3 GTGTGTGTGT GTGTGTGTGTG TGTGT Amostra 1 Amostra 2 Amostra 3
  67. 67. Na recombinação dos alelos 3´ CACACACACA 5´ iniciador reverse Taq GTGT 5´ GTGTGTGTGT 3´ iniciador forward 3´ CACACACACA 5´P1 5´ GTGTGTGTGT 3´ 3´ CACACACACA 5´ P1 F1 P2 5´ GTGTGTGTGT 3´F1 3´ CACACA 5´ 5´ GTGTGT 3´ 3´ CACACA 5´P2 5´ GTGTGT 3´
  68. 68. Microsatélites MICROSSATÉLITES• SSR – Simple Sequence Repeats – Pequenas sequências (“sequence motif”) com 1 a 4 nucleotídeos repetidos em tandem - Amplificados via PCR – Classe de marcadores moleculares mais polimórficos Sinonimias SSR (Simple Sequence Repeats); STMS (Sequence Tagged Microsatellites); SSLP (Single Sequence Length Polymorphisms); Onde são encontrados ??? Mamíferos: (CA)n ( 50.000 a 100.000 vezes no genoma) Plantas: (AT)n Mitocôndrias
  69. 69. Aplicações dos MicrossatélitesGenetic Characterization of ActiveBank of Germoplasm of PineappleGuava (Acca Sellowiana) by transferof markers Microsatellites ofEucalyptus sppKarine Louise dos Santos1, Leocir JoséWelter1, Adriana Cibele de MesquitaDantas1, Jean Pierre Ducroquet2 ,Rubens Onofre Nodari1Laboratório de Fisiologia do Desenvolvimento1e Genética Vegetal, CCA/UFSC, Florianópolis,SC, Brasil2 Estação Experimental de São Joaquim,Epagri, São Joaquim, SC, Brasil
  70. 70. Como os microsatélites são formados ?Modelos para explicar os processos mutacionaisenvolvidos na formação das repetições•Escorregões da DNA polimerase•Crossing over desigual
  71. 71. Replicação Fita nascente Fita molde Slippage Misalignment+1 repeat -1 repeat
  72. 72. Se você escolheu os microssatélites como marcador molecular para o seu estudo a primeira coisa a fazer é verificar se já existem microsatélites para a sua espécie no GenBank.Se não, existem você terá que desenvolve-los !
  73. 73. SEQUENCIAMENTO animação
  74. 74. Microsatélites em sequências
  75. 75. PCR-RFLP gene DNA cromossômico Restrição com endonuclease (1 ou mais)Separação por eletroforese animação
  76. 76. Alelo S-Rnases – marcador específico
  77. 77. Auto-incompatibilidade Gametofítica Superfície estigmática Estilete CELSO L.DE ALBUQUERQUE JUNIOR (2004)
  78. 78. Compatibilidade Gametofítica CELSO L.DE ALBUQUERQUE JUNIOR (2004)
  79. 79. Análise das marcas específicas
  80. 80. AFLP (Amplified Fragment Length Polymorphism) Zabeau (1993), Vos et al. (1995)O ensaio combina a especificidade, resolução e poder deamostragem da digestão de enzimas de restrição com avelocidade e praticidade de detecção do polimorfismo via PCRCo-amplificação específica de um grande número de fragmentosde restriçãoTipicamente 40-100 fragmentos são amplificados e detectadosem gel de poliacrilamidaEsta característica também é chamada de “índice de multiplex doensaio AFLP ”
  81. 81. 5´------GAATTC --------TTAA-----3´ 3´------CTTAAG---------AATT-----5´ EcoR I Mse I 5´------GAATTC --------TTAA-----3´Digestão do DNA 3´------CTTAAG---------AATT-----5´ AATTC --------TLigação de adaptadores G---------AAT EcoR I adaptador TA Mse I adaptador TTAA AATTC --------TTA TTAAG---------AATPré-amplificação EcoR I primer E-A E- AATTCA --------GTTA TTAAGT---------CAAT Mse I primer M - CAmplificação EcoR I primer E- ACA AATTCAACA -----------GTGGTTA TTAAGTTGT------------CACCAAT Mse I primer M - CAC
  82. 82. AFLPVantagem é indiscutivel-Grande número de fragmentos-Número de marcadores simultâneos analisados-Facilidade e rapidez com que é realizado,-Alta resolução e repetitivoDesvantagem-Discriminar o heterozigoto dos homozigotos.
  83. 83. Marcas segregantesProgênie F1 (Santa Rosa x Chatard) S C M
  84. 84. Excelente = Saturar mapas genéticos 840 marcadores: 475 AFLPs 235 RAPDs 129 SSRs
  85. 85. SCARs (Sequence characterized amplified RAPD)Desenvolvimento de um SCAR2) identificação de um iniciador que confere polimorfismo a dois bulks de DNA com fenótipos contrastantes,3) o isolamento e a clonagem do fragmento amplificado em um vetor (plasmideo),4) sequenciamento do fragmento isolado,5) desenho dos iniciadores de tamanho maior que os decâmeros6) teste final (Paran e Michelmore, 1993).
  86. 86. Seleção de indivíduos F1 expressando Seleção de indivíduos F1 expressandoo carater de resistência o carater de suscetibilidade Extração de DNA Extração de DNA Mistura equitativa de DNA Mistura equitativa de DNA Bulk resistentes Bulk suscetíveis Padrão de banda dos Bulks 1 2 3 4 5 P1 P2 1 (Resistente) (Suscetível) 2 3 4 Análise de RAPD dos 5 indivíduos e confirmação DNA de indivíduos da DNA de indivíduos da entre o marcador população que são resistentes população que são suscetíveis (todos possuem a banda 3) (nenhum possui a banda) detectado nos bulks e a expressão do carater
  87. 87. ProteínasAtributos Isoenzimas de sementes RFLPs RAPDs Microssatélites AFLPsNível de baixo alto baixo-alto baixo-alto muito alto muito altoPolimorfismoEstabilidade moderada alta alta alta alta altaambientalNúmero de locos moderado (<50) baixo (<10) alto alto alto altoExpressão genética co-dominate co-dominante co-dominante dominante co-dominante dominanteNúmero de alelos por 2-5 multialélico multialélico 2 multialélico 2locoDistribuição no regiões de cópia regiões de cópia várias ao acaso ao acaso ao acasogenoma única únicaAcessibilidade muito alta muito alta média muito alta muito baixa médiatecnológicaAplicabilidade no rápido, rápido, lento, rápido, baixo lento, custo alto rápido, customelhoramento baixo custo baixo custo custo médio custo baixoIdentificação de baixa baixa alta muito alta muito alta muito altagenótiposAvaliação de média baixa alta alta alta muito altagermoplasmaMapeamento baixa muito baixa alta alta muito alta altagenéticoMapeamento de baixa inadequado média muito alta média muito altaregiões específicasMapeamento baixa inadequado muito alta baixa alta baixacomparativoGenética de baixa baixa média alta muito alta muito altaAutógamasGenética de média baixa média alta muito alta muito altaAlógamasAnálise Filogenética média baixa muito alta média alta médiaAdaptado de Gepts (1993) e Ferreira & Grattapaglia (1995).
  88. 88. Abordagem Limitações EstratégiasDiversidade genética Financeira Alozimas Filogenia RAPD Amostragem AFLP Fluxo gênico Biblioteca genômica SSRAnálise de paternidadeMapeamento genético
  89. 89. RGAs (Resistance gene homologues)N-terminal C-terminal RNBS-A RNBS-A Kinase-2 RNBS-D RNBS-D P-loop GLPL Não TIR TIR W/D Não TIR TIR Motivos exclusivos TIR Motivos exclusivos não TIR Motivos TIR e não TIR Primers Sense Motivos Sequencia 5’- 3” 39F1 P-loop (n-terminal): TCATCAAGGACGAGCTGARWBNATGMA P1a P-Loop GGIATGCCIGGIIIIGGIAARACIAC P3a GLPL AIITYIRIIR YIAGIGGYAA ICC LM638 P-loop GGI GGI GTI GGI AAI ACI AC 1F P-loop-GKTT GGCGGGGTGGGCAARACNACNHT P1c P-loop-GKTT non TIR Arabidopsis GGICGICCIGGIIIIGGIAARACIAC 3F2 kinase GAGGTACTTCCTGGTGCTGGAYGAYRTBTG 2F nbs-2 AACGGCTGCAGGATCATGRTBACHACHMG OLE 1121 P-loop GGWATGGEGGWRTHGGWAARACHAC Primers antisense Motivos Sequencia 5’- 3” P1b P-loop GGIATGGGIGGIIIIGGIAARACIAC P3d GLPL AIITYIRIIR YYAAIGGIAG ICC RNBS-D GGR AAI ARI SHR CAR TAI VIR AAR C 1R1 P-loop CGTGCTGGGCCAGGGTNGTYTTNCC P3b GLPL – non TIR Arabidopsis AIITYIRIIRYIAGIGGIAGICC 13R1 GLPL – C-terminal CGGCCAAGTCGTGCAYVAKRTCRTGCA 11R1 GLPl – C-terminal TCAGCTTGCCGATCCACTYDGGSAGBYT OLE 122 GLPLAL ARNWYYTTVARDGCVARWGGVARWCC
  90. 90. RGAs polimórficosM 39F1/1R1 2F/13R1 F G Br Bs A F G Br Bs A
  91. 91. Sequenciamento e alinhamento dos motifs
  92. 92. Aplicações
  93. 93. Genes diferencialmente expressos Genes exclusivos de uma forma Biblioteca de fruto resistente Biblioteca de frruto suscetível Genes comunsDeterminando o perfil de expressão gênica eidentificando genes diferencialmente expressos
  94. 94. Por que?• Determinação da função de um gene• Caracterização de um estádio dedesenvolvimento ou fisiológico• Caracterização de elementos regulatórios
  95. 95. Técnicas disponíveis• Seleção diferencial e hibridização subtrativa (Sambrook et al., 1989)• cDNA-AFLP (Bachem et al.,1996)• Differential Display Reverse Transcription PCR - (DDRT-PCR) (Liang and Pardee., 1992)• RFLP-coupled differential display (RC4D) (Fischer et al., 1995)• Serial Analysis of Gene Expression (SAGE) (Velculescu et al., 1995)• Macroarrays (Chen et al., 1998)• Microarrays (Schena et al., 1995)
  96. 96. ESTs (Expression Sequences Tags) cDNA AAAAAAAAA TTTTTTTTT RTExtração RNAm + Oligo (dT) PCR Clonagem Seqüenciamento
  97. 97. Construção de bibliotecas Subtrativas cDNA “tester“com adaptador 1 R cDNA “Driver” cDNA“tester“com adaptador 2 R (em excesso) Tester Driver RNA tecido A RNA tecido B 1ª Hibridização a cDNA b cRNA mensageiro d Digestão com Dpn II 2ª Hibridização mistura de amostras, : adição de “Driver” desnaturado anelamento e cDNA a, b, c, d + e Ligação ao oligo A Ligação ao oligo B Preenchimento dos terminaisDigestão comRsaI a b Hibridização com excesso de Driver Ligação dos c adaptadores d PCR com a utilização de iniciadores complementares ao oligo A e Adição de “primers” Subtração Amplificação por PCR Amplificação seletiva dos cDNAs derivados do Tester a e d - nenhuma amplificação b- b’ - nenhuma amplificação c - amplificação linear Clonagem em vetores e montagem da biblioteca 5’ 3’ e e - amplificação exponencial 3’ 5’
  98. 98. acmdantas@cca.ufsc.br 2 Núcleo de Biologia Aplicada, Embrapa Milho e Sorgo – Sete Lagoas – MG 1 Recursos genéticos Vegetais, CCA, Universidade Federal de Santa Catarina – Florianópolis – SC. DANTAS, ACM1; STOLF, EC1; GUIMARÃES, CT2; CARNEIRO, N2; PURCINO, AA2 radicular de porta-enxerto de macieira Identificação dos genes induzidos pelo alumínio em ápice Clone Sequenciamento Sequences producing significant e value alignments: C5 A10 hypothetical protein [Erwinia amylovora]. 3e-13 C5 A10 putative reverse transcriptase [Cicer 3e-13 arietinum] F6 B10 formate dehydrogenase beta-subunit 1e-10 [Methanococcus voltae].. C8 C10 Catalase 8e-11 C9 D10 class III chitinase [Sphenostylis stenocarpa]. 7e-06 D8 E10 Catalase 3e-11 G8 F10 Structural Analysis Of The Spiroplasma Virus 3e-40 E10 H10 IntI [Citrobacter freundii] 2e-13 (a) (b)Estacas enraizadas dos porta-enxertos: (a) Marubakaido (tolerante) e (b) M9 (sensível) em Al3+
  99. 99. cDNA-AFLP
  100. 100. cDNA-AFLPVantagens:• Alta reprodutibilidade;• Poucos falso positivos;• Necessita de pequenas quantidades iniciais de RNA.Desvantagens:• O cDNA precisa conter o sítio de restrição da enzima utilizada.
  101. 101. DDRT-PCR(Differential Display Reverse Transcription PCR)
  102. 102. SNPs I.G. Gut, Automation in genotyping single nucleotide polymorphisms. Hum. Mutat. 17 (2001) 475–492. (Single nucleotide polymorphisms) Polimorfismo de um único nucleotídeo 5’ leader Coding sequence 3’ end Poly-A (exons) Seqüênciamento 3’Seqüênciamento 5’
  103. 103. SNPs - Princípio detectar a variação de seqüência na janela de um alinhamento de ESTs de um mesmo gene, parcialmente sobrepostasVariações mais frequentes no genoma: 1 substituição a cada 31pb não codificadora e a cada 124 pb em regiões codificadoras
  104. 104. Detecção e validação de SNPs
  105. 105. Princípio da genotipagem SNP site1. PCR amplificação TTACGCATAACCTATCGAATTCCATCGCATCGA C2. Restrição do produto PCR com a enzima adequada (ex: EcoRI, GAATTC) Se ‘A’ está presente ocorre Se ‘C’ está presente, não ocorre a restrição a restriçãoTAACCTATCGAATTCCATCG TAACCTATCGACTTCCATCG N R - N R - + +
  106. 106. Análise Molecular de OGMs
  107. 107. Identificação MolecularAnálise de DNA - PCR - Southern Blot - Real Time PCR - ArranjosAnálise de Proteína Baseadas em imunologia - ELISA - Western blot - Proteoma
  108. 108. Southern Blot Papel para Absorção Membrana de Nylon Gel Esponja Solução de1. Digestão do DNA com transferênciaenzimas de restrição 2. Eletroforese DNA em Gel 3. Transferência do DNA para a de Agarose membrana de nylon (Blotting) Retirada da membrana com o DNA Retirada das hibridizações não específicas Hibridização da membrana com sonda radioativa 4. Hibridização da membrana 5. Revelação do autoradiograma com a sonda específica
  109. 109. Análise Molecular Southern blotPCR Digestão com EcoRI e hibridação com sonda específica para sarcotoxin IA
  110. 110. Western blot Análise do fenótipoSintoma aos 25 dias após inoculação (104 CFU/ml) Controle stx-5
  111. 111. Análise da Expressão de Genes Real Time PCRResultados após amplificação
  112. 112. Arranjos de DNA Aumento do número de genes chips de DNA diferentes seqüências paradetectar genes expressos ou introduzidos em plantas
  113. 113. Impressão do chip DNA Amplificaç ão de PCR Mantagem em placas Diretamente do estoque 384-well Usando iniciadores SP6-T7 Biblioteca em placas 96-well Estoque de bacté riaem glicerol (96 ou 384-well ) Gotas em matrizes Sobre lâminas de vidro
  114. 114. ProteomaLevantamento quantitativo de proteínas/peptídeos em umaamostra para identificar mudanças de interesse Proteoma Genoma Proteínas e peptídeos DNA Dinâmico Estático Células e tecido específicos Orgão específico
  115. 115. Separação e preparo de amostra Digestão - tripsina Peptídeo Separação

×