Genômica e proteômica

6.747 visualizações

Publicada em

Publicada em: Educação
0 comentários
4 gostaram
Estatísticas
Notas
  • Seja o primeiro a comentar

Sem downloads
Visualizações
Visualizações totais
6.747
No SlideShare
0
A partir de incorporações
0
Número de incorporações
4
Ações
Compartilhamentos
0
Downloads
254
Comentários
0
Gostaram
4
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Genômica e proteômica

  1. 1. SEQUENCIAMENTO DE DNA (cDNA) Prof. Adriana Dantas UERGS
  2. 2. • Objetivos  Determinar a estrutura de uma molécula de DNA, identificando A SEQÜÊNCIA DE nucleotídeos componentes.  É o primeiro passo para a interpretação das informações genéticas codificadas no DNA, as quais determinam as características estruturais e funcionais de cada ser vivo
  3. 3. Projetos Genomas Estrutural – Sequenciamento Completo do Genoma – Região Gênica e Região Intergênica Funcional – ESTs – Expressed Sequence Tag – Regiões que codificam proteinas – Funçoes celulares, metabólicas, fisiológicas.
  4. 4. Evolução dos organismos vivos, dogmas central e periféricosA Engenharia Genética atuaem nível molecular, onde as diferenças entre espécies “desaparecem”.
  5. 5. TranscriptaseReplicação Transcrição Tradução DNA RNAm Proteínas (n aa) citoplasma núcleo
  6. 6. Etapas genômicasObtenção do DNA genômicoConstrução de primersAmplificação do gene de interesse a ser clonadoPreparação do vetorLigação do vetor ao “inserto”Transformação da bactériaSeleção dos clones recombinantesPropagação da colônia recombinante em meio líquidoExtração e purificação de plasmídio recombinanteDigestão e seqüenciamentoBioinformáticaIdentificaçao de sequenciasInserção de DNA exógeno: - Eletroporação; Agrobact.; Biobalistica, etc.
  7. 7. gDNA x cDNADiferenças moleculares; Tecidos; Estratégias;Onde obter e como obter?
  8. 8. Walter Gilbert (1932 - ) Graduado em química e física em Harvard 1960 - biologia molecular mRNA síntese proteíca regulação gênica técnicas de DNA recombinantePrêmio Nobel de medicina e fisiologia em 1980 PNAS, vol. 74 No. 2 p. 560-564, 1977
  9. 9. Frederick Sanger ( 1918 -) Graduado em Ciências em Cambridge Estudou proteínas – insulina 1943 – técnicas de sequenciamentoPrêmio Nobel de medicina e fisiologia em 1980 J. Mol. Biol. v.94, p. 441-448, 1975
  10. 10. DNACTC ATT GTG CTT GAA TTT TTG GTG mRNAGAG UAA CAC GAA CUU AAA AAC CAC Proteínaaa aa aa aa aa aa aa aa
  11. 11. Seqüenciamento de DNA - Gilbert
  12. 12. Não forman ligaçãofosfodiéster com o próximodNTPs que chega na cadeia -OH nos dNTPS
  13. 13. ddATP32 ddCTP32 Repetidos ciclos de: DNA polimerase DNA polimerase DNA DNA desnaturação, A, C, G e T A, C, G e T anelamento extensãoddTTP32 ddGTP32 DNA polimerase DNA polimerase DNA DNA A, C, G e T A, C, G e T A C T G Interpretação AACGGTTCCAC
  14. 14. Histórico Gilbert e Sanger – 70’s: 20 bases em dois anos • Seqüenciamento manual – Géis de poliacrilamida – Radioisótopos Seqüenciamento automático Capilar 500 bases / segundo
  15. 15. Uso da bioinformática na análise genômica
  16. 16. Seqüenciamento de DNA primer polimerase template dNTPs labelled ddNTPs
  17. 17. ATCTCGTAGCTATCTCGTAGCTA AATCTCGTAGCTATCTCGTAGCTAG GATCTCGTAGCTATCTCGTAGCTAGC CATCTCGTAGCTATCTCGTAGCTAGCT TATCTCGTAGCTATCTCGTAGCTAGCTA AATCTCGTAGCTATCTCGTAGCTAGCTAC CATCTCGTAGCTATCTCGTAGCTAGCTACG GATCTCGTAGCTATCTCGTAGCTAGCTACGA AATCTCGTAGCTATCTCGTAGCTAGCTACGAC CATCTCGTAGCTATCTCGTAGCTAGCTACGACG GATCTCGTAGCTATCTCGTAGCTAGCTACGACGT TATCTCGTAGCTATCTCGTAGCTAGCTACGACGTC CATCTCGTAGCTATCTCGTAGCTAGCTACGACGTCT TATCTCGTAGCTATCTCGTAGCTAGCTACGACGTCTA ATAGAGCATCGATCGATGCTGCAGATGATGCTAGCATCGGCTAGGCGACG
  18. 18. Seqüenciamento de DNA
  19. 19. Seqüenciamento de DNA
  20. 20. Início Bioinformática Receber Processar Anotar Depositar Fim
  21. 21. PROJETOS GENOMA COMPARAÇÃO COM BANCOS DE DADOS VERIFICAÇÃO DE HOMOLOGIA COM GENES PREVIAMENTE SEQUENCIADOS
  22. 22. Crescimento do GenBank Seqüências 16.000.000 15 milhões 14.000.000 24h 12.000.000 10.000.000 Europeu Japonês 8.000.000 6.000.000 4.000.000 2.000.000606 0 83 84 86 96 82 85 87 88 89 90 91 92 93 94 95 97 98 99 00 011919191919191919191919191919191919192020 Ano
  23. 23. Seqüenciamentoparcial de transcritos
  24. 24. Genes diferencialmente expressos Genes exclusivos de uma forma Biblioteca de fruto resistente Biblioteca de frruto suscetível Genes comunsDeterminando o perfil de expressão gênica eidentificando genes diferencialmente expressos
  25. 25. Por que?• Determinação da função de um gene• Caracterização de um estádio dedesenvolvimento ou fisiológico• Caracterização de elementos regulatórios
  26. 26. Técnicas disponíveis• Seleção diferencial e hibridização subtrativa (Sambrook et al., 1989)• cDNA-AFLP (Bachem et al.,1996)• Differential Display Reverse Transcription PCR - (DDRT-PCR) (Liang and Pardee., 1992)• RFLP-coupled differential display (RC4D) (Fischer et al., 1995)• Serial Analysis of Gene Expression (SAGE) (Velculescu et al., 1995)• Macroarrays (Chen et al., 1998)• Microarrays (Schena et al., 1995)
  27. 27. ESTs (Expression Sequences Tags) cDNA AAAAAAAAA TTTTTTTTT RTExtração RNAm + Oligo (dT) PCR Clonagem Seqüenciamento
  28. 28. Construção de bibliotecas Subtrativas cDNA “tester“com adaptador 1 R cDNA “Driver” cDNA“tester“com adaptador 2 R (em excesso) Tester Driver RNA tecido A RNA tecido B 1ª Hibridização a cDNA b cRNA mensageiro d Digestão com Dpn II 2ª Hibridização mistura de amostras, : adição de “Driver” desnaturado anelamento e cDNA a, b, c, d + e Ligação ao oligo A Ligação ao oligo B Preenchimento dos terminaisDigestão comRsaI a b Hibridização com excesso de Driver Ligação dos c adaptadores d PCR com a utilização de iniciadores complementares ao oligo A e Adição de “primers” Subtração Amplificação por PCR Amplificação seletiva dos cDNAs derivados do Tester a e d - nenhuma amplificação b- b’ - nenhuma amplificação c - amplificação linear Clonagem em vetores e montagem da biblioteca 5’ 3’ e e - amplificação exponencial 3’ 5’
  29. 29. cDNA-AFLP
  30. 30. cDNA-AFLPVantagens:• Alta reprodutibilidade;• Poucos falso positivos;• Necessita de pequenas quantidades iniciais de RNA.Desvantagens:• O cDNA precisa conter o sítio de restrição da enzima utilizada.
  31. 31. DDRT-PCR(Differential Display Reverse Transcription PCR)
  32. 32. SNPs I.G. Gut, Automation in genotyping single nucleotide polymorphisms. Hum. Mutat. 17 (2001) 475–492. (Single nucleotide polymorphisms) Polimorfismo de um único nucleotídeo 5’ leader Coding sequence 3’ end Poly-A (exons) Seqüênciamento 3’Seqüênciamento 5’
  33. 33. SNPs - Princípio detectar a variação de seqüência na janela de um alinhamento de ESTs de um mesmo gene, parcialmente sobrepostasVariações mais frequentes no genoma: 1 substituição a cada 31pb não codificadora e a cada 124 pb em regiões codificadoras
  34. 34. Detecção e validação de SNPs
  35. 35. Um mRNA & suas ESTs ATG AUG cDNA (fita +) ATCATGACTTACGGGCGCGCGAT AAATTTATTATCC (A)18 200 5’EST cDNA (fita -) 3’EST 3’EST (T)18 AUG cDNA (fita +) GGCGCGCGATATCC AAATTTATTATCCATCTACG (A)18 200 5’EST (fita -) cDNA 3’EST 3’EST (T)18
  36. 36. PCR inespecífico & seu ORESTES +ORESTES (outros iniciadores) AUG ampliconGGGCGCGCGATATCGAAAAATTTATAAGGCTAG (fita +)CCCCGGCGGCTCGGCCGGGGAGATCGATCATGAC AGATCGATCATGACTTACGGGCGCGCGATATCG (A)200 ORESTE amplicon (fita -) cDNA (fita -) S Iniciador PCR (60ºC(60ºC) 37ºC)
  37. 37. montagemAGATATGAGAGACACAGAAATTTCCG GACACAGAAATTTCCGATA ATTTCCGATACAAACCTGGTAAGACAGC AAATTTCCGATACAAACCTGGTAAGACAGCTAAGGTTAG GACAGCTAAGGTTAGGACGACTTTAGGACCGATACCC TTAGGACGACTTTAGGACCGATACCCCAAATACC TACCCCAAATACCCTAAGATTA
  38. 38. GACACAGAAATTTCCGATAAGATATGAGAGACACAGAAATTTCCG ATTTCCGATACAAACCTGGTAAGACAGC AAATTTCCGATACAAACCTGGTAAGACAGCTAAGGTTAG GACAGCTAAGGTTAGGACGACTTTAGGACCGATACCC TTAGGACGACTTTAGGACCGATACCCCAAATACC TACCCCAAATACCCTAAGATTAAGATATGAGAGACACAGAAATTTCCGATACAAACCTGGTAAGACAGCTAAGGTTAGGACGACTTTAGGACCGATACCCCAAATACCCTAAGATTA
  39. 39. GACACAGAAATTTCCGATAAGATATGAGAGACACAGAAATTTCCG ATTTCCGATACAAACCTGGTAAGACAGC AAATTTCCGATACAAACCTGGTAAGACAGCTAAGGTTAG GACAGCTAAGGTTAGGACGACTTTAGGACCGATACCC TTAGGACGACTTTAGGACCGATACCCCAAATACC TACCCCAAATACCCTAAGATTA ContigAGATATGAGAGACACAGAAATTTCCGATACAAACCTGGTAAGACAGCTAAGGTTAGGACGACTTTAGGACCGATACCCCAAATACCCTAAGATTA
  40. 40. Análise de transcriptoma Expressed Sequence Tags Micro arranjos Serial Analysis of Gene Expression
  41. 41. Expression Sequences Tags AAAAAAAAA TTTTTTTTT RT PCR Clonagem Seqüenciamento
  42. 42. Redundância entre os transcritos
  43. 43. 250200150100
  44. 44. Genes diferencialmente expressos Genes exclusivos de uma formaBiblioteca de micélio Biblioteca de levedura Genes comuns
  45. 45. Genes específicos
  46. 46. Princípio da genotipagem SNP site1. PCR amplificação TTACGCATAACCTATCGAATTCCATCGCATCGA C2. Restrição do produto PCR com a enzima adequada (ex: EcoRI, GAATTC) Se ‘A’ está presente ocorre Se ‘C’ está presente, não ocorre a restrição a restriçãoTAACCTATCGAATTCCATCG TAACCTATCGACTTCCATCG N R - N R - + +
  47. 47. Análise Molecular
  48. 48. Identificação MolecularAnálise de DNA - PCR - Southern Blot - Real Time PCR - ArranjosAnálise de Proteína Baseadas em imunologia - ELISA - Western blot - Proteoma
  49. 49. Southern Blot Papel para Absorção Membrana de Nylon Gel Esponja Solução de1. Digestão do DNA com transferênciaenzimas de restrição 2. Eletroforese DNA em Gel 3. Transferência do DNA para a de Agarose membrana de nylon (Blotting) Retirada da membrana com o DNA Retirada das hibridizações não específicas Hibridização da membrana com sonda radioativa 4. Hibridização da membrana 5. Revelação do autoradiograma com a sonda específica
  50. 50. Análise Molecular Southern blotPCR Digestão com EcoRI e hibridação com sonda específica para sarcotoxin IA
  51. 51. Western blot Análise do fenótipoSintoma aos 25 dias após inoculação (104 CFU/ml) Controle stx-5
  52. 52. Análise da Expressão de Genes Real Time PCRResultados após amplificação
  53. 53. Arranjos de DNA Aumento do número de genes chips de DNA diferentes seqüências paradetectar genes expressos ou introduzidos em plantas
  54. 54. Impressão do chip DNA Amplificaç ão de PCR Mantagem em placas Diretamente do estoque 384-well Usando iniciadores SP6-T7 Biblioteca em placas 96-well Estoque de bacté riaem glicerol (96 ou 384-well ) Gotas em matrizes Sobre lâminas de vidro
  55. 55. Seqüênciamento de genes expressos: Documentar a existência de transcritos gênicos num transcriptoma EST(Etiqueta de Seqüência Expressa) – seqüenciamento único de cada cDNA – extremidades 5’ ou 3’ ORESTES (ESTs ricas em ORFs) – seqüenciamento único do amplicon
  56. 56. Micro-arrayBaseado nahibridização desondas de DNA(clones individuais)com cDNA isoladode diferentesformas celulares.Clones individuaissão adsorvidos emuma matriz sólida.
  57. 57. cDNA Microarray PrintingDeposição dos produtos de PCR sobre lâminas de vidro oumembranas de nylon utilizando “Array Spotter Gen. IIIAmersham-Biosciences”
  58. 58. hibridização
  59. 59. Chip de alta densidade
  60. 60. Forno de hibridação
  61. 61. Hibridação e lavagem automática Hibridações de lâminas é realizada no módulo ASP (automated slyde processor). A hibridação de mambranas de nylon é realizada em forno de hibridação
  62. 62. Histórico do sequenciamento de genomas1977- bacteriófago phi-x174 (5386bp) foi 1. organismo sequenciado. Sanger et al [Nature 246, 687 (1977)].1982- bacteriophage lambda (48,502bp) Sanger et al [J. Mol. Biol. 162, 729 (1982)]anos 80 - genoma mitocondrial, 16kb; Epstein Barr virus, 172kb; human cytomegalovirus, 229kb1980’s- final: desenvolvimento de sequenciadores automáticos1991- menos de 2,000 gens de proteinas humanas conhecidos1995- 1o. genoma de um organismo de vida livre 1995 bactéria Haemophilus influenzae Rd KW20- 1,8 Mbases
  63. 63. 2004 – 160 genomas bacterianos completos, de 130 espécies 19 genomas de archae completos 28 genomas de eucariotos, completos, ou alguns cromossomas completos cromossomas completos, incluindo: • homem • camundongo (rato sendo sequenciado) • 3 plantas: Arabidopsis thaliana e 2 variedades de arroz • 2 peixes • 6 protozoários • 3 artrópodos incluindo Drosophila melanogaster • 6 fungos • nematódios, alga, cryptomonas
  64. 64. Dados sobre composição do genoma: grande extensão de introns x exons Gen humano típico: 5 ou 6 introns, tamanho médio dos introns: 2100bp (alguns com 100000 bp) tamanho médio dos exons: 125bp Exons de gens celulares: 5% genoma humano
  65. 65. Dados sobre composição do genoma: tamanho e número de gensHomem: 30.000 gens 2,8 x 109 bpArroz (Oryza sativa): 20.000 gens 3,7 x 108 bpDrosophila melanogaster:13.600 gens 1,8 x 108 bpEscherichia coli: 5.300 gens 4,6 x 106 bp Comparando Homem e E. coli tem-se que: número de gens: 5,7x tamanho do DNA: 610 x
  66. 66. Genômica x ProteômicaA Genômica possibilitou o sequenciamento de alta performance de diferentes gens de diversos organismos. Porém não resolveu questões importantes relativo á função de várias proteínas. “Podemos ver o Genoma como a descoberta dos hieróglifos que ainda necessitam ser decifrados”
  67. 67. Um gen  vários produtos !questão 1: 1 transcrito primário podendo corresponder amais de um mRNA, e portanto mais de uma proteinaquestão 2: 1 mRNA não sendo eficientemente traduzido,como ocorre em alguns casos de transferência lateralquestão 3: alguns RNAs ficam longo tempo sem sertraduzidos em células eucarióticasquestão 4: processamento pós-traducional: várias proteinas,com atividade distinta, vindo do mesmo gen
  68. 68. Pos-Genômica  Genomica Funcional Genomica Estrutural Proteômica Gel Electroforese 2D Crystallografia deDNA-Microarray Espectrometria de Massa X Ray Sequenciamento de Proteina NMR Sequência - Forma - Função
  69. 69. Rede Proteômica Problemas BiológicosGel 2D Cromatografia Gel 2D Gel 2D Gel 2D Maldi - Tof Bioinformatica Maldi - Tof MS-MS: ESI-Q-Tof Microarray MALDI TOF-TOF Expressão Purificação de Proteína Cristalização NMR X- rays
  70. 70. ProteomaLevantamento quantitativo de proteínas/peptídeos em umaamostra para identificar mudanças de interesse Proteoma Genoma Proteínas e peptídeos DNA Dinâmico Estático Células e tecido específicos Orgão específico
  71. 71. Abordagens em Proteômica Proteômica de Expressão – Expressão Diferencial Proteômica Funcional – Interação Proteina-Proteina – Vias de Sinalização – Modificação Pós- traducional Proteômica Quantitativa
  72. 72. Separação e preparo de amostra Digestão - tripsina Peptídeo Separação
  73. 73. Esquema geral de identificação de proteínas
  74. 74. Aplicações:- Descoberta de novas drogas,- Estudos em patologia,- Diagnóstico,- Terapias,- Microbiologia,- Bioquímica,- Fisiologia de plantas,- Controle de qualidade.
  75. 75. 2D-gel, V. cholerae El Tor N16961 strain
  76. 76. Mapa de referência de Vibrio cholerae El Tor com 94 spots
  77. 77. Identification of spots by peptide mass fingerprint: 94 spots, corresponding to 80 proteins Main cellular roles spots proteins found: Energy metabolism 36 28 (TCA cycle) (9) (8) (glycolysis/gluconeogen (11) (7) esis) Transport and binding 16 13 proteins (Solute-binding protein (15) (12) of ABC transporters) (other transporters) (1) (1)
  78. 78. Spot 24, 28, 29, 30, 31, 32, 77, 90, 93 and 96 kDa Metalloproteinase (PIII) B.insularis 4 7 94,0- Spots 255, 260, 261, 262 and 268 Metalloproteinase (PI) B.insuaris 67,0- Spot 258 Serine proteinase B. 43,0- insularis Spot 386 and 394 Phospholipase A2 B. insularis 30,0- Spot 356 Metalloproteinase (Agkistrodon contortrix laticinctus) 20.1- Spot 412 Anticoagulant protein A [Deinagkistrodon acutus] Spot 428 Convulxin beta [Crotalus 14.4- durissus] Spot 444 Unnamed Protein Product (Mus Musculus) Spot 474 433 e 434 489 Spot 375, 435 e 459 Spot 427, 429 e 467 Vascular endothelial Agkisacutacin B chain BJcuL precursor Platelet glycoprotein Ib-binding Lectin [Bitis arietans] growth factor[Deinagkistrodon acutus] [B. jararacussu]. protein alpha subunit [B. jararaca]
  79. 79. Análise de Peptídeos: Peptidomics• A eletrofores bidimensional separa proteínas entre 10 kDa e 200 kDa: Proteínas maiores ou menores não são detectadas;• Para análise de peptídeos dependendo da amostra podemos analisar diretamente no MALDI-TOF, ou ainda fazer uma separação prévia e analisar frações cromatográficas contendo peptídeos.
  80. 80. B. insularis crude venom MALDI-TOF/MS 4700 Reflector Spec #1[BP = 1370.7, 16470] 1370.7482 100 1.6E+4 90 80 70 60 50% Intensity 1196.6423 40 1279.7783 30 20 1392.7262 1218.6238 10 1414.7090 0 1100 1180 1260 1340 1420 1500 Mass (m/z)
  81. 81. Crude venom direct analysis in MALDI- TOF 4700 MS/MS Precursor 1373.72 Spec #1=>BC=>NF0.7[BP = 1161.5, 46639] 1161.5211 4700 Reflector Spec #1=>BC=>NF0.7[BP = 1087.6, 36679] Lachesis muta MS/MSI 1373 100 P G H /L P P 90 100 1087.6228 3.7E+4 80 90 70 80 60 70 1277.6161 1373.7229% Intensity 60 50 50 % Intensity 40 40 1244.6398 1404.7640 1048.4594 851.4226 30 30 1133.5608 911.4136 1169.5776 1373.5835 1258.6473 20 20 1037.5443 639.3297 1101.5996 1063.5736 774.3678 1370.7004 1144.6414 1299.6952 956.5493 1395.7002 1409.7925 10 10 0 0950 1060 1170 1280 1390 1500 610 778 946 Mass (m/z) 1114 1282 1450 Mass (m/z) qkpwppghipp Peptídeo potenciador de bradicinina
  82. 82. Spots only visible in logaritmic or stationary cells (arrows), indicating different protein expression along growth curve. Some common spots varied in intensity with growth phase.6.1 6.4 6.1 6.4~16kD ~16kD

×