Aula molecular 1

1.749 visualizações

Publicada em

0 comentários
4 gostaram
Estatísticas
Notas
  • Seja o primeiro a comentar

Sem downloads
Visualizações
Visualizações totais
1.749
No SlideShare
0
A partir de incorporações
0
Número de incorporações
3
Ações
Compartilhamentos
0
Downloads
42
Comentários
0
Gostaram
4
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Aula molecular 1

  1. 1. Dra. Adriana Cibele de Mesquita DantasEngenharia de Bioprocessos e Biotecnologia UERGS, Bento Gonçalves, RS
  2. 2. Taxonomia e evolução•classificação de organismos é um aspecto fundamental de biologia• noção consistente que um esquema de classificação deveria refletir a ‘ordem natural • inicialmente era considerado que Deus era o princípio de ordenação• Darwin enfatizou que o princípio de ordenação deveria ser compartilhado descida de antepassados comunsSpecies Plantarum - 1753 Carl Linnaeus introduziu o binômio (gênero-espécies) sistema de classificação- “ad majorem Dei gloriam” (para a maior glória de Deus) Classificação de planta baseado somente em órgãos sexuais Origin of Species - 1859
  3. 3. DARWIN
  4. 4. O Tamanho das células
  5. 5. Formas e Funções
  6. 6. Célula animalCélula vegetal Célula bacteriana
  7. 7. Genética Mendeliana• Gregor Mendel (1822-1884), monge austríaco, é considerado o “pai da genética”.• Desenvolveu seus trabalhos com plantas de ervilha (Pisun sativum) observando a transmissão hereditária de várias características.• Em 1865 publicou o artigo "Experiments with Plant Hybrids" que foi ignorado.• A partir de 1900 vários pesquisadores confirmaram seus resultados.• Suas duas leis ainda hoje são base para os estudos genéticos.
  8. 8. Por que ervilhas?• Fácil cultivo em canteiros.• Várias características contrastantes e de fácil observação.• Ciclo vital curto e grande número de descendentes (sementes).• Predomina reprodução por autofecundação, portanto linhagens naturais são puras.
  9. 9. 1a Lei de Mendel“Pureza dos Gametas” “As características dos indivíduos são condicionadas por pares de fatores (genes), que se separam durante a formação dos gametas, indo apenas um fator do par para cada gameta”.
  10. 10. Versuche überPflanzen HybridenAnotações de Resultados
  11. 11. G. MendelAs características herdadas dospais não se fundem, mas sãoherdadas como unidadesdiscretas de informação que semantêm íntegras ao longo dasgerações GeneUnidade de informação que transmiteas características hereditárias de umageração para a seguinte
  12. 12. Conceito Gerais• Gene: fragmento de DNA que pode ser transcrito na síntese de proteínas.• Locus (Loco): local, no cromossomo, onde se encontra o gene.• Alelos: genes que ocupam o mesmo locus em cromossomos homólogos.• Homólogos: cromossomos que possuem genes para as mesmas características.
  13. 13. •Genótipo: conjunto de genes de umindivíduo.•Fenótipo: características observáveis deuma espécie, que são determinadas por genese que podem ser alteradas pelo ambiente•Gene Letal: com efeito mortal.
  14. 14. •Gene Dominante: aquele que sempre que estápresente se manifesta.•Gene Recessivo: aquele que só se manifesta naausência do dominante.•Homozigoto ou Puro: indivíduo que apresentaalelos iguais para um ou mais caracteres.•Heterozigoto ou Híbrido: indivíduo que apresentaalelos diferentes para um ou mais caracteres.
  15. 15. • Os caracteres biológicos são determinados por GENES ou FATORES ( segundo Mendel ) existentes nos CROMOSSOMOS e são transmitidos de uma geração para outra por meio dos GAMETAS durante a reprodução.• Os genes que o indivíduo possui para uma determinada característica constituem o GENÓTIPO, e o referido CARÁTER em interação com o meio constitui o FENÓTIPO.
  16. 16. MODELO DO DNA:• Watson e Crick propuseram, em 1953, um modelo de molécula de DNA, que seria em DUPLA HÉLICE e em ESPIRAL, com duas cadeias de nucleotídeos ligados por PONTES DE HIDROGÊNIO.
  17. 17. Informações disponíveis, quais eram:1- a molécula de DNA era grande, longa, fina e composta de nucleotídeos: adenina; guanina; timina e citosina;2- Os estudos de difração de raios X, realizados por Maurice King e Rosalind Franklin sugeriam a forma helicoidal;3- Linus Pauling (1950), descreveu a estrutura helicoidal com um filamento mantida por pontes de hidrogênio em proteínas e sugeriu que o mesmo pudesse ocorrer com o DNA;4- Erwin Chargaff havia demonstrado que a proporção entre os nucleotídeos A e T era de 1:1, o mesmo acontecendo entre G e C.
  18. 18. Difração de Raios-X Estrutura Molecular 34A
  19. 19. DNA ou ADN O Ácido Desoxirribonucléico é um polinucleotídeo formado por duas “fitas” ou hélices ligadas entre si por pontes de hidrogênio entre as bases nitrogenadas. O pareamento das bases sempre segue a mesma ordem: Adenina com Timina e Guanina com Citosina.
  20. 20. Ligações entre Nucleotídeos Polímero longo: Base 1 1. A ligação entre a base Pentose nitrogenada e a pentose é feita covalentemente através de uma ligação N-glicosídica com a hidroxila ligada ao carbono-1 da pentose. 4 1 2 2 •2. Os nucleotídeos são unidos por ligações fosfodiéster covalentes que ligar o carbono 5´de um grupo desoxirribose (pentose + base) ao carbono 3´do próximo
  21. 21. • James Watson e Francis Crick (1953)• um modelo de molécula de DNA, que seria em DUPLA HÉLICE e em ESPIRAL, com duas cadeias de nucleotídeos ligados por PONTES DE HIDROGÊNIO.
  22. 22. Portanto: : 1) ÁCIDOS NUCLEICOS são compostos por nucleotídeos ligados entre si através de ligação covalente. 2) NUCLEOTÍDEOS são as unidades fundamentais dos ácidos nucleicos. Cada nucleotídeo é constituído por um grupo fosfato, uma pentose e uma base. Purinas: Adenina, Guanina BASESDNA ≠ RNA Pirimidinas: Citosina, Timina, Uracila
  23. 23. Bases Nitrogenadas Adenina Guanina PurinasCitosina Timina Uracil Pirimidinas
  24. 24. A Importância do DNA-Transportar muita informação, de célula para célula e de geraçãopara geração;-Capacidade de produzir cópias exatas de si mesmo, pois oscromossomos são copiados em cada divisão celular;-Capacidade de “replicar erros” de cópia, como se fossem o geneoriginal;-Apresenta mecanismo de decodificação da informaçãoarmazenada, traduzindo-as através da produção deenzimas/proteínas;-O DNA é chamado de “molécula da vida” pois contém o códigopra construção das proteínas em todos os seres vivos;-Nos eucariontes, o DNA é encontrado no núcleo celular formandoos cromossomos e também nas mitocôndrias e nos cloroplastos;-Nos procariontes encontra-se uma molécula de DNA circular(cromossomo bacteriano) e outras moléculas circulares chamadasplasmídeos;
  25. 25. DNARNA
  26. 26. O RNA ou ARNO Ácido Ribonucléico é um polinucleotídeo que difere do DNAem três aspectos básicos: DNA • O açúcar é uma Ribose; A-T T-A • É formado, geralmente, G-C C-G por uma fita simples que pode enrolar-se; • Não existe a base pirimídica Timina e no RNA seu lugar se encontra a A-U base Uracila. U-A • Os pareamentos G-C C-G seguem a ordem A-U e G-C).
  27. 27. Tipos de RNA• RNAm  O RNA mensageiro é formado no núcleo e contém a “mensagem” - o código transcrito a partir do DNA - para a síntese das proteínas. Cada conjunto de três nucleotídeos no RNAm é chamado de CÓDON.• RNAt  O RNA transportador está presente no citoplasma e é responsável pelo transporte dos aminoácidos até os ribossomos para a síntese protéica. No RNAt existe uma seqüência de nucleotídeos correspondente ao códon chamada de ANTI-CÓDON.• RNAr  O RNA ribossômico ou ribossomal faz parte da estrutura dos ribossomos e participa do processo de tradução dos códons para construção das proteínas.
  28. 28. Wilkins, Perutz, Crick, Steinbeck, Watson, Kendrew
  29. 29. ProteínasEstruturaisTransporteEnzimasHormôniosAnticorposReceptoresFatores de crescimentoMediadores inflamatórios
  30. 30. AminoácidosGlicina Cisteína GlutaminaAlanina Serina AsparaginaLeucina Tirosina FenilalaninaIsoleucina Metionina TriptofanoValina Treonina Ac. AspárticoHistidina Lisina Ac. GlutâmicoProlina Arginina Proteínaaa aa aa aa aa aa aa aa
  31. 31. GenesCaracterísticas físicas oubioquímicas observáveis
  32. 32. GenesEstrutura das proteínasCaracterísticas físicas oubioquímicas observáveis
  33. 33. GenesSeqüência de aminoácidos nas proteínas Estrutura das proteínasCaracterísticas físicas oubioquímicas observáveis
  34. 34. REPLICAÇÃO TRANSCRIÇÃO TRADUÇÃO
  35. 35. DOGMA CENTRAL genes ambiente FENÓTIPODNA armazena RNA transfere Proteína executaa informação a informação a função
  36. 36. DUPLICAÇÃO EUCARIOTOS(= Replicação = DNA → DNA) 5´ 3´ (Delta) 3´ 5´ 3´5´ (Alfa)
  37. 37. Forquilha de replicação
  38. 38. TRANSCRIÇÃO Promotor: Região que sinaliza o início da transcrição (Sequências específicas do DNA reconhecidas pelos fatores de transcrição (proteínas) e pela RNA polimerase) “Sequência consenso”
  39. 39. ORGANIZAÇÃO GENÔMICA DE EUCARIONTES cromossomo de 1,5 x 108 pb, contendo ~ 3.000 genes 0,5% do cromossomo, contém ~ 15 genes 1 gene de 105 pbSeqüência regulatória Transcrição DNA Transcrito de RNA primário Seqüência de intron Seqüência de exon
  40. 40. ORGANIZAÇÃO GENÔMICA DE PROCARIONTES E EUCARIONTESPROCARIONTES Archaebacteria Eubacteria CianobactériasEUCARIONTES Protistas Fungos Vegetais Animais VÍRUS DNA Vírus RNA Vírus
  41. 41. ORGANIZAÇÃO GENÔMICA DE EUCARIONTES -Envoltório Nuclear (Carioteca) -Cromatina (Eucromatina, heterocromatina) - Vários cromossomos diplóides -DNA linear, dupla fita -Complexado com proteínas (Histonas e não histonas) - Grande parte do DNA não é codificado (íntrons e éxons) Funções: - condensação, -pode influenciar na atividade celular
  42. 42. ORGANIZAÇÃO GENÔMICA DE PROCARIONTES Escherichia coli - 1 cromossomo (DNA circular, dupla fita) Elementos genéticos móveis (plasmídeo, bacteriófagos, transposons)- Cromossomo e Plasmídeo possuem replicação independente- Organização genômica mais simples, compactação com proteínas- Quase todo o DNA é codificante- Os genes são organizados em “Operons”- Os genes de um operon são transcritos em um único RNAm (policistrônico)
  43. 43. Síntese de DNA em ProcariontesOrigem da replicaçãoForquilhas dereplicação O ponto de origem da replicação é denominado oriC. Fitas novasFitas velhas A replicação é bidirecional: as duas fitas se separam na origem, sendo, a partir daí, copiadas simultaneamente em direções opostas.
  44. 44. TRANSCRIÇÃO : EUCARIOTO X PROCARIOTOEUCARIOTOS PROCARIOTOS
  45. 45. DNACTC ATT GTG CTT GAA TTT TTG GTG mRNAGAG UAA CAC GAA CUU AAA AAC CAC Proteínaaa aa aa aa aa aa aa aa
  46. 46. O que são os cromossomos e o que eles contém? Contem o DNA que é constituído por nucleotídeos
  47. 47. C T G G A C TCCTGATGGATCGCGTACGTTGTACGCACAGTGTCGAAAAAGCATACGGGGACTGCACGTACACGTAGCACGGCGTCGATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
  48. 48. CCTGATGGATCGCGTACGCCATATTTGTACGCACAGTGTCGAAAAAGCATACGGGGACTGCACGTACACGTAGCACGGCGTCGATTTTATAATGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGTGTGGATGGATCGCGGCAGTTGTACGCACAGTGTCGAACAAGCATACGGGGACTGCACCCCGATGTAGCACGGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCTGAGTGAAGGATCAGTGCAGCGTGGAGCGCGCATGAAAACACACATTGTATCGACAGTTGTACGCACAGTGTCGAGGGCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTCGCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGAAGGATCAGTGCAGCGGGCAGATGTAATATATATGATTTGATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
  49. 49. HomemCCTGATGGATCGCGTACGTTGTACGCACAGTGTCGAAAAAGCATACGGGGACTGCACGTACACGTAGCACGGCGTCGATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT BactériaGTGGATGGATCGCGGCAGTTGTACGCACAGTGTCGAACAAGCATACGGGGACTGCACCCCGATGTAGCACGGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCTGAGTGAAGGATCAGTGCAGCGTGGAGCGCGCATGAAAAATAGGA VírusCACACATTGTATCGACAGTTGTACGCACAGTGTCGAGGGCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTCGCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGAAGGATCAGTGCAGCGGGCAGATGTAATATATATGATTT
  50. 50. TAMANHO DO GENOMAHomem 3.200.000.000 basesRato 3.000.000.000 basesDrosophila 160.000.000 basesArabidopsis 135.000.000 basesS. cerevisae 13.000.000 basesX. fastidiosa 2.679.572 basesH. influenzae 1.830.000 basesM. pneumoniae 810.000 basesHTLV-II 8.952 bases
  51. 51. 300 kb 0,5 kb CCTCGACTTCAGGGAT GGGATCATTTATTCAGGGATAACCCTCGACTTCAGGGAT CATTTATTCAGGGAT
  52. 52. CCTCGACTTCAGGGATGGGATCATTTATTCAGGGAT
  53. 53. CCTCGACTTCAGGGAT GGGATCATTTATTCAGGGAT
  54. 54. CCTCGACTTCAGGGAT GGGATCATTTATTCAGGGAT
  55. 55. AACCCTCGACTTCAGGGAT CCTCGACTTCAGGGAT GGGATCATTTATTCAGGGAT
  56. 56. AACCCTCGACTTCAGGGAT CCTCGACTTCAGGGAT GGGATCATTTATTCAGGGAT CATTTATTCAGGGAT AACCCTCGACTTCAGGGATCATTTATTCAGGGAT
  57. 57. CCTGATGGATCGCGTACGCCATATTTGTACGCACAGTGTCGAAAAAGCATACGGGGACTGCACGTACACGTAGCACGGCGTCGATTTTATAATGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGTGTGGATGGATCGCGGCAGTTGTACGCACAGTGTCGAACAAGCATACGGGGACTGCACCCCGATGTAGCACGGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCTGAGTGAAGGATCAGTGCAGCGTGGAGCGCGCATGAAAACACACATTGTATCGACAGTTGTACGCACAGTGTCGAGGGCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTCGCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGAAGGATCAGTGCAGCGGGCAGATGTAATATATATGATTTGATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
  58. 58. mRNAProteína
  59. 59. Exons Introns
  60. 60. CCTGATGGATCGCGTACGCCATATTTGTACGCACAGTGTCGAAAAAGCATACGGGGACTGCACGTACACGTAGCACGGCGTCGATTTTATAATGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGTGTGGATGGATCGCGGCAGTTGTACGCACAGTGTCGAACAAGCATACGGGGACTGCACCCCGATGTAGCACGGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCTGAGTGAAGGATCAGTGCAGCGTGGAGCGCGCATGAAAACACACATTGTATCGACAGTTGTACGCACAGTGTCGAGGGCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTCGCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGAAGGATCAGTGCAGCGGGCAGATGTAATATATATGATTTGATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
  61. 61. CCTGATGGATCGCGTACGCCATATTTGTACGCACAGTGTCGAAAAAGCATACGGGGACTGCACGTACACGTAGCACGGCGTCGATTTTATAATGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGTGTGGATGGATCGCGGCAGTTGTACGCACAGTGTCGAACAAGCATACGGGGACTGCACCCCGATGTAGCACGGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCTGAGTGAAGGATCAGTGCAGCGTGGAGCGCGCATGAAAACACACATTGTATCGACAGTTGTACGCACAGTGTCGAGGGCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTCGCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGAAGGATCAGTGCAGCGGGCAGATGTAATATATATGATTTGATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
  62. 62. CCTGATGGATCGCGTACGCCATATTTGTACGCACAGTGTCGAAAAAGCATACGGGGACTGCACGTACACGTAGCACGGCGTCGATTTTATAATGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGTGTGGATGGATCGCGGCAGTTGTACGCACAGTGTCGAACAAGCATACGGGGACTGCACCCCGATGTAGCACGGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCTGAGTGAAGGATCAGTGCAGCGTGGAGCGCGCATGAAAACACACATTGTATCGACAGTTGTACGCACAGTGTCGAGGGCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTCGCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGAAGGATCAGTGCAGCGGGCAGATGTAATATATATGATTTGATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
  63. 63. CCTGATGGATCGCGTACGCCATATTTGTACGCACAGTGTCGAAAAAGCATACGGGGACTGCACGTACACGTAGCACGGCGTCGATTTTATAATGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGTGTGGATGGATCGCGGCAGTTGTACGCACAGTGTCGAACAAGCATACGGGGACTGCACCCCGATGTAGCACGGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCTGAGTGAAGGATCAGTGCAGCGTGGAGCGCGCATGAAAACACACATTGTATCGACAGTTGTACGCACAGTGTCGAGGGCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTCGCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGAAGGATCAGTGCAGCGGGCAGATGTAATATATATGATTTGATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
  64. 64. CCTGATGGATCGCGTACGCCATATTTGTACGCACAGTGTCGAAAAAGCATACGGGGACTGCACGTACACGTAGCACGGCGTCGATTTTATAATGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGTGTGGATGGATCGCGGCAGTTGTACGCACAGTGTCGAACAAGCATACGGGGACTGCACCCCGATGTAGCACGGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCTGAGTGAAGGATCAGTAGGTCGTGGAGCGCGCATGAAAACACACATTGTATCGACAGTTGTACGCACAGTGTCGAGGGCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTCGCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGAAGGATCAGTGCAGCGGGCAGATGTAATATATATGATTTGATTTTGACGTGCACGTGTCAGTGCGATGAAGGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
  65. 65. CCTGATGGATCGCGTACGCCATATTTGTACGCACAGTGTCGAAAAAGCATACGGGGACTGCACGTACACGTAGCACGGCGTCGATTTTATAATGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGTGTGGATGGATCGCGGCAGTTGTACGCACAGTGTCGAACAAGCATACGGGGACTGCACCCCGATGTAGCACGGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCTGAGTGAAGGATCAGTAGGTCGTGGAGCGCGCATGAAAACACACATTGTATCGACAGTTGTACGCACAGTGTCGAGGGCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTCGCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGAAGGATCAGTGCAGCGGGCAGATGTAATATATATGATTTGATTTTGACGTGCACGTGTCAGTGCGATGAAGGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
  66. 66. Síntese Protéica A Tradução • O RNAm transcrito no núcleo chega ao citoplasma e se liga a um ou mais ribossomos. • O ribossomo “lê” o primeiro códon e um RNAt com o anticódon correspondente transporta um aminoácido e se liga ao códon. • O ribossomo se desloca, no sentido 5’3’ e lê o próximo códon. • Os aminoácidos são unidos por ligações peptídicas. • Ao final da tradução o polipeptídeo se desliga e se constituí na proteína.
  67. 67. Transcrição Gene ativo RNA polimerase 5’ T G CA C 3’ A 3’ ATGGC A AU TACCG GC A T TA 3’ C G T 5’ 5’ C AU GG DNA - Fita moldeMolécula de RNA nascente complementar a fita molde•Fita única•No lugar da Timina haverá uma Uracila
  68. 68. Tradução Cada códon é traduzido num AA específico AA livre Ribossomo His Gly Phe GluProteína Asp Met Ala Cys tRNA 5’ 3’ AUGGCAUGCGACGAAUUCGGACACAUAMolécula de mRNA codon Direção do avanço do ribossomo
  69. 69. Gly His Phe Glu Asp Met Ala Cys5’ 3’ AUGGCAUGCGACGAAUUCGGACACAUA
  70. 70. Ile Met His Ala Gly Cys Asp Glu Phe5’ 3’ AUGGCAUGCGACGAAUUCGGACACAUA
  71. 71. Met Ala Cys Asp Glu Asn Phe Gly His Ile Lys Leu Met5’ 3’ GACGAAUUCGGACACAUAAAAUUAAUG
  72. 72. Ala Cys Asp Glu Phe Met Gly His Ile Lys Leu Met Asn Pro Gln5’ STOP 3’ AUAAAAUUAAUGAACCCACAAUAATAC
  73. 73. Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn Met5’ 3’ AUAAAAUUAAUGAACCCACAAUAATAC RNAm será degradado
  74. 74. Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn MetPROTEÍNA NORMAL
  75. 75. Exemplo hipotético de uma mutação pontual Gene Normal = Proteína Normal 5’ T G CA C 3’ ATGGC A A TACCG T T A C G T 3’ 5’ 3’ 5’ AUGGCAUGCGACGAAUUCGGACACAUA mRNA AlaninaGene Mutado =Proteína Anormal - G T 5’ T G CA C 3’ A ATGGA A TACCT TA T 3’ C G T 5’ 5’ 3’ AUGGAAUGCGACGAAUUCGGACACAUA mRNA Acido Glutâmico
  76. 76. Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn Met e p Glu Ph G ly As sPROTEÍNA NORMAL Cy His Glu I le t Lys Me Leu G ln t ro P sn Me A PROTEÍNA DEFEITUOSA
  77. 77. Genoma Vegetal
  78. 78. Os vegetais são constituídos de três genomas: genomas- O genoma do cloroplasto tem uma estrutura muito conservada 120-217kb que inclui 110-113 gene;- O genoma da mitocondria é maior de 300-600kb e contêm perto de 60 genes, é um genoma muito dinâmico já que ganha e perde facilmente seqüências nucleares e do cloroplasto. 5 1 genoma nuclear genoma cloroplasto genoma mitocondrial 90
  79. 79. Genoma nuclearParadoxo do valor C (DNA haplóide) = pares de base- Não existe correlação entre o tamanho do nuDNA e o número de genes;- Angiospermas – 80% do nuDNA é DNA repetitivo;- Correlação positiva entre a quantidade de seqüências de DNA repetitiva em um genoma e sua quantidade de DNA.
  80. 80. O tamanho do DNA nuclearPlantas superiores - 1,1 x 106 pb a 1,1 x 1011pbAngiospermas – 3 x 108 a 1 x 1011pbOcorre um incremento na escala evolutiva- RNA associado a cromatina (RNA nascentes, presos a fita molde) representa 3% de sua composiçãoO genoma nuclear de Arabidopsis thaliana tem 135Mb = 25.500 gens.Do arroz (Oryza sativa) tem se seqüenciado duas variedades e seu genomaé quase 4 vezes maior que o de A. thaliana e compreendem de 32.000 a55.615 genes.Para o milho (Zea mays), embora não seqüenciado, se conhece muitainformação estima-se que 60 a 80% de seu genoma nuclear esta constituídopor elementos móveis
  81. 81. Organização do genoma nuclear
  82. 82. ORGANIZAÇÃO E EVOLUÇÃO DAS SEQÜÊNCIAS REPETITIVASTrês graus de repetição:Cópia única – cada seqüência de nucleotídeo só se encontra uma vez porgenoma haplóide, pertence a > dos genes que codificam proteínas. É abundantecerca de 58% no genoma dos mamíferos e 33% em células vegetaisMediamente repetitivos – apresenta seqüências nucleotídecas que se repetemum moderado número de vezes. É menos abundante que os de cópia única e asua proporção aumenta na escala evolutiva – são genes que codificam o RNAribossômico e histonas – encontrado mais de 100 cópias por genoma haplóidede genes do RNA ribossômico (rRNA)Altamente repetitivos – seqüências nucleotídecas altamente redundantes,acima de 10.000 cópias de cada gene, seqüências curtas e restritas a regiõesespecíficas do genoma constituem o chamada DNA satélite
  83. 83. DNA SATÉLITE(PROPORÇÃO SEPARÁVEL INCOMUM DE NUCLEOTÍDEOS)O DNA satélite foi descoberto em 1960.- banda principal contendo genes;-bandas secundárias, bandas satélites. seqüências de DNA repetidas;- Representa a maioria das famílias de seqüências altamente repetitivas nosgenomas eucarióticos;-Composta por fragmentos DNA repetitivos cerca de 150 a 500 pb-Encontrada próximo ao telômero e centrômeros vegetais Função: Recombinação – rearranjos no genoma (expandir-se ou contrair-se) Sem função – sujeitas a seleção neutra
  84. 84. DNA ribossomal (rDNA)- Outra porção do DNA repetitivo encontrado no encontrado no nuDNA;- Constituida de três genes: 18S, 5,8S e 26 S;- Rearranjados em tandem e as unidades ribossomais (rDNA) também é repetido em tandem;- Estas unidades estão associadas às regiões organizadoras do nucléolo (NORs)NORs: porções de fibras cromatínicas onde estão os genes que codificam os rRNAs O número de NORs varia de espécie para espécie
  85. 85. Tamanho da unidade ribossomal- Com espaços intergênicos, varia de 7,8 kb a 18,5 kb, com numero de cópias que pode variar de 600 a 8500/ genoma haplóide- A unidade ribossomal é constituída pelos genes 18S, 5,8S e 28S e dos espaçadores transcritos internos (ITS) que intercalam os genes;- A sigla IGS indica o espaço intergênico, separa as unidades ribossomais;- RNA ribossomal 5S (5S rDNA); 140 a 900pb, cada unidade de repetição pode variar de 1 mil a 50 mil cópias por genoma haplóide;- Em plantas as seqüências ITS variam em comprimento de ≈ 500-700pb em angiospermas e 1500-3700pb em algumas gimnospermas
  86. 86. Genoma Extranuclear- Os cromossomos das mitocôndrias e dos cloroplastos apresentam padrão de organização e herança bem diferente dos cromossomos nucleares;- Os genes extranucleares também chamados genes citoplasmáticos;- A maioria das proteínas das mitocôndrias e dos cloroplastos são codificadas pelo DNA nuclear e importados do citosol para s organelas;- O tráfego das proteínas do citosol para as organelas é unidirecional;- O DNA das organelas celulares são circulares;- São relativamente pequenas e simples;- Não ocorre recombinação (somente mutação);- Herança não-mendedliana (citoplasmática, herança da mãe) Marcador de linhagem materna.
  87. 87. O genoma cloroplasto • Sequencia no genoma varia de 70kb - 201kb • 100-250 genes: – Gene expressos – Fotossíntese – 20 genes – Metabolismo Sequenciamento completo: Tabaco - 155,844 pb; Arroz -134,525 pb
  88. 88. O Genoma do cloroplasto codifica várias proteínas e RNAs• Cloroplastos apresentam DNA com tamanho variado: 120-190 kb• codifica todos os rRNAs e tRNAs necessários para a síntese protéica, e aproximadamente 50 proteínas• os genes da organela podem ser transcritos e traduzidos pelo aparato da mesma
  89. 89. GENOMA MITOCONDRIAL
  90. 90. • mitocondrias mostram tamanhos variados de genoma – o número de genes codificadores de proteínas é pequeno – a maior parte é codificadora de componentes das subunidades dos complexos da respiração I-IV – genes codificadores de RNA• Genoma mitocondrial apresenta introns, exceto nos mamíferos
  91. 91. • Tamanho do mtDNA •Humanos e outrros vertebrados ~16 kb (todos genes mtDNA codificam produtos) •Leveduras ~80 kb •Plantas ~100 kb to 2 Mb (muitos genes mtDNA não codificam produtos) Aplicação: • Análise maternal • Filogenia Sistemática •Genética de populações •Teste forensi (maternal ID)
  92. 92. Marchantia polymorpha – 121Kb136 genes: 4 rRNA, 29tRNA90 genes codificadores de proteínas - destes 20 estão envolvidas notransporte de elétrons durante a fotossíntese
  93. 93. Genômica?• Genomica é estudo de todos os genes em um organismo……..• Proteomics é estudo de todas as proteínas…..• Metabolomics isé o estudo de todas as vias metabólicas…
  94. 94. Plantas Modelos • Arabidiopsis thaliana --modelo florescimento e dicotiledônea • Oryza sativa (rice) --modelo monocotiledônea • Medicago truncatula (barrel medic) --modelo leguminosas • Lycopersicon esculentum (tomato) --modelo de frutificaçãoTambém, milho, tabaco, trigo, etc.…
  95. 95. Arabidopsis thalianaModelo de genoma em plantasRapido crescimentoBrassicaceaeGenome: 125 Mb ( muito pequeno )Cromossomos: 5Genes: 25,498Website: http://www.arabidopsis.org
  96. 96. Oryza sativaGenome: 430 Mb (1/8 do genoma humano)Um dos menores genomas de gramíneasCromossomos: 12Genes: ~ 50,000 (mais do que genomahumano)http://www.usricegenome.org

×